ID: 1135823768

View in Genome Browser
Species Human (GRCh38)
Location 16:25707985-25708007
Sequence GTGGAGTAACTATGGAATAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 135
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 125}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1135823768_1135823771 -5 Left 1135823768 16:25707985-25708007 CCTGTATTCCATAGTTACTCCAC 0: 1
1: 0
2: 0
3: 9
4: 125
Right 1135823771 16:25708003-25708025 TCCACACCCACCCAGGTTTCTGG 0: 1
1: 0
2: 0
3: 24
4: 272

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1135823768 Original CRISPR GTGGAGTAACTATGGAATAC AGG (reversed) Intronic
900468520 1:2838169-2838191 GTGGCGTGACTCTGGAACACTGG - Intergenic
901747378 1:11383206-11383228 GTGGAGAAACTTTAGACTACAGG + Intergenic
902109880 1:14069283-14069305 GTGGAGTAATTATGCAATGTGGG + Intergenic
905799878 1:40836561-40836583 GTGGAGTAAATAGAGAATAGAGG + Intronic
909451408 1:75801744-75801766 CTTGAGTAACTATGGACTATAGG - Intronic
910862018 1:91751033-91751055 GTGGAGGATCTAGGGAAAACTGG - Intronic
912067251 1:105758748-105758770 GAAGAGTATGTATGGAATACAGG + Intergenic
914699616 1:150119764-150119786 GTGGAATATTTCTGGAATACAGG + Intronic
914951900 1:152123212-152123234 GTGGAGTGACTGTGGATGACAGG - Intergenic
915884092 1:159704519-159704541 TTGTATTAACTAAGGAATACAGG - Intergenic
916365859 1:164027083-164027105 GAGGAGTATGTTTGGAATACAGG - Intergenic
918188179 1:182145876-182145898 ATGGAGAAATTATGGAATGCAGG + Intergenic
920802165 1:209199536-209199558 GTGGAGTAATAAAGCAATACAGG - Intergenic
923038696 1:230303743-230303765 GTGGAGAAAGTATGGAACAGAGG - Intergenic
1064050161 10:12053067-12053089 GTTGAGTAGCTATGTAATCCTGG - Intergenic
1065164434 10:22960435-22960457 GTCGAGTAGCAATGGCATACTGG - Intronic
1065723442 10:28647960-28647982 CTGCAGTAAATATGGGATACAGG + Intergenic
1066183665 10:32987859-32987881 CTGGAGTAGCTAAGGACTACAGG + Intronic
1066267667 10:33792011-33792033 GTGGCGTACCAATGGAATACTGG + Intergenic
1077723162 11:4647401-4647423 GTGGAGGGACTATGGAACATTGG + Intronic
1081351806 11:42063266-42063288 TTGGAGTATCAATGGAAGACAGG + Intergenic
1085598110 11:77828960-77828982 GTGTAGTAACTTTGGAAGCCAGG - Intronic
1088249072 11:107847107-107847129 GTGGAGTGCCTTTGAAATACTGG + Intronic
1091868774 12:3869083-3869105 ATGGAGTGACTATGGAAGAATGG - Intronic
1092841328 12:12544537-12544559 TTGGAATAACTGTGGAAAACTGG - Intronic
1094240284 12:28214300-28214322 GTAGAGTATGTCTGGAATACAGG + Intronic
1095909825 12:47414794-47414816 GTGGAGTAGCTATGGAAACCAGG + Intergenic
1098460346 12:70726347-70726369 GTGCAATAAATATAGAATACAGG - Intronic
1098831632 12:75371946-75371968 GAAGAGTATGTATGGAATACAGG - Intronic
1099401007 12:82203992-82204014 GAAGAGTATATATGGAATACAGG - Intergenic
1108942827 13:55978320-55978342 ATGTAGAAACTATGGAAAACTGG + Intergenic
1109712444 13:66179094-66179116 GAAGAGTAAGTGTGGAATACAGG - Intergenic
1110982970 13:81925632-81925654 GTGGTACAACTATGAAATACAGG - Intergenic
1111317728 13:86583568-86583590 GAGGAGTATGCATGGAATACAGG + Intergenic
1112384476 13:98925690-98925712 GTGGTGTAACTATTGTTTACAGG - Intronic
1114641186 14:24222772-24222794 GTGATGTAAATATGAAATACAGG - Intronic
1114747231 14:25162705-25162727 GTGGAGTACCTGTGGAGTAAAGG - Intergenic
1114758010 14:25282111-25282133 GAAGAGTATCCATGGAATACAGG - Intergenic
1115272397 14:31568281-31568303 GTGAAGTAACTATGTAATAAGGG + Intronic
1118684316 14:68276151-68276173 GAGGAGGAACTCTGGAATACTGG - Intronic
1120301307 14:82710715-82710737 GTGGAGAAACTTTTGAAGACAGG + Intergenic
1120893214 14:89507441-89507463 GTGGAGTGATTATTGAACACTGG - Intronic
1121161472 14:91745208-91745230 CAGGAGTATATATGGAATACAGG + Intronic
1121668213 14:95688489-95688511 GTGCAGCCACTATGGAAAACAGG + Intronic
1124032786 15:26026664-26026686 TTTGAGTAACTATGAAATTCTGG - Intergenic
1124837323 15:33207924-33207946 GTGGAGGGACTATGGAAACCTGG - Intergenic
1131986402 15:98046269-98046291 GTAAAGTAACAATGGAATTCTGG + Intergenic
1135823768 16:25707985-25708007 GTGGAGTAACTATGGAATACAGG - Intronic
1138066947 16:53952085-53952107 GAGGAGTAAGTAAGGAATATGGG - Intronic
1140680708 16:77382084-77382106 GTGGAGTATCTCTGGCATTCAGG - Intronic
1143268074 17:5655443-5655465 CTGGAGTAGCTGTGGAATAAGGG + Intergenic
1154443296 18:14412213-14412235 GAGGGGTAACTAAAGAATACTGG - Intergenic
1155976065 18:32132941-32132963 GGGGAATAAATATGGAAGACTGG + Intronic
1159711581 18:71766201-71766223 GGAGAGTATGTATGGAATACGGG + Intronic
1164585527 19:29470563-29470585 GTAGAGACACTATGGAAAACAGG + Intergenic
927620509 2:24651947-24651969 GTGTAGTTACTGTGGAAAACTGG + Intronic
928819854 2:35347769-35347791 GTGAAGTAACTCAGGAATAATGG + Intergenic
929629904 2:43448841-43448863 GTGTAGTAACTCTGGAAATCAGG - Intronic
934848216 2:97677015-97677037 GTTAAGTAGCTATGGAATATTGG + Intergenic
936060375 2:109291627-109291649 GTGGAGGAATTTTGGAAGACTGG + Intronic
937334927 2:121056412-121056434 GTGGCGTAAGTATGGAGAACAGG + Intergenic
937802574 2:126097322-126097344 GAAGAGTAAGCATGGAATACAGG + Intergenic
939849761 2:147290616-147290638 TTGGAGTCACTCTGGGATACTGG - Intergenic
940419637 2:153464646-153464668 TTGCAGTGACTTTGGAATACAGG + Intergenic
943182520 2:184561410-184561432 GAAGAGTATGTATGGAATACAGG + Intergenic
943281076 2:185933481-185933503 GTGGAGGAACTAGAGAGTACTGG + Intergenic
944368050 2:198947696-198947718 ATGGAGTAACTATGGCATCAGGG + Intergenic
945234722 2:207623980-207624002 GAGGAGTGACTAAGGGATACGGG + Intronic
1168919384 20:1518422-1518444 ATGGAGTAAATTTGGAATACTGG + Intergenic
1176049740 20:63112413-63112435 GTGCAGTAAGTATGTAATCCTGG + Intergenic
1176452793 21:6878995-6879017 GAGGGGTAACTAAAGAATACTGG + Intergenic
1176830966 21:13744044-13744066 GAGGGGTAACTAAAGAATACTGG + Intergenic
1184540126 22:45116775-45116797 GTGTAGAAGCTATGGAAAACAGG + Intergenic
954511253 3:51127921-51127943 GAAGAGTAAGCATGGAATACAGG - Intronic
956045025 3:65186652-65186674 GTGCAGTCACTTTGGAAAACAGG - Intergenic
959866471 3:111276230-111276252 CTTGAGAAACCATGGAATACTGG - Intergenic
960696849 3:120405015-120405037 GTGGAGTAATGATGGAACAGGGG - Intronic
961959400 3:130838688-130838710 GTGAAGTAACAATGGAATGTAGG + Intergenic
964678994 3:159317151-159317173 GTAGAGTATGCATGGAATACAGG - Intronic
966373584 3:179273493-179273515 ATGGCCTAACTATGGGATACAGG - Intergenic
971484768 4:27147878-27147900 ACAGAGAAACTATGGAATACTGG + Intergenic
972192681 4:36613530-36613552 GAGGAGTACGCATGGAATACAGG + Intergenic
975535013 4:75440959-75440981 GTACAGCAACTATGGAAAACAGG + Intergenic
975834747 4:78410722-78410744 GGGGAGTAATTATGGAATAATGG + Intronic
977577690 4:98692207-98692229 GTGGAATAAGTATGAAATACTGG - Intergenic
977701504 4:100028130-100028152 GAAGAGTATGTATGGAATACAGG - Intergenic
978919013 4:114159797-114159819 GTGGAGTAACCTTGGAAGACAGG - Intergenic
980564036 4:134514808-134514830 GTGGAGCAAATAGGAAATACAGG + Intergenic
981605623 4:146537332-146537354 GTAGAGTATGCATGGAATACAGG - Intergenic
981936407 4:150244641-150244663 GTGGAGTATCAATGCGATACCGG + Intronic
982549841 4:156783977-156783999 GTGACATAACTATGTAATACAGG + Intronic
985190027 4:187362896-187362918 ATGTAGTCACTATGGAATCCAGG + Intergenic
987958734 5:24775053-24775075 GTGAAGTAACAATGGAAAAATGG + Intergenic
990410053 5:55533507-55533529 GTGGAATAACTAGGAACTACTGG + Intronic
992666553 5:79015167-79015189 GTGGATTAACTAGGAAACACAGG - Intronic
994582913 5:101670411-101670433 GTGCATTAACTAGGGAATAAGGG - Intergenic
996401441 5:123067636-123067658 GTGTAGCTACTATGGAATATAGG - Intergenic
998131184 5:139651736-139651758 GTGGAGGAATGAGGGAATACGGG + Intronic
1000319185 5:160119876-160119898 GAGGAGTAACAAGGGAATGCGGG + Intergenic
1001587377 5:172842594-172842616 GTGCAGCCACTATGGAAAACAGG - Intronic
1001713696 5:173797819-173797841 GTGGAGTAGCTTGGGACTACAGG + Intergenic
1003223431 6:4182306-4182328 GTGCAGTTACTTTGGAAAACTGG - Intergenic
1008820630 6:55626893-55626915 GAAGAGTATGTATGGAATACAGG + Intergenic
1014845906 6:126276739-126276761 GTGGAGTCATTATGTAATTCAGG + Intergenic
1017362842 6:153596047-153596069 GTGGTGTAACTCTGGAGTAGTGG - Intergenic
1017602930 6:156103087-156103109 GTGGATTAACCATGGAGAACTGG - Intergenic
1018654246 6:166018705-166018727 GGGGAGTTACTAAGAAATACTGG + Intergenic
1019460906 7:1158777-1158799 GTTAAGTCACTATGGAAAACAGG + Intronic
1021854445 7:24839864-24839886 CTGGAGTAACTGGAGAATACAGG - Intronic
1022977173 7:35569498-35569520 GTGGAGTAAGAAGGGAAAACAGG - Intergenic
1024766036 7:52660828-52660850 ATTGTGTAAATATGGAATACAGG + Intergenic
1028957529 7:96710427-96710449 GTGTAGTAACTCTGGTTTACAGG + Intergenic
1029081294 7:97975855-97975877 GTAGAGTAACCATGGAACAGGGG + Intergenic
1030785540 7:113656664-113656686 GTGCAGTCACTTTGGAAAACTGG + Intergenic
1031237097 7:119190028-119190050 GTAGAGTATGTGTGGAATACAGG + Intergenic
1032395451 7:131586244-131586266 GTCTAGTAACTGTGGAATTCAGG + Intergenic
1033174647 7:139113016-139113038 GTGGAATATGTATGGAATTCTGG - Intergenic
1035544599 8:470038-470060 GTGAAGTAACAGTGGTATACGGG - Intronic
1042576879 8:70230332-70230354 GGGGAGTAACTGTTGAGTACAGG + Intronic
1046197800 8:110885973-110885995 GAAGAGTAAGTATGGAATACAGG + Intergenic
1048928770 8:139294134-139294156 GTGCAGTAGCTATGGAAAAACGG + Intergenic
1051399367 9:16663097-16663119 GTGGAGTGCCTATGGATCACTGG - Intronic
1051959428 9:22740041-22740063 GGGAAGAAACTATGGAATAATGG + Intergenic
1056313998 9:85371169-85371191 GAAGAGTATGTATGGAATACAGG - Intergenic
1060568549 9:124616276-124616298 GTGGAGTAGCTTGGGATTACAGG - Intronic
1061279789 9:129590926-129590948 GTGGAGTAACAAGGGAATCGGGG + Intergenic
1203516388 Un_GL000213v1:5520-5542 GAGGGGTAACTAAAGAATACTGG - Intergenic
1186710054 X:12184547-12184569 CTGGAGTAAATGTGTAATACTGG - Intronic
1188327458 X:28822990-28823012 CAGCAGTAACTATGGAATTCTGG - Intronic
1189683578 X:43541232-43541254 GTGGAATATCTCTGGAATAAGGG + Intergenic
1193053733 X:77127527-77127549 GAGGAGTATGCATGGAATACAGG + Intergenic
1194174865 X:90632593-90632615 GAAGAGTATATATGGAATACAGG + Intergenic
1194210524 X:91064110-91064132 GAAGAGTATGTATGGAATACAGG + Intergenic
1197298157 X:124745188-124745210 GGAGAGGAACTATGGAGTACAGG - Intronic
1201651010 Y:16286633-16286655 GTGCAGCAACTATGGAAAATAGG + Intergenic