ID: 1135810914

View in Genome Browser
Species Human (GRCh38)
Location 16:25585971-25585993
Sequence TTCCCCGGTGTCTCTAGAGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1135810912_1135810914 -1 Left 1135810912 16:25585949-25585971 CCATAGAAAGTAGAATCTGTAAT No data
Right 1135810914 16:25585971-25585993 TTCCCCGGTGTCTCTAGAGATGG No data
1135810911_1135810914 4 Left 1135810911 16:25585944-25585966 CCAAGCCATAGAAAGTAGAATCT No data
Right 1135810914 16:25585971-25585993 TTCCCCGGTGTCTCTAGAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1135810914 Original CRISPR TTCCCCGGTGTCTCTAGAGA TGG Intergenic
No off target data available for this crispr