ID: 1135814172

View in Genome Browser
Species Human (GRCh38)
Location 16:25616897-25616919
Sequence ACTTGACCTAAGGCAGAGCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1135814172_1135814178 25 Left 1135814172 16:25616897-25616919 CCTTGCTCTGCCTTAGGTCAAGT No data
Right 1135814178 16:25616945-25616967 ATAGCTAAAATGTCCTTTCTGGG No data
1135814172_1135814174 -6 Left 1135814172 16:25616897-25616919 CCTTGCTCTGCCTTAGGTCAAGT No data
Right 1135814174 16:25616914-25616936 TCAAGTCTTCTCCCTCTGTTTGG No data
1135814172_1135814177 24 Left 1135814172 16:25616897-25616919 CCTTGCTCTGCCTTAGGTCAAGT No data
Right 1135814177 16:25616944-25616966 AATAGCTAAAATGTCCTTTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1135814172 Original CRISPR ACTTGACCTAAGGCAGAGCA AGG (reversed) Intergenic
No off target data available for this crispr