ID: 1135830072

View in Genome Browser
Species Human (GRCh38)
Location 16:25765306-25765328
Sequence GAAAATGCGGAGACGCCGCT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 34
Summary {0: 1, 1: 0, 2: 1, 3: 2, 4: 30}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1135830064_1135830072 28 Left 1135830064 16:25765255-25765277 CCACTGAATTTATTCTCAAAGGT 0: 1
1: 0
2: 0
3: 18
4: 259
Right 1135830072 16:25765306-25765328 GAAAATGCGGAGACGCCGCTGGG 0: 1
1: 0
2: 1
3: 2
4: 30
1135830068_1135830072 2 Left 1135830068 16:25765281-25765303 CCTGTTCAGTGGGCCAAGGTGTT 0: 1
1: 0
2: 1
3: 10
4: 84
Right 1135830072 16:25765306-25765328 GAAAATGCGGAGACGCCGCTGGG 0: 1
1: 0
2: 1
3: 2
4: 30

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1135830072 Original CRISPR GAAAATGCGGAGACGCCGCT GGG Intronic
904068358 1:27773110-27773132 CAAAGTGCGCAGGCGCCGCTGGG - Intergenic
905164688 1:36072830-36072852 GAAAATGGGGAGACGACGCTAGG + Intergenic
917488293 1:175475247-175475269 GAGAATGGGGAGATGACGCTAGG - Intronic
1074721989 10:116272064-116272086 AAAAATCCCGAGCCGCCGCTGGG + Exonic
1117307275 14:54488909-54488931 GAAAATGGTGAGTTGCCGCTGGG - Exonic
1117719882 14:58618993-58619015 GAAAACGTGGAGATGCGGCTGGG + Intergenic
1121024979 14:90608931-90608953 AAAAGTGGGGAGACGGCGCTGGG + Intronic
1128665297 15:69533186-69533208 GAAAATCCGGAGAGGTAGCTTGG + Intergenic
1131476767 15:92746618-92746640 GAAAATGCAGAGACTACACTGGG - Intronic
1135830072 16:25765306-25765328 GAAAATGCGGAGACGCCGCTGGG + Intronic
1137649909 16:50110864-50110886 GAAAATGCTAAGATGACGCTTGG + Intergenic
1152185950 17:78856420-78856442 GAACATGCGGAGAAGGGGCTGGG + Intronic
1155639511 18:27997168-27997190 GTAAATGCTGAGAAGCCTCTAGG - Intronic
931711305 2:64990524-64990546 GAAAATGAGGCGAAGCCACTGGG - Intronic
941666277 2:168246904-168246926 GAAGATGCGGCGGCGCCGCCTGG + Intronic
947951368 2:234150382-234150404 GAAACTGCAGAGACCCTGCTGGG - Intergenic
948399455 2:237673274-237673296 GACAATGCGGGGACAGCGCTGGG + Intronic
1173014272 20:39210693-39210715 TAAAATGCGGGGAGGCCGCTGGG + Intergenic
1173344234 20:42184144-42184166 GAAAATGGGGAGCCTCAGCTGGG - Intronic
1176107130 20:63394759-63394781 GAAAAGGCGGAGGCGCTGGTGGG + Intergenic
1176243209 20:64084528-64084550 GAAAATGCTGAGACCCCACTGGG + Intronic
978629898 4:110732313-110732335 GAACATGCTGAGACCCCACTGGG - Intergenic
981802704 4:148677024-148677046 GAAAATGTGGAGTCACCACTTGG + Intergenic
984518986 4:180777418-180777440 GAAAATGCAGACACACCACTGGG + Intergenic
985124071 4:186674174-186674196 GAAAATGGGGAGAGACCACTGGG - Intronic
986210441 5:5666674-5666696 GAAAATGCAGAAACTCTGCTTGG + Intergenic
989103493 5:37840254-37840276 GAGAGCGCGGAGACGCCGCGGGG + Intergenic
1013792719 6:113855235-113855257 GAAGAGGCGGAGCCGGCGCTGGG - Intergenic
1020572455 7:9883150-9883172 GAAAATGCGGAGATGGAGATTGG + Intergenic
1052879958 9:33595685-33595707 GAAAATGCACAGATGCAGCTTGG + Intergenic
1053496015 9:38548535-38548557 GAAAATGCACAGATGCAGCTTGG - Intronic
1056586124 9:87928346-87928368 GAAAATGCACAGATGCAGCTTGG - Intergenic
1056610758 9:88124597-88124619 GAAAATGCACAGATGCAGCTTGG + Intergenic
1057675944 9:97136053-97136075 GAAAATGCACAGATGCAGCTTGG - Intergenic