ID: 1135803455

View in Genome Browser
Species Human (GRCh38)
Location 16:25520538-25520560
Sequence GGCAGACTATAAACTCCATA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1135803448_1135803455 24 Left 1135803448 16:25520491-25520513 CCCTCAGTTCTTTCTGCCTGGGG No data
Right 1135803455 16:25520538-25520560 GGCAGACTATAAACTCCATAGGG No data
1135803450_1135803455 23 Left 1135803450 16:25520492-25520514 CCTCAGTTCTTTCTGCCTGGGGT No data
Right 1135803455 16:25520538-25520560 GGCAGACTATAAACTCCATAGGG No data
1135803452_1135803455 8 Left 1135803452 16:25520507-25520529 CCTGGGGTACTCTTCGGTCTAGT No data
Right 1135803455 16:25520538-25520560 GGCAGACTATAAACTCCATAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1135803455 Original CRISPR GGCAGACTATAAACTCCATA GGG Intergenic
No off target data available for this crispr