ID: 1135826325

View in Genome Browser
Species Human (GRCh38)
Location 16:25731715-25731737
Sequence TCCTTTCTTTGGAATGTGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 2239
Summary {0: 1, 1: 4, 2: 19, 3: 66, 4: 2149}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1135826321_1135826325 -1 Left 1135826321 16:25731693-25731715 CCAGGAGCTGGTCAAAAGTTGGT 0: 1
1: 0
2: 1
3: 13
4: 116
Right 1135826325 16:25731715-25731737 TCCTTTCTTTGGAATGTGGAGGG 0: 1
1: 4
2: 19
3: 66
4: 2149
1135826319_1135826325 0 Left 1135826319 16:25731692-25731714 CCCAGGAGCTGGTCAAAAGTTGG 0: 1
1: 0
2: 0
3: 13
4: 133
Right 1135826325 16:25731715-25731737 TCCTTTCTTTGGAATGTGGAGGG 0: 1
1: 4
2: 19
3: 66
4: 2149
1135826316_1135826325 21 Left 1135826316 16:25731671-25731693 CCAAGGGTTCAGAGATTATCTCC 0: 1
1: 2
2: 7
3: 56
4: 272
Right 1135826325 16:25731715-25731737 TCCTTTCTTTGGAATGTGGAGGG 0: 1
1: 4
2: 19
3: 66
4: 2149

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1135826325 Original CRISPR TCCTTTCTTTGGAATGTGGA GGG Intronic
Too many off-targets to display for this crispr