ID: 1135803458

View in Genome Browser
Species Human (GRCh38)
Location 16:25520551-25520573
Sequence CTCCATAGGGGCAAGGATCA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1135803452_1135803458 21 Left 1135803452 16:25520507-25520529 CCTGGGGTACTCTTCGGTCTAGT No data
Right 1135803458 16:25520551-25520573 CTCCATAGGGGCAAGGATCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1135803458 Original CRISPR CTCCATAGGGGCAAGGATCA TGG Intergenic
No off target data available for this crispr