ID: 1135822048

View in Genome Browser
Species Human (GRCh38)
Location 16:25692975-25692997
Sequence CGTCAGCACCCCCGACTATG GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 70
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 61}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1135822039_1135822048 16 Left 1135822039 16:25692936-25692958 CCGGAGAGCGGCCAACGGGAGCA 0: 1
1: 0
2: 0
3: 11
4: 70
Right 1135822048 16:25692975-25692997 CGTCAGCACCCCCGACTATGGGG 0: 1
1: 0
2: 0
3: 8
4: 61
1135822043_1135822048 5 Left 1135822043 16:25692947-25692969 CCAACGGGAGCAGCGAGAGGGGC 0: 1
1: 0
2: 1
3: 7
4: 163
Right 1135822048 16:25692975-25692997 CGTCAGCACCCCCGACTATGGGG 0: 1
1: 0
2: 0
3: 8
4: 61

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1135822048 Original CRISPR CGTCAGCACCCCCGACTATG GGG Exonic
912135894 1:106659823-106659845 CATCAGCACTCCAGACCATGAGG - Intergenic
913678600 1:121166334-121166356 CTTCAGCACCCCCGAGTAGCTGG - Intergenic
914030435 1:143953972-143953994 CCTCAGCACCCCCGAGTAGCTGG - Intronic
914159014 1:145113979-145114001 CCTCAGCACCCCCGAGTAGCTGG + Intergenic
917252681 1:173079122-173079144 GGGCAGGACCCCAGACTATGTGG + Intergenic
920465899 1:206184858-206184880 CCTCAGCACCCCCGAGTAGCTGG - Intergenic
923317219 1:232792567-232792589 CCTCAGCACCCCCGAGTAGCTGG - Intergenic
1073289833 10:102408106-102408128 CGCCAGCACCTCCAACTGTGGGG + Intronic
1081869252 11:46375893-46375915 CGTCAGCATGCACGACTATGAGG + Exonic
1082133962 11:48526371-48526393 CCTCAGCACCGCCAACTAAGTGG - Intergenic
1082566979 11:54692757-54692779 CCTCAGCACCACCAACTAAGTGG - Intergenic
1083574196 11:63777610-63777632 AGTCAGCACTCCCAACTATGTGG + Intergenic
1090947266 11:131442069-131442091 CTTCAGCAGCCCCAATTATGCGG + Intronic
1092767017 12:11861970-11861992 AGTCTGCAGCCCCGACTGTGAGG + Intronic
1094602506 12:31922118-31922140 CCTCAGCACCCCCTAGTAGGTGG - Intergenic
1100942050 12:99734406-99734428 CCTCAGCACCCCCGAGTAGCTGG + Intronic
1107787471 13:43970376-43970398 CGTCAGCATGCACGACTATGAGG + Intergenic
1108090201 13:46841517-46841539 CATCAGAACCCCCGAGAATGAGG - Intronic
1113696807 13:112352406-112352428 CGTCAGGACCCCAGACTACAGGG + Intergenic
1118327663 14:64792504-64792526 TGTCAGCACCCCAGATGATGAGG - Intronic
1122761994 14:104035582-104035604 CGGCAGCAGCCCCCACTGTGAGG - Intronic
1124369938 15:29098870-29098892 AGGCAGCAGCCCCCACTATGTGG + Intronic
1124722375 15:32121206-32121228 CATCAGCTCCACCGACCATGTGG - Intronic
1128081548 15:64860155-64860177 GGACAGCACCACCTACTATGAGG - Intronic
1130635543 15:85616182-85616204 CTTCAGCATCCCCCACTAGGTGG + Intronic
1135577199 16:23595134-23595156 CCTCAGCCCCCCCGAGTATTTGG - Intronic
1135822048 16:25692975-25692997 CGTCAGCACCCCCGACTATGGGG + Exonic
1136557390 16:31015593-31015615 CCTCAGCACCCCCGAGTAGCTGG - Intergenic
1138553488 16:57759466-57759488 AGTCAGCACCCCCGGCTGAGAGG + Intronic
1139747414 16:69085980-69086002 CCTCAGCACCCCCGAGTAGCTGG + Intergenic
1157452941 18:47801635-47801657 CTTCAGCACCCCCTGCTATGTGG + Intergenic
1158554404 18:58463522-58463544 CTTCAGCACCCTCGATTCTGAGG - Intergenic
1159883075 18:73878118-73878140 CCTCAGAACTCCAGACTATGTGG - Intergenic
1162589202 19:11579457-11579479 CCTCAGCACCCCCGAGTAGCTGG + Intronic
1166867645 19:45850128-45850150 CCTCAGCCCCCCCGAGTATCTGG - Intronic
928567771 2:32570612-32570634 CCTCAGCACCCCCAAGTAGGTGG + Intronic
929939005 2:46316372-46316394 CCTCAGCACCCCCGAGTAGCTGG + Intronic
932837313 2:75049659-75049681 CATCAGCGCCGGCGACTATGAGG - Exonic
934695473 2:96397003-96397025 CCTCAGCACCCCCGAGTAGCTGG - Intergenic
937946696 2:127344977-127344999 CCTCAGCACCCCCGAGTAGATGG + Intronic
946315227 2:218906920-218906942 TGGCAGCAGCCCCGACCATGTGG + Intergenic
947178244 2:227388899-227388921 CGTCAGTACCTCCAACAATGGGG - Intergenic
947487621 2:230566943-230566965 AGTCACAACCCCCCACTATGGGG + Intergenic
1178780994 21:35603412-35603434 TCTCAGCACCCCCGACTGGGGGG - Intronic
961274886 3:125718868-125718890 CGGCAGCAACCCCAACAATGTGG - Intergenic
967916785 3:194584194-194584216 AGGCAGCGCCCCCGACTCTGGGG + Intergenic
975830723 4:78365847-78365869 CCTCAGCACCCCCGAGTAGCTGG - Intronic
981312469 4:143310757-143310779 CCTCAGCACCCCCGAGTACCTGG - Intergenic
981625284 4:146747892-146747914 CCTCAGCAGCTCAGACTATGGGG - Intronic
988732057 5:33982187-33982209 CTTCAGCTCCCCAGACAATGAGG - Intronic
989373822 5:40738297-40738319 CCTCAGCACTCCCGACTAGCTGG - Intronic
996729215 5:126701112-126701134 CATCAGCCCCCCCGAGTAGGTGG - Intergenic
1002554197 5:180021729-180021751 CCTCATCACCCCCGAATATGTGG + Intronic
1002696050 5:181091883-181091905 CCTCAGCACCCCCGAGTATTGGG + Intergenic
1006335753 6:33419833-33419855 CTTCACCACCCCCCACTGTGGGG - Intergenic
1017901540 6:158722274-158722296 CTTCAGCACCCCCGAGTAGCTGG + Intronic
1028431938 7:90757714-90757736 CCTCAGCACCCCCGAGTAGCTGG + Intronic
1029190375 7:98767554-98767576 CCTCAGCACCCCCGAGTAGCTGG + Intergenic
1032226408 7:130035274-130035296 CCTCAGCACCCCCGAGTACCTGG - Intronic
1036906206 8:12710276-12710298 TGTCAGCAACCCCAACAATGTGG + Intergenic
1040487401 8:47886504-47886526 CCTCAGCACCCCCGAGTATCTGG + Intronic
1046077767 8:109333648-109333670 CGTCAGCAGCCCAGCCTCTGAGG - Intronic
1047603648 8:126452595-126452617 CCTCAGCACCCCCGACTAGCTGG + Intergenic
1055477404 9:76676788-76676810 TGTCAGGAGCCCCGATTATGTGG - Intronic
1055801780 9:80045371-80045393 CCTCAGCACCCCCGAGTAGCTGG + Intergenic
1186644758 X:11494703-11494725 CTTCAGCACCTTAGACTATGAGG - Intronic
1188689193 X:33108380-33108402 CCTCAGCACCCCCGAGTAGCTGG + Intronic
1192438181 X:71155329-71155351 CGTCATCACCCTCAACTATCGGG + Exonic
1196539183 X:116884714-116884736 CATCAGGACCCCAGAATATGGGG - Intergenic
1200898799 Y:8406314-8406336 AGTCAGCACCCTGGATTATGTGG - Intergenic