ID: 1135804674

View in Genome Browser
Species Human (GRCh38)
Location 16:25532015-25532037
Sequence CAGAATCTGCATCTTTAACA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1135804670_1135804674 -6 Left 1135804670 16:25531998-25532020 CCCCAGTCCTACTGAATCAGAAT No data
Right 1135804674 16:25532015-25532037 CAGAATCTGCATCTTTAACAAGG No data
1135804669_1135804674 -1 Left 1135804669 16:25531993-25532015 CCTCACCCCAGTCCTACTGAATC No data
Right 1135804674 16:25532015-25532037 CAGAATCTGCATCTTTAACAAGG No data
1135804671_1135804674 -7 Left 1135804671 16:25531999-25532021 CCCAGTCCTACTGAATCAGAATC 0: 6
1: 95
2: 557
3: 1577
4: 2819
Right 1135804674 16:25532015-25532037 CAGAATCTGCATCTTTAACAAGG No data
1135804672_1135804674 -8 Left 1135804672 16:25532000-25532022 CCAGTCCTACTGAATCAGAATCT 0: 6
1: 98
2: 565
3: 1585
4: 2909
Right 1135804674 16:25532015-25532037 CAGAATCTGCATCTTTAACAAGG No data
1135804668_1135804674 8 Left 1135804668 16:25531984-25532006 CCTCTTGGACCTCACCCCAGTCC No data
Right 1135804674 16:25532015-25532037 CAGAATCTGCATCTTTAACAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1135804674 Original CRISPR CAGAATCTGCATCTTTAACA AGG Intergenic
No off target data available for this crispr