ID: 1135815394

View in Genome Browser
Species Human (GRCh38)
Location 16:25627927-25627949
Sequence GTTCTGATGGAGACCATGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1135815394_1135815399 0 Left 1135815394 16:25627927-25627949 CCTTCCATGGTCTCCATCAGAAC No data
Right 1135815399 16:25627950-25627972 TCCTCAGGGAGATAGATTTGAGG 0: 3
1: 30
2: 68
3: 163
4: 336
1135815394_1135815402 24 Left 1135815394 16:25627927-25627949 CCTTCCATGGTCTCCATCAGAAC No data
Right 1135815402 16:25627974-25627996 TCTCCTGTCATCTCCTTGCTGGG No data
1135815394_1135815401 23 Left 1135815394 16:25627927-25627949 CCTTCCATGGTCTCCATCAGAAC No data
Right 1135815401 16:25627973-25627995 ATCTCCTGTCATCTCCTTGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1135815394 Original CRISPR GTTCTGATGGAGACCATGGA AGG (reversed) Intergenic
No off target data available for this crispr