ID: 1135803452

View in Genome Browser
Species Human (GRCh38)
Location 16:25520507-25520529
Sequence ACTAGACCGAAGAGTACCCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1135803452_1135803456 9 Left 1135803452 16:25520507-25520529 CCTGGGGTACTCTTCGGTCTAGT No data
Right 1135803456 16:25520539-25520561 GCAGACTATAAACTCCATAGGGG No data
1135803452_1135803454 7 Left 1135803452 16:25520507-25520529 CCTGGGGTACTCTTCGGTCTAGT No data
Right 1135803454 16:25520537-25520559 AGGCAGACTATAAACTCCATAGG No data
1135803452_1135803455 8 Left 1135803452 16:25520507-25520529 CCTGGGGTACTCTTCGGTCTAGT No data
Right 1135803455 16:25520538-25520560 GGCAGACTATAAACTCCATAGGG No data
1135803452_1135803457 14 Left 1135803452 16:25520507-25520529 CCTGGGGTACTCTTCGGTCTAGT No data
Right 1135803457 16:25520544-25520566 CTATAAACTCCATAGGGGCAAGG No data
1135803452_1135803458 21 Left 1135803452 16:25520507-25520529 CCTGGGGTACTCTTCGGTCTAGT No data
Right 1135803458 16:25520551-25520573 CTCCATAGGGGCAAGGATCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1135803452 Original CRISPR ACTAGACCGAAGAGTACCCC AGG (reversed) Intergenic
No off target data available for this crispr