ID: 1135801787

View in Genome Browser
Species Human (GRCh38)
Location 16:25504048-25504070
Sequence GATTGCTGCAAAACCTAAGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1135801787_1135801790 -4 Left 1135801787 16:25504048-25504070 CCATCTTAGGTTTTGCAGCAATC No data
Right 1135801790 16:25504067-25504089 AATCACCCTGGGTACACATATGG No data
1135801787_1135801796 26 Left 1135801787 16:25504048-25504070 CCATCTTAGGTTTTGCAGCAATC No data
Right 1135801796 16:25504097-25504119 AATGAAGAGGTAAGCACTGGAGG No data
1135801787_1135801793 3 Left 1135801787 16:25504048-25504070 CCATCTTAGGTTTTGCAGCAATC No data
Right 1135801793 16:25504074-25504096 CTGGGTACACATATGGAGAATGG No data
1135801787_1135801794 13 Left 1135801787 16:25504048-25504070 CCATCTTAGGTTTTGCAGCAATC No data
Right 1135801794 16:25504084-25504106 ATATGGAGAATGGAATGAAGAGG No data
1135801787_1135801795 23 Left 1135801787 16:25504048-25504070 CCATCTTAGGTTTTGCAGCAATC No data
Right 1135801795 16:25504094-25504116 TGGAATGAAGAGGTAAGCACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1135801787 Original CRISPR GATTGCTGCAAAACCTAAGA TGG (reversed) Intergenic
No off target data available for this crispr