ID: 1135828409

View in Genome Browser
Species Human (GRCh38)
Location 16:25751173-25751195
Sequence AGCCATTGCAAACCGGGCCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 104
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 96}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1135828409 Original CRISPR AGCCATTGCAAACCGGGCCA TGG (reversed) Intronic
921176059 1:212595501-212595523 AGTCAGAGCAAACCAGGCCAGGG - Intronic
921960693 1:221030772-221030794 ATCCATTGCACCCCTGGCCAAGG + Intergenic
923113302 1:230910340-230910362 AGCCAAGGCAAACCAGGGCAGGG + Intronic
923660136 1:235950549-235950571 AGCCATTGTGCATCGGGCCAGGG + Intergenic
1065426065 10:25605103-25605125 AGCTCTAACAAACCGGGCCATGG - Intergenic
1067106134 10:43367879-43367901 AGCCATTGCACTCCAGTCCAGGG - Intergenic
1069916511 10:71790201-71790223 AGCCATGGCTCACCGGGACAGGG + Intronic
1071506957 10:86238356-86238378 AGCCATGGCTAAAAGGGCCAAGG + Intronic
1074945493 10:118277074-118277096 AACAATTGCAAACCAAGCCATGG + Intergenic
1076545720 10:131244717-131244739 AGCCATTGAAATCCTGGCCCAGG + Intronic
1086133691 11:83425522-83425544 ATCCCTTGCCAACAGGGCCATGG - Intergenic
1088019666 11:105104255-105104277 AGCCAATGTTAACCGTGCCAAGG - Intergenic
1091219658 11:133922518-133922540 GGGCATTTGAAACCGGGCCAGGG + Intronic
1093665351 12:21806009-21806031 AGCCTTTGCAGACCGGACCGTGG - Exonic
1094798047 12:33999798-33999820 AGCCATTACAAACAAGGCAATGG - Intergenic
1095110812 12:38293886-38293908 AGCCATTACAAACAAGGCAATGG - Intergenic
1105694114 13:22871490-22871512 AGCCATGGCTAAAAGGGCCAAGG + Intergenic
1106640106 13:31574985-31575007 AGCTATGGCAAACAGGGCCAGGG - Intergenic
1106773206 13:32982741-32982763 AGCCATGGAAAACCATGCCATGG + Intergenic
1123189106 14:106551021-106551043 AGCCATGGCTAAAGGGGCCAAGG + Intergenic
1124686605 15:31788385-31788407 AGACATGGCAAACATGGCCATGG - Intronic
1126555791 15:49986188-49986210 AGCCATTCCAAACAAGGTCACGG + Intronic
1128345658 15:66850955-66850977 CGCCATTGCATACCGGGCACTGG + Intergenic
1128685489 15:69681359-69681381 AGGCATGGCAAACCTGCCCACGG - Intergenic
1129350994 15:74956011-74956033 AGCGATCGCAACCCGAGCCAGGG - Exonic
1130745983 15:86654482-86654504 AGACATTGCATACAGGGCCATGG - Intronic
1133175493 16:4011134-4011156 GGCAATAGCAAACCAGGCCAGGG + Intronic
1133831422 16:9326829-9326851 AGCCCTTGCAACCCCAGCCATGG - Intergenic
1135828409 16:25751173-25751195 AGCCATTGCAAACCGGGCCATGG - Intronic
1137400945 16:48154063-48154085 AGGCAGTGCCAACCGGGCCAGGG + Intronic
1140939116 16:79704584-79704606 AGCCATTGTTAACCAGGCGAAGG - Intergenic
1140939809 16:79710893-79710915 AGCCATTGTTAACCAGGCAAAGG - Intergenic
1143929053 17:10401391-10401413 AACCATTGCAAAACTGTCCAAGG - Exonic
1143947218 17:10604050-10604072 TGACATTGCAAATCTGGCCAAGG - Intergenic
1145788085 17:27607235-27607257 AGCCTTTGAAAACCAGGCAAGGG - Intronic
1145800096 17:27677120-27677142 AGCCACTGCAAACCAGTCCCTGG - Intergenic
1148150458 17:45394005-45394027 CCCCATTGCCAACAGGGCCAGGG - Exonic
1149680932 17:58506764-58506786 AGCAGTGGCCAACCGGGCCAAGG - Exonic
1151419354 17:73987175-73987197 GGCCAGGGCAAACCAGGCCAGGG - Intergenic
1153016111 18:583987-584009 AGGCATTCCAAACTGGGGCAAGG + Intergenic
1156265923 18:35488487-35488509 AGCCATGGTAAAAGGGGCCAAGG - Intronic
1157325138 18:46663531-46663553 AGACTTTGCAAACAGGGCTAAGG - Intergenic
1160387649 18:78506150-78506172 AGCCACTGCACAGCGGGTCATGG - Intergenic
1160791860 19:926917-926939 AGCCTTTGAAATCCGGACCAGGG + Intronic
1167749218 19:51369778-51369800 AGCCACTGCGCACCCGGCCAAGG - Intergenic
1168366410 19:55791960-55791982 AGAAATTGCAAGCCAGGCCAGGG + Intronic
925004381 2:429723-429745 AGGCCCTGCAAACCGGGGCAGGG - Intergenic
926502187 2:13669875-13669897 CGCCATTGCAAAGTGGGCAAGGG - Intergenic
928231915 2:29505624-29505646 AGCCACTGTAAACAGGGCCTGGG - Intronic
928356965 2:30625398-30625420 AGCTATTACAACCAGGGCCATGG + Intronic
929517426 2:42616346-42616368 AGCCATTGCACGCCTGGCCTAGG + Intronic
934979541 2:98828548-98828570 AGCCTTTGCTAACCCGGACAGGG + Intronic
935172367 2:100620458-100620480 AGCCATTGAAAGCCGTGCCCTGG - Intergenic
936862379 2:117032981-117033003 AGCCATTGTAAAAGGGGCCAAGG - Intergenic
943312924 2:186349673-186349695 AGACACTGTAAATCGGGCCAAGG + Intergenic
949031072 2:241797787-241797809 AACCAAGGCAAAGCGGGCCAGGG - Intronic
1175416759 20:58806293-58806315 AGACATTGCGAACAGTGCCAGGG - Intergenic
1175983662 20:62753762-62753784 CTCCATTGGAAGCCGGGCCATGG + Intronic
1177479631 21:21669710-21669732 AGCCATGGCTAAAAGGGCCAAGG - Intergenic
1177579911 21:23008054-23008076 AGCCACTGAAAACCAGGCTAAGG + Intergenic
1184467594 22:44677937-44677959 AGCCAATGCAAAGCCTGCCAGGG - Intronic
950025540 3:9817525-9817547 AGACCTTGCAAGCGGGGCCAAGG + Intronic
954688749 3:52384695-52384717 AGCCACTGCAACCTGGGCCGAGG - Intronic
966941509 3:184750806-184750828 AGGCAATGCAAAGCGAGCCAGGG - Intergenic
968926496 4:3551218-3551240 AGCCACTGCAAAGGAGGCCAGGG - Intergenic
972563242 4:40247122-40247144 AGCCATTGCAAACCAGGCAGAGG - Intergenic
980266547 4:130524154-130524176 AGCCATGGCTAAAGGGGCCAAGG - Intergenic
982477243 4:155868407-155868429 AGCCATGGCTAAAAGGGCCAAGG - Intronic
983694983 4:170517445-170517467 AGCCATTTGAAACTGGGGCAGGG - Intergenic
986651293 5:9965837-9965859 AGCCCTAGCAAACTAGGCCAAGG - Intergenic
987512370 5:18856548-18856570 AGTCATTGCTAAAAGGGCCAAGG + Intergenic
996278325 5:121696135-121696157 AGCCATAAAAAACCAGGCCATGG - Intergenic
1006253134 6:32807516-32807538 AGCCATTGCAGACAGAGCCTTGG - Intergenic
1012320230 6:97835202-97835224 AGTCATTTCCAACCAGGCCATGG + Intergenic
1012706538 6:102538813-102538835 AGCCATGGCTAAAAGGGCCAAGG + Intergenic
1012937035 6:105379201-105379223 AGCCACAGGAAAGCGGGCCAGGG - Intronic
1015705253 6:136080882-136080904 ACCCATTGCAAAAGGGGCGAGGG + Intronic
1016185316 6:141191765-141191787 AGCCATAGCTAAAAGGGCCAAGG - Intergenic
1016187961 6:141221333-141221355 AGCCATGGCTAAAGGGGCCATGG - Intergenic
1023991897 7:45133491-45133513 AGCCCTTGCAATCAGGGTCACGG + Intergenic
1027783498 7:82550177-82550199 AGCCATTGGAAGCCCGGGCATGG + Intergenic
1030527665 7:110673245-110673267 AGCCATGGCTAAAAGGGCCAAGG - Intronic
1031315869 7:120257022-120257044 AGCCATAGCTAAAAGGGCCAAGG + Intergenic
1033735141 7:144214790-144214812 AGCCATTGCTAAAAGGGCCGAGG + Intergenic
1033747915 7:144336179-144336201 AGCCATTGCTAAAAGGGCCGAGG - Intergenic
1038556709 8:28524821-28524843 AGCCATTGGAAATCTGGCCTCGG + Intronic
1041607624 8:59801670-59801692 ATCCATATCAAACCAGGCCATGG + Intergenic
1043695898 8:83216830-83216852 AGCCATTAAAAAGCGGGCAAAGG - Intergenic
1048054879 8:130853701-130853723 AGCCATTTAAAACTGGGTCAGGG - Intronic
1050951936 9:11608059-11608081 AGCAATTGCAAAACTTGCCAAGG + Intergenic
1053801418 9:41766600-41766622 AGCCACTGCAAAGGAGGCCAGGG - Intergenic
1054143782 9:61548225-61548247 AGCCACTGCAAAGGAGGCCAGGG + Intergenic
1054189849 9:61978754-61978776 AGCCACTGCAAAGGAGGCCAGGG - Intergenic
1054463556 9:65479561-65479583 AGCCACTGCAAAGGAGGCCAGGG + Intergenic
1054648663 9:67609837-67609859 AGCCACTGCAAAGGAGGCCAGGG + Intergenic
1055025581 9:71716504-71716526 AGCAATTACAAACCTGGCAAAGG + Exonic
1057757810 9:97851978-97852000 AGCCACTGGAACCCGCGCCAAGG + Intergenic
1060729030 9:126025422-126025444 TACCATTGCAAACGGTGCCAAGG - Intergenic
1062637567 9:137499661-137499683 AGCCCTTCCCAACTGGGCCAGGG + Intronic
1187841867 X:23497248-23497270 AGACATTTCAAACCTGGTCATGG + Intergenic
1193682675 X:84541360-84541382 AGCCATGGCTAAAGGGGCCAAGG + Intergenic
1197507483 X:127324815-127324837 AGCCATTGAAAACCAGGTCAAGG + Intergenic
1197883237 X:131191260-131191282 AGGAATTGCAAACCAGGCCATGG + Intergenic
1199060390 X:143349534-143349556 AACCCTTGCAAACAGGGTCAGGG + Intergenic