ID: 1135818892

View in Genome Browser
Species Human (GRCh38)
Location 16:25661603-25661625
Sequence CTGTATATATTCAGGGAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1135818892_1135818896 -3 Left 1135818892 16:25661603-25661625 CCTTCCTCCCTGAATATATACAG No data
Right 1135818896 16:25661623-25661645 CAGCAGAGAACAGAAGTTTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1135818892 Original CRISPR CTGTATATATTCAGGGAGGA AGG (reversed) Intergenic
No off target data available for this crispr