ID: 1135801793

View in Genome Browser
Species Human (GRCh38)
Location 16:25504074-25504096
Sequence CTGGGTACACATATGGAGAA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1135801786_1135801793 9 Left 1135801786 16:25504042-25504064 CCAGCTCCATCTTAGGTTTTGCA No data
Right 1135801793 16:25504074-25504096 CTGGGTACACATATGGAGAATGG No data
1135801787_1135801793 3 Left 1135801787 16:25504048-25504070 CCATCTTAGGTTTTGCAGCAATC No data
Right 1135801793 16:25504074-25504096 CTGGGTACACATATGGAGAATGG No data
1135801781_1135801793 22 Left 1135801781 16:25504029-25504051 CCTCCCAAAGTGCCCAGCTCCAT No data
Right 1135801793 16:25504074-25504096 CTGGGTACACATATGGAGAATGG No data
1135801782_1135801793 19 Left 1135801782 16:25504032-25504054 CCCAAAGTGCCCAGCTCCATCTT No data
Right 1135801793 16:25504074-25504096 CTGGGTACACATATGGAGAATGG No data
1135801785_1135801793 10 Left 1135801785 16:25504041-25504063 CCCAGCTCCATCTTAGGTTTTGC No data
Right 1135801793 16:25504074-25504096 CTGGGTACACATATGGAGAATGG No data
1135801783_1135801793 18 Left 1135801783 16:25504033-25504055 CCAAAGTGCCCAGCTCCATCTTA No data
Right 1135801793 16:25504074-25504096 CTGGGTACACATATGGAGAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1135801793 Original CRISPR CTGGGTACACATATGGAGAA TGG Intergenic
No off target data available for this crispr