ID: 1135833658

View in Genome Browser
Species Human (GRCh38)
Location 16:25802527-25802549
Sequence TTGAAAAAGAATGACAAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1290
Summary {0: 1, 1: 0, 2: 6, 3: 104, 4: 1179}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1135833658_1135833662 25 Left 1135833658 16:25802527-25802549 CCTTCCTTGTCATTCTTTTTCAA 0: 1
1: 0
2: 6
3: 104
4: 1179
Right 1135833662 16:25802575-25802597 TTATACTTGCAGATTAATTTTGG 0: 1
1: 1
2: 6
3: 58
4: 554

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1135833658 Original CRISPR TTGAAAAAGAATGACAAGGA AGG (reversed) Intronic
900667344 1:3824469-3824491 ATGAAAAAGACTGGCAAGGTGGG + Intronic
901169003 1:7241499-7241521 TTGAAAAAGAAGAACAAAGTTGG + Intronic
901806577 1:11742468-11742490 AAGAAAAAGAAAGAAAAGGAAGG - Intronic
901901262 1:12365198-12365220 TTGAAAAAGAACAACAAAGTTGG - Intronic
902095416 1:13940167-13940189 TTCCAAAAGAATGAAGAGGAGGG - Intergenic
902300095 1:15495485-15495507 TTGAAATACACAGACAAGGATGG + Intronic
902675724 1:18007331-18007353 AAGAAAGAGAATGAGAAGGAAGG + Intergenic
902869898 1:19307696-19307718 TTTAAAAAAATAGACAAGGAAGG + Intronic
903131814 1:21284442-21284464 CAGAAAGAGAATGAGAAGGAGGG + Intronic
903388638 1:22947377-22947399 TTGAAAAAGAAGGATAAAGTGGG + Intergenic
903751837 1:25627642-25627664 TTGAAAAAGAAGATCAAAGATGG - Intronic
904145092 1:28384197-28384219 TTCCAAAAGAATGAAGAGGAGGG - Intronic
904933925 1:34113042-34113064 GAGAAAAAGAAGGACATGGATGG + Intronic
905136002 1:35800458-35800480 TTGAAAAAGAAGAACAAAGTTGG + Intergenic
905210566 1:36371252-36371274 TTAAGAAATAATGACAAGAAGGG + Intronic
905533677 1:38701890-38701912 TCAAAACAGAAAGACAAGGAAGG + Intergenic
906099194 1:43246225-43246247 TTGAAAAAGAAGAACAAGGTTGG + Intronic
906159232 1:43635435-43635457 TTAAAAAATAATAATAAGGAGGG + Intergenic
906551031 1:46666668-46666690 TTGAAAAAGAATGGAGAGGAGGG - Intronic
906893076 1:49739153-49739175 TTGAAAAACGATGAGAAGAATGG + Intronic
907377385 1:54054773-54054795 TTGCAAAAGAATAACAACGAAGG - Intronic
907950285 1:59176696-59176718 TTGAAAAAGAAGAACAAAGTTGG - Intergenic
908364621 1:63407386-63407408 TGGAAAAAGAGTGCCAAGTATGG + Intronic
908818899 1:68062288-68062310 TTGAATAAGAATGGTAAGAAAGG - Intergenic
909153373 1:72037576-72037598 ATGACAAAAAATGACAACGAAGG - Intronic
909301392 1:74017290-74017312 TTCAAAAACAATGACAAATATGG + Intergenic
909633283 1:77788849-77788871 TTGAAAAAGAAGAACAAAGCTGG - Intronic
910062613 1:83111825-83111847 TTGAAAAAGAAAGTAAAGGTAGG + Intergenic
910096561 1:83529210-83529232 TTGAATAAGAGTGACAAGAGAGG + Intergenic
910299185 1:85686255-85686277 TTTAAAAAGAATGTTAAGGGTGG - Intronic
910729118 1:90371645-90371667 TTGAAAAAGAAGAACAAAGTTGG - Intergenic
910785065 1:90988586-90988608 TTGAAAAAGAACAACAAAGTTGG + Intronic
910822051 1:91361659-91361681 TTCCAAAAGACTGAAAAGGAGGG + Intronic
910824680 1:91393242-91393264 TTGAGCAAGAATGAGAAGAATGG - Intronic
910912399 1:92251149-92251171 TTGAAAAAGAAGAACAAAGTTGG + Intronic
911483655 1:98477412-98477434 CTGAAAAAGTAAGATAAGGAAGG - Intergenic
911561272 1:99408897-99408919 TTGGAAAAAAAGGAAAAGGATGG - Intergenic
911632813 1:100201351-100201373 AGAAAAAAGAATGAGAAGGAAGG + Intronic
911668220 1:100579122-100579144 TTGAAAAAGAAGAACAAAGTTGG + Intergenic
911675190 1:100650734-100650756 TTCCAAAAGATTGAAAAGGAGGG + Intergenic
911686101 1:100779549-100779571 TTGAAAAAGAGTGATAGAGATGG - Intergenic
911874298 1:103139337-103139359 TTCAAAAAAATTGAAAAGGAGGG + Intergenic
911882704 1:103262413-103262435 TTGAAAAAAAATTAAAATGAAGG + Intergenic
912073552 1:105843485-105843507 TACAAATAGAATGACAAGAACGG + Intergenic
912169507 1:107081498-107081520 ATGAAGAAGAATGGAAAGGAAGG + Intergenic
912563714 1:110569474-110569496 TAGAAAAAGAAATACAAGGCCGG - Intergenic
912887453 1:113489837-113489859 AGGCAAAAGAATGAAAAGGAAGG + Intronic
913128520 1:115815778-115815800 GAGAAAAAGAATAACAAGAAAGG - Intergenic
913145475 1:115985650-115985672 TTGAAAAAGAGAGAGAAGGCCGG + Intronic
913301960 1:117380802-117380824 TTGAAAAAGAATAACAAACCTGG - Intronic
913672802 1:121113806-121113828 TTGAAAAAGGATGAGAAGAGAGG - Intergenic
914024578 1:143901180-143901202 TTGAAAAAGGATGAGAAGAGAGG - Intergenic
914315254 1:146504831-146504853 TTGAAAGAGAACCAAAAGGAGGG - Intergenic
914339602 1:146748831-146748853 TTGTCAAAGAAGGCCAAGGAGGG - Intergenic
914499101 1:148228545-148228567 TTGAAAGAGAACCAAAAGGAGGG + Intergenic
914512950 1:148350971-148350993 TTTAAAAAGAAAGAGAAGGAAGG + Intergenic
914663063 1:149809201-149809223 TTGAAAAAGGATGAGAAGAGAGG - Intronic
914798805 1:150944536-150944558 CTGATAGAGAATGAGAAGGAAGG + Intronic
914911233 1:151788911-151788933 TTAATCAAGAATGACAAGCATGG - Intronic
915677479 1:157545128-157545150 TGGAAAAACAATGAAAAGAAAGG - Intronic
915710043 1:157887522-157887544 TTGAATAAGAATGATTAGGGTGG - Intronic
915833375 1:159152329-159152351 GTGAAAGAGATTGAGAAGGAGGG - Intergenic
916050230 1:161030577-161030599 TTGAAAAAGAACATCAATGAGGG - Intronic
916078397 1:161216805-161216827 TTGAAAGAGAATGACTGGGGAGG + Intronic
916271015 1:162941429-162941451 ATGAAAAAGCAGGATAAGGAAGG - Intergenic
916528630 1:165634833-165634855 ATGATCAAGAATGAGAAGGAAGG - Intronic
916843219 1:168621773-168621795 GAAAAAAAGAATGTCAAGGAAGG + Intergenic
916975241 1:170070349-170070371 TTGAAAAAGAACAACAAAGTTGG + Intronic
917000945 1:170358117-170358139 ATGAAAAAGTATGAAAAGTATGG + Intergenic
917023228 1:170613219-170613241 AGAAAAAAGAATGAAAAGGAAGG - Intergenic
917221625 1:172736193-172736215 TTGAAAAAGAATCAGAAAAAAGG + Intergenic
917290249 1:173464767-173464789 TTCAAAAAGATCGAAAAGGAGGG + Intergenic
917665875 1:177224940-177224962 TTGAAAATTATTGCCAAGGAGGG - Intronic
917866217 1:179198224-179198246 TTAAAAGAGAAGGAAAAGGAAGG + Intronic
917917112 1:179713190-179713212 TTGAAAAAGAAAGACAAAGTTGG + Intergenic
917998224 1:180463663-180463685 TTCAAAAAAACTGAAAAGGAGGG + Intronic
918420188 1:184356524-184356546 TTAAAAAAGAAAGAAAAAGAAGG + Intergenic
918732552 1:188016301-188016323 TTTAAAAAGAAAGAAAAGGAAGG - Intergenic
918754298 1:188317687-188317709 TTGAAATAGAAAGAAAAGAATGG + Intergenic
918959141 1:191248899-191248921 TTTAAAAAAAAAGAAAAGGAGGG - Intergenic
918982612 1:191582943-191582965 TTCAAAAAAATTGAAAAGGATGG - Intergenic
919483965 1:198123056-198123078 TTTAAAAATAATAACAATGAAGG + Intergenic
919846123 1:201643291-201643313 AAGAAAAAGAAAGAGAAGGAAGG - Intronic
920131641 1:203736656-203736678 TTGAGAAATGATGACCAGGAAGG + Intronic
920762965 1:208803636-208803658 TTCAAGCAGAATGACAAAGAAGG - Intergenic
920894101 1:210026648-210026670 CAGAAAGAGAATGACAAGTAGGG - Intronic
920903908 1:210140939-210140961 TTGAAAAACAATAACAAGGTTGG - Intronic
921196002 1:212758834-212758856 TTGAAAAAGAAGAACAAGGTTGG + Intronic
921242463 1:213199600-213199622 TTGAATAAGAGTGGCAAGGGAGG - Intronic
921516300 1:216096716-216096738 TGAAAAAAGAAAGACAGGGAAGG + Intronic
921635604 1:217488555-217488577 CTGAAATATAATGACAGGGAAGG - Intronic
921787979 1:219254956-219254978 ATAAAAAAGAATGAAAAGTAAGG - Intergenic
921970709 1:221146256-221146278 CTCAAAAAGAAAGAGAAGGAAGG + Intergenic
922010579 1:221581084-221581106 TTGACAAAGAATAACAAAGTTGG + Intergenic
922176018 1:223198212-223198234 TTAAGAAAGAATGACAGAGAAGG - Intergenic
923307716 1:232703375-232703397 TTGATAAAGAGTGACCAGGGTGG - Intergenic
923649779 1:235863656-235863678 TGGGAAAAGAATGACTAGGTTGG + Intronic
923823148 1:237469621-237469643 TTGAAAAAGAATGAGAATTCTGG - Intronic
924390308 1:243547995-243548017 CTGAAATAGAATGAAAAAGAGGG - Intronic
924519091 1:244790520-244790542 TTGAAAAAGAAGAACAAAGTTGG + Intergenic
924546776 1:245035268-245035290 TTGAAAAAGGATAACAAAGTTGG + Intronic
924841828 1:247719244-247719266 TGGAAAAGGAATGACTAGAAAGG - Intergenic
924842667 1:247729976-247729998 TTAAAAAATAATGATAATGAAGG - Intergenic
1063057024 10:2516908-2516930 TTTAGAGAGACTGACAAGGATGG - Intergenic
1063166993 10:3472311-3472333 TAGAACAAGAATGTCAAGAAAGG + Intergenic
1063213180 10:3899765-3899787 TTGGAAAAGAAAGAAAAGAAAGG + Intergenic
1063495666 10:6505319-6505341 TTGAAAAACAATTCCATGGATGG - Intronic
1063878545 10:10507156-10507178 AAGAAAAAGAAAGAAAAGGAAGG - Intergenic
1064045532 10:12011300-12011322 TTTAAAAACAATGACAGGGCTGG + Intronic
1064354534 10:14604855-14604877 ATGAAAGAGAATGAGAATGAGGG - Intronic
1065086172 10:22179723-22179745 TTGAAAAAGAATGACAAAGTTGG + Intergenic
1065163685 10:22951832-22951854 TAGAAAAAGAAGAACAAGGCTGG + Intronic
1065724810 10:28659029-28659051 TTGAGAAAGAAAGCCATGGAAGG + Intergenic
1065822162 10:29535769-29535791 TTGACAAAGATTGAAAAAGAGGG + Intronic
1066167786 10:32807391-32807413 TTAAAAAAAAATGACAAGAGAGG + Intronic
1066427527 10:35321764-35321786 TTGAAAAAGAACAACAAAGTTGG + Intronic
1067086892 10:43246470-43246492 TTGAAAAAGAAGTACAAAGTTGG + Intronic
1068541992 10:58305110-58305132 TTGGAAAATAATTACAAAGATGG - Intergenic
1068771056 10:60821009-60821031 TTTAAGAAAAATCACAAGGAAGG + Intergenic
1068837825 10:61573621-61573643 TTAAAAAATAATGAAAAGGTGGG + Intergenic
1068986339 10:63110850-63110872 TGGAAATAGAATGACAAGTTAGG + Intergenic
1069190933 10:65488780-65488802 TTCCAAAAGATTGAGAAGGAGGG + Intergenic
1070070964 10:73088929-73088951 TTGAAAAAGAATAACAAAGTTGG - Intronic
1070108914 10:73463434-73463456 TAGAAAAAGAATGAAAAGTTAGG - Intronic
1070431543 10:76344590-76344612 TTTAAAAAGAATTATAATGAGGG + Intronic
1070578870 10:77703759-77703781 TAGAAAAATGGTGACAAGGATGG + Intergenic
1071344755 10:84682368-84682390 TTGGAAATGAAAGACAAGTATGG - Intergenic
1071355848 10:84793447-84793469 TTGAAAATGAAGGACAAAGTTGG - Intergenic
1071462137 10:85908734-85908756 TTGAAAATGAAGAACAAGGCAGG + Intronic
1071737776 10:88320684-88320706 TTAAAAAAAAAAGACAAAGAAGG + Intronic
1071833924 10:89400217-89400239 TTGAAAAAGAAGAACAAAGTTGG - Intronic
1071928064 10:90434391-90434413 GTGAAAGAGAAAGAGAAGGAGGG - Intergenic
1072755208 10:98016080-98016102 TTGACAAGGAGTGACAAAGAGGG + Intronic
1072849884 10:98878409-98878431 TTAAACAAGAAAGACAAGGTAGG + Intronic
1073294950 10:102433274-102433296 AAGAAAAAGAAAGAGAAGGAAGG - Intergenic
1073644539 10:105286702-105286724 TTGATAAAGAAAGACAAAGTTGG - Intergenic
1073671773 10:105598827-105598849 TTTAGAAAGAATGAAAAGAATGG + Intergenic
1073711089 10:106042602-106042624 TTGAAAAAGAAAGACAAAGTTGG + Intergenic
1073732042 10:106300513-106300535 TTGCAAAGGAATGAGAATGATGG - Intergenic
1073913433 10:108373909-108373931 TTGAAAAATGATGACAGGGCAGG + Intergenic
1073965191 10:108980738-108980760 TTGTAAAAAAATGATAATGAAGG + Intergenic
1073993185 10:109287405-109287427 CTGATAAAGAATGACAAGGGAGG - Intergenic
1074055408 10:109918929-109918951 AAGAAAAAGAACGAAAAGGAAGG + Intronic
1074356221 10:112785906-112785928 TTGAAAAAGAAGAACAAAGTTGG - Intronic
1074672945 10:115815852-115815874 TTTAAAAAGAATTATAAGGCAGG - Intronic
1074784069 10:116823448-116823470 TTGAAAAAGAAGAACAAAGTTGG + Intergenic
1075221103 10:120585501-120585523 TGGCAAAAGGATAACAAGGATGG + Intronic
1075376270 10:121980108-121980130 TTGAAAAAGAAGGACAAATTTGG + Intergenic
1075947479 10:126448974-126448996 TTGAAAGAGTTTGAGAAGGATGG - Intronic
1076051683 10:127339319-127339341 TTGAATCAGAGTGACAAGAAGGG + Intronic
1076387959 10:130072255-130072277 TTGAAGTAGAATAACAAGCAAGG - Intergenic
1076419869 10:130323756-130323778 TTGCAAATGTATGACAAGGATGG - Intergenic
1077427261 11:2488407-2488429 TTGGGAAAGATTGAGAAGGATGG + Intronic
1077452607 11:2658468-2658490 TTAAAAATAAATGAAAAGGATGG - Intronic
1077461109 11:2710916-2710938 TTGAAAAAGAAAAACAAAGTTGG - Intronic
1077811976 11:5647396-5647418 TCTAAATAGAATCACAAGGAAGG + Intergenic
1077864671 11:6212152-6212174 TTGATTAAGACTGAGAAGGATGG - Intronic
1078273901 11:9824260-9824282 TTGAAAAAGATTGTTAAGGCCGG + Intronic
1078423900 11:11234031-11234053 TTGGAAATGAATGCGAAGGAGGG - Intergenic
1078606468 11:12780899-12780921 TTGAAAAAGAAGAACAAAGTTGG + Intronic
1078634899 11:13040300-13040322 AAGAAAAAGAATGAGAGGGATGG - Intergenic
1078643981 11:13121479-13121501 TTGAAAAAGAAGAACAAAGTTGG - Intergenic
1078778371 11:14414512-14414534 TTGAAAAGGAATGAAAAAGGGGG + Intergenic
1078850966 11:15163320-15163342 AGGGAAAAGAATGAGAAGGAAGG - Intronic
1079303536 11:19301323-19301345 ATTAAAAAGACTGACAAGGATGG + Intergenic
1079627328 11:22631850-22631872 TTGCAAAAGATTGAGAAAGAGGG - Intronic
1079681952 11:23308112-23308134 CTGAATAAGAATGAAAAGGTAGG - Intergenic
1079698778 11:23518261-23518283 TTACAAAAGAATGAAAAGGTTGG - Intergenic
1079975011 11:27080022-27080044 TTTAAAAAGAAAGAGCAGGATGG - Intronic
1080033453 11:27687099-27687121 GAAAAAAAGAATGAAAAGGAAGG - Intronic
1080176798 11:29372594-29372616 TTGAAAGAGAATAACAAAGTTGG - Intergenic
1080324861 11:31058768-31058790 TTGAAAGAGATAGACAAGGTAGG + Intronic
1080556623 11:33422784-33422806 ATGAAAAAGAAAAAAAAGGAAGG + Intergenic
1080741069 11:35064724-35064746 CTTTAAAAGAATGACAACGAAGG - Intergenic
1081026624 11:38022744-38022766 TTCAAAAAAATTGAGAAGGAGGG + Intergenic
1081262294 11:40975428-40975450 TTGAGAAATAATGAGAAGGCAGG - Intronic
1082192540 11:49264777-49264799 TTGAGAAAGTTTGAAAAGGAAGG - Intergenic
1082610712 11:55293872-55293894 TTGAAAAAGAATGATAATTTTGG - Intergenic
1082783318 11:57302930-57302952 TGGAAAAAGCATGGGAAGGAGGG - Intronic
1082918633 11:58467338-58467360 TTGAAGATAAATGACAGGGAAGG + Intergenic
1082954269 11:58851972-58851994 TTGAGAAAGAGTGAGAAGGCTGG + Intronic
1083398419 11:62407047-62407069 TTTAAAAACAATGATAAGGCTGG + Intronic
1083813779 11:65120380-65120402 ATGAAAAAGAATGACCTGGGGGG + Intergenic
1084214423 11:67639827-67639849 TTGAAGAGGGAGGACAAGGAGGG - Intergenic
1085072269 11:73557716-73557738 TTGAAAAAGAACAACAAAGTTGG + Intronic
1085149863 11:74242420-74242442 TTGAAAAAGAAGAACAAAGTTGG - Intronic
1085166833 11:74409227-74409249 TTGAAAAATAAGGACAAAGTTGG - Intergenic
1085290830 11:75398342-75398364 TTGAAAAAGAAGGCCAGGCACGG + Intergenic
1085812476 11:79696882-79696904 CAGAAAAAGTATGAAAAGGAAGG + Intergenic
1085926564 11:81030654-81030676 TTGATAAAGAAGAACAAAGAGGG - Intergenic
1086168680 11:83810112-83810134 CTGAAAAAGAAAGAAAAGAAGGG - Intronic
1086519044 11:87649171-87649193 TTGAAAAAGAAGAACAAAGTTGG + Intergenic
1086673576 11:89576194-89576216 TTGAGAAAGTTTGAAAAGGAAGG + Intergenic
1087053907 11:93913376-93913398 TTGAAAAAGAAAAACAAGCTTGG - Intergenic
1087126635 11:94633903-94633925 CTGAAAAAGAATAACAAGAAAGG + Intergenic
1087239525 11:95759192-95759214 TTGAAAAATAACGACAGGAAGGG - Intergenic
1087273515 11:96137590-96137612 TGGAAAAAGAATAACAAGTATGG + Intronic
1087630568 11:100646371-100646393 AAGAAAAAGAAAGAAAAGGAAGG + Intergenic
1087704029 11:101468453-101468475 TGGAATACAAATGACAAGGAGGG - Intronic
1088330853 11:108649755-108649777 GTCAAAAAGGATGAAAAGGATGG + Intergenic
1088552725 11:111030337-111030359 TTTCAAAAGATTGAGAAGGAGGG + Intergenic
1089012900 11:115145157-115145179 TTAAAAAAGAATCACAAAGCAGG + Intergenic
1089672887 11:120068641-120068663 TTGAATCAGAATGCCCAGGATGG + Intergenic
1090129991 11:124130736-124130758 TTGATAAAAAACGACAAAGAAGG - Intronic
1090783563 11:130028602-130028624 TTAAAAAAAAATGACCAGGCTGG - Intergenic
1091112185 11:132979814-132979836 TTGTAAGAGACTGAGAAGGAAGG + Intronic
1091609290 12:1989716-1989738 TTGAAAAAGCAAGAAAAGAAAGG + Intronic
1092333321 12:7605637-7605659 TTACAAAAGCATTACAAGGACGG + Intergenic
1092519279 12:9250813-9250835 TTCTAAAAGATTGAAAAGGAGGG + Intergenic
1092579471 12:9822456-9822478 AGGAAAAAGAATGAAAAGGAAGG + Intergenic
1092681344 12:10985005-10985027 TTTAAAAAGAATTTCAAGTATGG + Intronic
1092711159 12:11339285-11339307 TTGAAAAAAGATGAGAAGAATGG - Intergenic
1092719052 12:11422620-11422642 TTGAAAGAATATGTCAAGGATGG + Intronic
1093146293 12:15570650-15570672 TTGGAAATGAATGAGGAGGATGG + Intronic
1093410165 12:18855766-18855788 TTGAGAGAGAAGGACAAAGATGG + Intergenic
1093637413 12:21488026-21488048 TTGGAAAAGAATGACTATGAAGG - Intronic
1093773897 12:23049917-23049939 TTGAACAAAAATGAGAAGGAAGG + Intergenic
1093974519 12:25406532-25406554 TTGAATAAGAGTGATAAGGTTGG - Intergenic
1094280596 12:28733212-28733234 TGGAGAAAGTAGGACAAGGAAGG + Intergenic
1094432211 12:30381759-30381781 TTGAAGAAGAAGAACAAAGATGG + Intergenic
1094539404 12:31350646-31350668 ATGAGAAAGAAGGACAAGAAGGG - Intergenic
1094632938 12:32195313-32195335 TTGAGAAAGAAGGACAAAGCTGG + Intronic
1094683565 12:32687854-32687876 TTGAAAAAGAAAAACAATGCTGG - Intronic
1094700387 12:32864726-32864748 TTGAAAAAGAATAAAATGGATGG + Intronic
1095051188 12:37555472-37555494 TTTAAAATGAATGAAAACGAGGG - Intergenic
1095449554 12:42315768-42315790 TTGTAAAAGAAAGAAAGGGAGGG - Intronic
1095457750 12:42407130-42407152 TTAAAAAAGAAAAACAAGGTAGG - Intronic
1095489117 12:42714683-42714705 ATGAATAAGAAAGACAAGGACGG + Intergenic
1095533790 12:43222472-43222494 TTGAAAAAGCCTGACAAAGGTGG + Intergenic
1095579127 12:43775728-43775750 TAGAAAAAGAATTACTAGGTAGG + Intronic
1095607641 12:44089176-44089198 TTTGAAATGAATGAAAAGGAAGG + Intronic
1095652680 12:44631345-44631367 TTAAAAAGGAATCACAATGAAGG + Intronic
1095756198 12:45769956-45769978 TTGAAAAATAAAGGCAAGGCCGG + Intronic
1096294073 12:50368719-50368741 TTGAAAAAGAATAACAAAGTTGG + Intronic
1096783245 12:54002800-54002822 CTTAAAAAGAAAAACAAGGAAGG + Exonic
1097214630 12:57401005-57401027 TTCAAAAAGAAAGACAAGTCAGG + Intronic
1097372487 12:58801360-58801382 TTGAAAGAGAAAGATAATGATGG - Intronic
1097512630 12:60563087-60563109 TTAAAAAAAAAACACAAGGAAGG - Intergenic
1098022138 12:66167585-66167607 TTTAAAAAGAAAGAAAAGAACGG + Intronic
1098354186 12:69595021-69595043 TTGAAAATGAATGAATAGGTTGG + Intronic
1098457352 12:70689853-70689875 TTGCTAAAGAAAGACAGGGATGG - Intronic
1098522452 12:71448962-71448984 TAGAAAAAGAATGGCAAGAGAGG + Intronic
1098549711 12:71749830-71749852 ATGAATAAGAATCACAAGGAGGG + Intergenic
1098557055 12:71831034-71831056 TTGAAAAAGAAGAACAAAGTTGG - Intergenic
1098657984 12:73057215-73057237 TTGAGAAAGAATAAGAAGAATGG - Intergenic
1099041657 12:77661987-77662009 TTGAAAAAGAAAGTCAAAGGTGG - Intergenic
1099141684 12:78984876-78984898 TAGAAAAAGAATTAACAGGAAGG + Intronic
1099165642 12:79304008-79304030 TTGTGAATGAATGACCAGGAAGG - Intronic
1099320771 12:81145688-81145710 CTGAAATAGAATCAGAAGGATGG + Intronic
1099558229 12:84138823-84138845 TTAAAAAAGAAGGACAAAGTTGG + Intergenic
1099586651 12:84525669-84525691 TTAAAACAGAATTACAAAGAGGG - Intergenic
1099675627 12:85756664-85756686 TATAGAAAGCATGACAAGGAGGG - Intergenic
1099881151 12:88468014-88468036 TTGAAAAATTATGAAAAGGAAGG - Intergenic
1100101938 12:91119512-91119534 ATGAAAGAGAATAACAAGGACGG + Intergenic
1100327886 12:93557223-93557245 TTGAAAAAGAATAACAAAGTTGG - Intergenic
1100427432 12:94500379-94500401 TTTAAAAAGAAAGAAAAGAAAGG + Intergenic
1101225256 12:102681885-102681907 GAGAAAAAGAATGAGAGGGAAGG - Intergenic
1101484371 12:105137443-105137465 TTGAAAAATAAGGAGAAAGAGGG - Intronic
1101644047 12:106612045-106612067 TTGAAAAAGAAGAACATGAAAGG - Intronic
1102726443 12:115069702-115069724 TTGAAAAGGCAGGAAAAGGAGGG - Intergenic
1102980019 12:117234057-117234079 TTCAATATGAATGTCAAGGATGG + Intronic
1103071551 12:117948076-117948098 TTGAAAAAGAATAATAAAGGTGG + Intronic
1103109513 12:118263043-118263065 TTGAAAAAGGAGGACAAAGTTGG + Intronic
1103766125 12:123281174-123281196 TTGAAAAAGAAGAACAAAGTTGG - Intergenic
1104272632 12:127295693-127295715 TGGAGAAAGAAGGACAAAGAAGG + Intergenic
1104433545 12:128737005-128737027 CTGAAGAAGAAAGAAAAGGAAGG + Intergenic
1105795391 13:23847075-23847097 TTGAAAAAAAATCAACAGGAGGG + Intronic
1105913991 13:24895277-24895299 TTAAAAAAGAAAGCCAAGGCCGG + Intronic
1105937012 13:25110696-25110718 TTGAAAAAGAAGAATAAAGATGG - Intergenic
1106079291 13:26487335-26487357 TTTAGAAAGAATGACCAGAATGG + Intergenic
1106617382 13:31341818-31341840 TTGAAAAAGAATTAGAAGAATGG + Intergenic
1106799285 13:33240324-33240346 TTGAAAAAGAAGGACAAAGTTGG - Intronic
1107005533 13:35605553-35605575 TTGAAAAAAGATGATCAGGATGG + Intronic
1107092914 13:36502015-36502037 TTGAAAAAGAAAAACAAAGTTGG - Intergenic
1107131646 13:36902750-36902772 TTGAAAAAGAAGAGCAAGGCTGG - Intronic
1107354435 13:39551535-39551557 TTGAAAAAGAAGGACAAAGTTGG - Intronic
1107523314 13:41204724-41204746 TTGAAATACAATCACCAGGAAGG - Intergenic
1107723581 13:43275256-43275278 TTTAAGAAAAAAGACAAGGAAGG - Intronic
1108055898 13:46484659-46484681 ACGAAAATGAATGAAAAGGAAGG - Intergenic
1108128699 13:47273728-47273750 TGGAGAATGAATCACAAGGAAGG + Intergenic
1108269463 13:48745321-48745343 TTGAAAAAGAATAAATTGGAAGG - Intergenic
1108273568 13:48786281-48786303 TGTAAAAATAATGAGAAGGAGGG + Intergenic
1108481473 13:50876877-50876899 TTGAAAAAGAAGAACAAAGTTGG - Intergenic
1108726733 13:53191360-53191382 TTGAGGAACAAAGACAAGGAAGG + Intergenic
1109185770 13:59265797-59265819 ATGAAAAAGAAAAAAAAGGAAGG - Intergenic
1109250365 13:60012428-60012450 TGGAAAAAGAATGAAAAGGCAGG + Intronic
1109363363 13:61324826-61324848 TTGAAAAAAGATGAGAAGAATGG + Intergenic
1109447211 13:62457041-62457063 TTGAAATAGAATAACCAGTAGGG + Intergenic
1109448585 13:62478861-62478883 TTGAAAAAGAAGAACAAAGCTGG + Intergenic
1109596891 13:64568281-64568303 GTGAAAAAAAAAGACAAAGAGGG - Intergenic
1109710356 13:66151216-66151238 TTGAGAATGAATGACAATGTAGG + Intergenic
1109904702 13:68824630-68824652 TTGAAAAATAATAACAACAATGG - Intergenic
1110309359 13:74029896-74029918 GTGAAAAAGTATGGAAAGGAAGG + Intronic
1110798729 13:79670390-79670412 ATGAAAAGGAATGACAAGTTTGG - Intergenic
1110887953 13:80661797-80661819 TTCCAAAAGATTGAAAAGGATGG - Intergenic
1110999517 13:82161413-82161435 TGGAAAAAAAATGAACAGGATGG + Intergenic
1111145400 13:84171481-84171503 ATGAAAAAGATTGTGAAGGAAGG + Intergenic
1111480895 13:88824930-88824952 GAGAAAAAGAAGGAAAAGGAAGG - Intergenic
1111491717 13:88985659-88985681 TTGAAAAAGAAACACAAAGTTGG + Intergenic
1112049031 13:95627059-95627081 TTGAAAAAGAAAAACAAAGTTGG + Intronic
1112084175 13:96010822-96010844 CTGAAAAAGAATAACAAAGCTGG + Intronic
1112428607 13:99329232-99329254 TTAAAAAAGAAAAACAAGGTGGG - Intronic
1112612793 13:100972463-100972485 TTCCAAAAAAATGACAAGGAAGG - Intergenic
1112651576 13:101404831-101404853 TGGGACAAGAAAGACAAGGAAGG - Intronic
1112956592 13:105066749-105066771 TGAAAAAAGAATGATATGGAAGG + Intergenic
1112964604 13:105172504-105172526 TTGAAAAAGAAGAACAAAGCTGG + Intergenic
1114336451 14:21696120-21696142 TTGAAAAAGAAAAATAAGGTGGG + Intergenic
1114904869 14:27114869-27114891 TTTCAAAAGACTGAGAAGGAGGG - Intergenic
1115735199 14:36320393-36320415 GAGAAAAAGAATGGCGAGGAGGG + Intronic
1115860183 14:37677001-37677023 TTGAAAAAGAAAAACAAAGCTGG - Intronic
1115903194 14:38177283-38177305 TTGCAAAAAAATGAAAAAGATGG + Intergenic
1115903544 14:38181810-38181832 TTGAAAAAGTACTACAATGATGG - Intergenic
1115940467 14:38602598-38602620 CAGAAAAAAAATGACAAGAACGG + Intergenic
1116160305 14:41259273-41259295 TTCAACAAGCATGACAAGCAAGG - Intergenic
1116213976 14:41986803-41986825 TTGAAACACTATGACAAGGCAGG - Intergenic
1116906313 14:50407002-50407024 TTGAAAAAGAAGAACAAAGTTGG - Intronic
1116913318 14:50494626-50494648 TTGAAAAAGAAGAACAAAGTTGG + Intronic
1117035236 14:51721617-51721639 TTGAGAAAGAAAGAGAGGGAGGG + Intronic
1117224697 14:53643421-53643443 ATGAAAAAGCATGAAAATGAAGG - Intergenic
1117262958 14:54055583-54055605 TTTAAAATACATGACAAGGATGG - Intergenic
1117607738 14:57448063-57448085 TTGAAAAGGAATGATAAGAGAGG + Intergenic
1117696226 14:58367008-58367030 TTAAAAAAGAAAGACAGGGAAGG + Exonic
1117782407 14:59247328-59247350 TTGAAAAAGAAGAACAAAGCTGG - Intronic
1117800362 14:59437542-59437564 TTGAAAAAGAATAACAAAACTGG + Intronic
1117982755 14:61358170-61358192 TTTAAAAAGAAAGACACTGAGGG - Intronic
1118557119 14:67036983-67037005 TTGAAAAAGAAGAACAAAGCTGG + Intronic
1118557778 14:67044884-67044906 TTTAAAAAGAAAGAGAGGGAGGG - Intronic
1118613614 14:67560337-67560359 GTTAAAAAGAATGAAGAGGATGG - Intronic
1118754461 14:68829585-68829607 TTGAAAAAGAAGAACAAAGCTGG + Intergenic
1120115640 14:80614163-80614185 TTAAAAAAGAATGAAAAAAAGGG + Intronic
1120133968 14:80842453-80842475 TTTAAAATGAAAGACAAAGAAGG + Intronic
1120374544 14:83685833-83685855 TTGAAAAAGAAAAACAAAGCTGG + Intergenic
1120380796 14:83776346-83776368 TAAAAAAAGAATGATAAGCAGGG + Intergenic
1120860090 14:89247142-89247164 TTGAAAAATTATGAGATGGAGGG - Intronic
1121118877 14:91363405-91363427 TGGAAAAAGAATGCAAAGGCCGG - Intronic
1121146561 14:91588554-91588576 TTTAGAAAGGATGACAAGAAAGG - Intronic
1121862817 14:97335607-97335629 TTGAAAAAGAAGAACAAAGTGGG - Intergenic
1122431495 14:101650938-101650960 ATGAAAAAGAATGAAGAGTATGG + Intergenic
1122658134 14:103275743-103275765 TTTAAAAAGAATAATAAGGTGGG - Intergenic
1122703633 14:103606788-103606810 AAGAAAAAGAAAGAGAAGGAAGG - Intronic
1122752346 14:103947087-103947109 TTGAAAAAGAAGTACAAAGCTGG + Intronic
1123168884 14:106352210-106352232 AAAAAAAAGAATGACAAGAATGG + Intergenic
1124079871 15:26482611-26482633 TTGGAAAAGAAAGACAAAGTAGG + Intergenic
1124339623 15:28881864-28881886 GGGAAAAAGAAGAACAAGGAAGG - Intergenic
1124344123 15:28910094-28910116 ATCAGAAATAATGACAAGGATGG + Intronic
1124475620 15:30031577-30031599 TTGAAAAAGAATAACAAAGTTGG - Intergenic
1124553311 15:30702867-30702889 TTGAAAAAGAAGGATAAAGTGGG - Intronic
1124681609 15:31736528-31736550 GTAGAAAAGAATGACAGGGAGGG + Intronic
1124709465 15:31994022-31994044 TTGAAAAAGAATAATAAAGTGGG - Intergenic
1124792507 15:32742574-32742596 TTGAAAAAGAAGAACAAAGCTGG + Exonic
1124986316 15:34619504-34619526 CTGCAATAGAATGACTAGGAAGG + Intergenic
1125152009 15:36543457-36543479 TGGAAAAAGTATCACAATGAAGG - Intergenic
1125292979 15:38170258-38170280 TAGAGAGAGAATGAGAAGGAAGG + Intergenic
1125370473 15:38971141-38971163 AGAAAAAAGAAAGACAAGGAGGG + Intergenic
1125438509 15:39674452-39674474 TTGAAAACGAAAAGCAAGGAGGG + Intronic
1125547983 15:40522397-40522419 TTGAAAAAGAAGAACAAAGTTGG - Intergenic
1125866793 15:43058671-43058693 TAGAAAAAGAATGAAAAGGTTGG - Intronic
1126155392 15:45560914-45560936 TTGAAAAAGAAGAACAAAGTTGG + Intergenic
1126157483 15:45578796-45578818 TTGCAAAATAATTAAAAGGAAGG - Intergenic
1126241235 15:46446653-46446675 TTGAAAAAGAAAGAAAAAAAAGG - Intergenic
1126352951 15:47764215-47764237 TTGAAAAAGTATTCAAAGGACGG + Exonic
1126386066 15:48094644-48094666 TTGAAAAAGGAGGACCAGGCTGG - Intergenic
1126386252 15:48096439-48096461 GTGCCAAAGAATGGCAAGGAGGG - Intergenic
1126504366 15:49387099-49387121 TTCCAAAAGATTGAGAAGGAAGG + Intronic
1126570526 15:50145925-50145947 ATGAAAATGAATGAGAAAGATGG + Intronic
1126640045 15:50815219-50815241 TTAAAAAAGAATTAAAAGCAGGG - Intergenic
1126647334 15:50888146-50888168 TTGAAAAAGAAGAACAAAGCTGG - Intergenic
1126948809 15:53855826-53855848 TTCCAAAAGATTGAAAAGGAGGG - Intergenic
1127062290 15:55199106-55199128 ATGAATAAGAAGGACAAGGAAGG - Intergenic
1127218541 15:56851402-56851424 TTGAAAAAGAATAACAGGCCAGG + Intronic
1127429318 15:58886591-58886613 TTGAAAAGGAAACACAAGTAGGG + Intronic
1128540639 15:68527609-68527631 TTGAAAAAGAAAAACAAAGTTGG - Intergenic
1128662003 15:69508381-69508403 ATGAAAGAGAAAGACAAGCAAGG + Intergenic
1129012529 15:72435238-72435260 TTGAAAAAGACAGACAAAGCTGG - Intergenic
1129027682 15:72593742-72593764 TTGAAAAATAACAAAAAGGAAGG - Exonic
1129695259 15:77737386-77737408 TTGTAAAAGAAAGAGAAGGGAGG + Intronic
1130043086 15:80421390-80421412 TTGAAATAGAAAGAAAAGAAAGG + Intronic
1130262284 15:82365213-82365235 TTGAAAAATAAAGACAAAAAAGG - Intergenic
1130560877 15:84957757-84957779 TTTAAAAAGAATAACAAAGATGG - Intergenic
1130605189 15:85309438-85309460 TTCCAAAAGAATGAGAAAGAGGG + Intergenic
1131414156 15:92237511-92237533 TGGAAAAAAAAAGACAAAGAAGG + Intergenic
1131569000 15:93513855-93513877 TTGAAAAAGAATGACAACGTTGG + Intergenic
1131600969 15:93848376-93848398 TAGAGACAGAAAGACAAGGATGG + Intergenic
1131636630 15:94239732-94239754 TTGGCAAAGAATGAGAAAGAAGG + Intronic
1131979588 15:97981707-97981729 TTCAAATAGAAACACAAGGATGG - Intergenic
1132080555 15:98861355-98861377 GTGAAAGAGAAGGACTAGGAGGG - Intronic
1132199193 15:99937115-99937137 TTGAAAAAGAGAAACAAGGTGGG - Intergenic
1132373016 15:101310889-101310911 CTGAAAAAGACTGAAAATGAGGG - Intronic
1132418151 15:101639422-101639444 TTGAAAAAGCCTGAAAATGAAGG - Intronic
1133522887 16:6576041-6576063 TTCAAAAACAATGACTAGCATGG + Intronic
1133957842 16:10461503-10461525 TTGCAAATGAATGAAAATGAAGG + Intronic
1134103007 16:11465746-11465768 TTGTAAAAGAAAGAGAAGGCGGG + Intronic
1134541034 16:15065745-15065767 TTGCAAAAGAATTAGAAGGTTGG + Intronic
1134914163 16:18055541-18055563 CTGAAAAAGAAAGGGAAGGAAGG + Intergenic
1135226537 16:20663816-20663838 TGGAAAAAGAAATACACGGAAGG - Intronic
1135431849 16:22391133-22391155 TTGAAAAAGAAGAACGAGGCTGG - Intronic
1135436486 16:22430289-22430311 TTGCAAAAGAATTAGAAGGTTGG + Intronic
1135696892 16:24596203-24596225 TTGAATAAGACTGACATTGAAGG - Intergenic
1135807704 16:25557593-25557615 AGAAAAAAGAATGAAAAGGAAGG + Intergenic
1135833658 16:25802527-25802549 TTGAAAAAGAATGACAAGGAAGG - Intronic
1135990180 16:27213892-27213914 TTAAAAAAGAGTGAAAAGTAAGG + Intronic
1136078411 16:27833435-27833457 TTGAAAAAGAAGAATAAGGCAGG - Intronic
1136159723 16:28411337-28411359 TTTAAAAAGAATGACTGGGCTGG - Intergenic
1136203366 16:28703957-28703979 TTTAAAAAGAATGACTGGGCTGG + Intronic
1136263771 16:29101626-29101648 TTGCAAAAGAATTAGAAGGTTGG - Intergenic
1136524420 16:30819646-30819668 TTGAATAAGAATAATAAGAATGG + Intergenic
1138222137 16:55260911-55260933 TTGAAAAAGAGTGAAAAGTTGGG - Intergenic
1138403818 16:56771998-56772020 AAGAAAAAGAATGAAAGGGAAGG - Intronic
1138659109 16:58507438-58507460 TTGTAGAAGAATGAGAAGGAGGG - Intronic
1138722154 16:59094879-59094901 TTGCAGAAGAAACACAAGGAGGG + Intergenic
1138789826 16:59890357-59890379 TTGAGAAAGAAGGACAAAGTTGG - Intergenic
1139894101 16:70274427-70274449 TTGAAAAAGACAGACATGGCTGG + Intronic
1139994684 16:70968577-70968599 TTGTCAAAGAAGGCCAAGGAGGG + Intronic
1140151294 16:72369558-72369580 TTAAAAAAGAAAGACAGAGATGG - Intergenic
1140494742 16:75375493-75375515 ATAAAAAAGACTGACAAGGCTGG + Intronic
1141026651 16:80555159-80555181 TTGAAAAAAAAAGACAAGAAAGG + Intergenic
1142235334 16:88919724-88919746 TCTAAAAAGAAAGACAAGGATGG + Intronic
1142492674 17:288972-288994 TTGCAAAAGAAGCACATGGAGGG - Intronic
1142682854 17:1560665-1560687 AGGAAAAAGAATCAGAAGGATGG + Intronic
1142715873 17:1746726-1746748 TTGCATAAGAATCACCAGGAGGG - Intronic
1143355701 17:6326408-6326430 GGGAACAAGAATGACTAGGAAGG + Intergenic
1143592822 17:7895783-7895805 TGGAAAAAGACAGATAAGGAAGG - Intronic
1144664780 17:17094906-17094928 TTAAAAAAAAATTACCAGGATGG - Intronic
1145735007 17:27222755-27222777 AAGAAAAAGAAAGAGAAGGAAGG + Intergenic
1145920640 17:28606788-28606810 TTGAAAAAGCATCACAGGGCTGG + Intronic
1147512525 17:41083718-41083740 TTGGAAAGGAATTAGAAGGAAGG - Intergenic
1147514690 17:41104900-41104922 TTGGAAAGGAATTAGAAGGAAGG - Intronic
1147540754 17:41356791-41356813 TTGAAAAAGAAGAACAAAGTAGG + Intergenic
1147699185 17:42381399-42381421 TAGCAAAAGAATAATAAGGAAGG - Intronic
1148487286 17:47998684-47998706 TTTAAAAAGAAGGACCAGGCTGG + Intergenic
1149285166 17:55155308-55155330 TTGAAAACAAATGAGAAGGTAGG - Intronic
1149404430 17:56332763-56332785 TTGAAAAAGAAGAACAAAGTTGG - Intronic
1149520106 17:57312331-57312353 TTGAAAAAGAAAAATTAGGAAGG - Intronic
1149628693 17:58100948-58100970 TTGAAAAATAATGATAAAGTTGG - Intergenic
1150098785 17:62403385-62403407 TGGAAACAGAGTGACAAGGCAGG - Intronic
1150144893 17:62760525-62760547 TTATAGAAGAGTGACAAGGAGGG - Intronic
1150368921 17:64618810-64618832 TAGAAAAAGAAGGTAAAGGAAGG - Intronic
1150735308 17:67731908-67731930 TTGAAAAAGAAGAACAAAGTTGG - Intronic
1151121901 17:71801932-71801954 TTGCAATAGAATTAAAAGGAAGG - Intergenic
1151172325 17:72257515-72257537 TTCAAAAAGAATGTGATGGATGG + Intergenic
1151256326 17:72879619-72879641 GTGAACAAGAATGACAAGCCAGG + Intronic
1151764131 17:76123366-76123388 CTGAAAAAGAAAAAGAAGGAAGG - Intergenic
1152523498 17:80874090-80874112 TTGAAAAAGATTGAAAAAGATGG + Intronic
1152547229 17:81007052-81007074 TTGAAAAAGAAGAACAAAGTTGG - Intronic
1152582867 17:81175485-81175507 TTGAAAAAGAAGAACAAAGCTGG + Intergenic
1153176408 18:2378720-2378742 TTGAAAAATAATAACAAAGTTGG + Intergenic
1153356978 18:4148051-4148073 ATGGAAAAGAGAGACAAGGATGG - Intronic
1153402485 18:4695914-4695936 TTGAAAAAAGATGAGAAGCATGG + Intergenic
1154072911 18:11169988-11170010 TTGAAAAAGAAGAACAAAGTTGG + Intergenic
1154099786 18:11461461-11461483 TTGAAAAAGAATAATAAAGTGGG - Intergenic
1154237601 18:12620376-12620398 TTGAAAAAGAACAACAAAGTTGG + Intronic
1155396288 18:25390096-25390118 TAGAAAAAGAATGGAAAGGTGGG + Intergenic
1155821541 18:30383795-30383817 TTGTCAAAGAGTAACAAGGAGGG - Intergenic
1155893103 18:31290453-31290475 TTCAAAAACATTGAAAAGGAGGG - Intergenic
1156103341 18:33625766-33625788 TAGAAAATAACTGACAAGGATGG + Intronic
1156172273 18:34499996-34500018 TTGAAAAAGAAAAACAAAGTGGG - Intronic
1156325508 18:36071373-36071395 TTGAAAAAGAAAAACAAAGTTGG + Intergenic
1156650524 18:39221062-39221084 TTGAAAAAGAATAATGAGAATGG - Intergenic
1156801607 18:41121729-41121751 TAGAAAAAGAAAGGCAAGTAGGG + Intergenic
1157345795 18:46831547-46831569 TTGAAAAAGAAGAACAAAGTTGG + Intronic
1157386898 18:47264944-47264966 TTGAAAAAGAAATAAAAGGAAGG - Intergenic
1157441612 18:47716011-47716033 TGGAAAACTGATGACAAGGAGGG + Intergenic
1157455706 18:47827231-47827253 TTTAACAAGAATGCTAAGGATGG - Exonic
1157787505 18:50498148-50498170 TTGAAAAAGAAGAACAAAGTAGG - Intergenic
1158172631 18:54616708-54616730 TTGAGAAAGAAAGAAAAGAAAGG - Intergenic
1158186576 18:54778701-54778723 TGGAAGAAGAATGGAAAGGAAGG - Intronic
1158651432 18:59290890-59290912 TTGAAAAAGAAAAACAAGTTTGG - Intronic
1158748882 18:60235514-60235536 TGGGAAAAGAATGAATAGGATGG - Intergenic
1158826061 18:61221033-61221055 AAGAAAAAGAAAGAGAAGGAAGG + Intergenic
1158856850 18:61551138-61551160 TTAGAAAAGAATTGCAAGGATGG - Intronic
1159439902 18:68464818-68464840 TTTAAAAAAAATTAGAAGGAAGG + Intergenic
1159832280 18:73292080-73292102 TTAAAATTGTATGACAAGGATGG - Intergenic
1159847827 18:73486994-73487016 AAGAAAAAGAAAGAGAAGGAAGG - Intergenic
1160134558 18:76261440-76261462 TTGAAAAGGAATGTAAAAGAAGG + Intergenic
1160315881 18:77846741-77846763 TTGGAAAAGCTTGAGAAGGATGG + Intergenic
1160925361 19:1542280-1542302 AAGAAAAAGAAGGAGAAGGAAGG - Intergenic
1161936433 19:7375340-7375362 AAGAAAAAGAAAGAAAAGGAAGG + Intronic
1162174753 19:8822800-8822822 TTGAAGAAGGATGGGAAGGATGG - Intronic
1162187567 19:8917772-8917794 TTGACAAAGAGTGGAAAGGAAGG - Intronic
1162204675 19:9046886-9046908 GAGAAAAAGAAAGAGAAGGAAGG - Intergenic
1162410887 19:10504313-10504335 ATCAAAAATAAAGACAAGGAAGG - Intergenic
1162584557 19:11551220-11551242 TAGAGAAAGGATGACAAGTAGGG + Intronic
1163684924 19:18706602-18706624 TTGAAAAAGAATAACAAAATTGG - Intronic
1164249986 19:23467910-23467932 GGGAAAAAGAAGGAAAAGGAGGG - Intergenic
1164403009 19:27915272-27915294 GTTAAAAAAAATCACAAGGAGGG - Intergenic
1165238088 19:34439834-34439856 GAAAAAAAGAATGAGAAGGAAGG + Intronic
1165548234 19:36560574-36560596 TTAAAAAAAAATGAGAAGAAAGG - Intronic
1165768543 19:38365218-38365240 TTGAGAAAGAATGAGAAGAAAGG - Intronic
1166133302 19:40759813-40759835 TTGAGAAACAGTCACAAGGAGGG - Intronic
1166686502 19:44799755-44799777 TAGAAAAAGAAAGAAAGGGAGGG + Intronic
1166725218 19:45022842-45022864 TTTAAAAAGAAAGAAAAGGCCGG - Intronic
1167567339 19:50264910-50264932 TTGGAAAGGAATGAGAAGGATGG + Intronic
1168042856 19:53772516-53772538 TTGGAAAAGAACAACAAGAAAGG - Intergenic
1168268107 19:55233908-55233930 TTTAAAAAGAAGAACAAGGTTGG + Intronic
925695320 2:6571104-6571126 TTGAAAGAGAATTCTAAGGAGGG - Intergenic
925935601 2:8755919-8755941 TTGAAAAAGAAGAACAAAGTTGG - Intronic
926014764 2:9440675-9440697 TTGTGGAAGAAAGACAAGGATGG + Intronic
926022524 2:9509511-9509533 ATGAATAAGACAGACAAGGAAGG + Intronic
926063305 2:9818398-9818420 TAGAAAAAAAAAGAGAAGGAAGG + Intergenic
926263399 2:11290229-11290251 TTGAAACTGCATAACAAGGAAGG - Intronic
926415641 2:12646925-12646947 TTGAAAAAGAAAGAGAGGGCAGG - Intergenic
926453738 2:13039470-13039492 TTGAAACAGAAGGACAAAGTAGG - Intergenic
927158923 2:20240482-20240504 TTTAAGAAGAAGGACAAGGGAGG - Intergenic
927728701 2:25450489-25450511 TTGAAAAAGAAAAACAAAGTTGG - Intronic
927887029 2:26724955-26724977 TAGCAAAAGAAGGGCAAGGAAGG + Intronic
928019472 2:27691074-27691096 TTCCAAAAGAATGAGAAAGAAGG - Intronic
928717890 2:34083848-34083870 TTGAAAAACAATTAAAAAGAAGG - Intergenic
928810579 2:35219516-35219538 CTGAAAAAGAAGGACATGCAGGG - Intergenic
929195593 2:39181236-39181258 TTGAAAAGGAGTGGCCAGGAGGG - Intronic
929219719 2:39450499-39450521 TTGTAAAAGAAACAAAAGGAAGG + Intergenic
929708002 2:44236093-44236115 TTGAAAAAAAATTATAATGAAGG + Intronic
929792063 2:45030714-45030736 AAGAAAAAGAAAGAGAAGGAAGG - Intergenic
929981111 2:46681280-46681302 TGGGAAAAATATGACAAGGATGG + Intergenic
930081661 2:47454592-47454614 ATGAAAAAGTATAACAAGGGGGG + Intronic
930180220 2:48348557-48348579 TTGCAAAAGAATGGCAGGGACGG + Intronic
930441671 2:51416188-51416210 ATGATAAAGAAGGAAAAGGAAGG + Intergenic
930590310 2:53319351-53319373 TGGAACAAGAAAGACCAGGAAGG + Intergenic
930591924 2:53337897-53337919 TTGAAAAAGAAGAACAAAGTTGG - Intergenic
930618459 2:53619138-53619160 TTGAAAAAGAAGAACAAAAAAGG + Intronic
930985716 2:57585471-57585493 TTGAAAAAGAAAAACAAAGTTGG - Intergenic
931083169 2:58798704-58798726 ATAAAAAGGAATGTCAAGGATGG + Intergenic
931227580 2:60346530-60346552 TTGAAAAAGAATAACAAAGTTGG + Intergenic
931519141 2:63076209-63076231 TTGAAAAAAAATGACAAAGTTGG - Intergenic
931545906 2:63387093-63387115 TTCCAAAAAAATGAGAAGGAAGG + Intronic
931552643 2:63463542-63463564 TTGAAAAAGAAGAACAAAGTTGG + Intronic
931978553 2:67669730-67669752 TTAAAAAAGAAGGAGAAGCAGGG + Intergenic
932470099 2:71949428-71949450 TGGAAAAGGCATGGCAAGGATGG + Intergenic
932523670 2:72440918-72440940 TTAAAAAAAAAAGACAAAGATGG + Intronic
932537942 2:72619495-72619517 TTTAAAAAGAATGAGGAGGAGGG + Intronic
932557511 2:72838177-72838199 TTGAAAAAGAAAAACAAAGTTGG - Intergenic
932634962 2:73380155-73380177 AAGAAGAAGAAAGACAAGGAGGG + Intergenic
932727215 2:74189765-74189787 ATGGAAAAGAAGGAAAAGGACGG + Intergenic
933136860 2:78747722-78747744 TTGAAAAACAATTACAAAGATGG - Intergenic
933255909 2:80080225-80080247 TTGAAAAAGGAAGACAAAGTTGG + Intronic
933482675 2:82876540-82876562 AAGAAAAAGAAAGAAAAGGAAGG + Intergenic
933618531 2:84510467-84510489 TTGAAAAAAAATTACACGAATGG - Intergenic
933765815 2:85708301-85708323 TTGAAAAAGCATAACAAATATGG + Intergenic
934072998 2:88402686-88402708 TTGAAAAAGAATAAAATGGGAGG + Intergenic
934878224 2:97947745-97947767 TTGAAAAAGAAGAACAAGATTGG + Intronic
934890474 2:98064076-98064098 TTCCAAAACATTGACAAGGAAGG - Intergenic
935027395 2:99290336-99290358 AGGAAATAGAATCACAAGGAAGG - Intronic
935517698 2:104063156-104063178 TTGAAAAATAAGAACAAAGATGG + Intergenic
936240077 2:110780287-110780309 TTGGAAAAGACTGACAATGCTGG + Intronic
936461872 2:112720358-112720380 TTTAAAAAGAAAGACAAGGCTGG - Intergenic
936486040 2:112926632-112926654 TTGAAAAAGAAGAACAAAGTTGG + Intergenic
936812242 2:116415806-116415828 ATGAAAAAAAAAGACAAAGAAGG + Intergenic
936958855 2:118051801-118051823 TGGAAAAAGGAAAACAAGGAAGG - Intergenic
937172563 2:119890262-119890284 TTAAAAAAAAAAGACAAAGAAGG - Intronic
937461008 2:122085912-122085934 AAGAAAAAGAAAGAAAAGGAAGG - Intergenic
937699610 2:124849475-124849497 TTGAGAAAGAAGAACAAGGCTGG - Intronic
937934674 2:127233568-127233590 TTGAAAAGGAAGAACAAGGCCGG + Intergenic
937974333 2:127572843-127572865 TTGAAAAAGAATAACAAAATTGG - Intronic
938147181 2:128845676-128845698 TTGAAAAAGAAGAACAAAGTTGG - Intergenic
938182919 2:129199900-129199922 TTGTTAAAGAATGGTAAGGAAGG - Intergenic
938186501 2:129236866-129236888 TATAACAAGAATGGCAAGGATGG - Intergenic
938237149 2:129715138-129715160 TTGAAAAAGAAAAAAAAGCAAGG + Intergenic
938325598 2:130397387-130397409 TTTCAAAACAATGAAAAGGAGGG + Intergenic
938423358 2:131162814-131162836 TTTCAAAACAATGAAAAGGAGGG - Intronic
938488224 2:131738268-131738290 GTTAAAAAGAATGACGAGAAAGG - Intronic
938507256 2:131899271-131899293 TTTGAAAAAAATGAGAAGGAAGG + Intergenic
938510083 2:131932676-131932698 CTGAAAAAGAATAACAAAGTTGG + Intergenic
938553936 2:132406414-132406436 TTGAAAAAGAAAAACAAAGCTGG - Intergenic
938756442 2:134384010-134384032 TTGAGAAAGAATCAAAAGAAGGG + Intronic
939115655 2:138057366-138057388 AGGAAAAAGAAAGAGAAGGAAGG - Intergenic
939130225 2:138226047-138226069 TTGAAAAAGAACAACAATGTTGG - Intergenic
939349018 2:141008284-141008306 TTAAAATAAAATTACAAGGAAGG + Intronic
939684628 2:145183938-145183960 TTTAAAAGGAATGACAAGGTTGG + Intergenic
939761832 2:146192156-146192178 TTGAAAGAGAGTGAAAATGAAGG - Intergenic
940179676 2:150918410-150918432 ATGAAAAGGAAGGAAAAGGAAGG + Intergenic
940221756 2:151359993-151360015 CTGAAAAAGAAGGGAAAGGAAGG + Intronic
940326189 2:152427591-152427613 TTGAAAAAAAAAGACAATAATGG - Intronic
940346892 2:152637688-152637710 TTGAGAAATAAGGGCAAGGAGGG - Intronic
940501395 2:154498280-154498302 TTTAAAAAGAATGATAAAGTTGG + Intergenic
940636028 2:156298138-156298160 TTGATAGGGAATGACAGGGAAGG - Intergenic
940825243 2:158404233-158404255 TTGCAATATAATGGCAAGGATGG + Intronic
940986051 2:160053378-160053400 CTGAATAAGAATGATAGGGATGG - Intronic
941498583 2:166239717-166239739 TTGAAATACAAAGACAAGGAAGG + Intronic
941535092 2:166712573-166712595 TTGAATAAGAGTGGCAAGAATGG + Intergenic
941930269 2:170931701-170931723 TTGAAAAATAATGAAAAAAATGG - Intronic
941962855 2:171270571-171270593 ATGAAAAGCAGTGACAAGGAAGG - Intergenic
942008274 2:171731928-171731950 TTCTAAAACAATGACAAAGACGG - Intronic
942189955 2:173459433-173459455 TTGAAAAAGAAAGAAAAAAAAGG - Intergenic
942601844 2:177648607-177648629 TTGAAAAAGAATAATAAGGAAGG + Intronic
942679845 2:178465825-178465847 TTTAAGAAGAATGACCATGATGG - Exonic
942929480 2:181472678-181472700 TTAAAAGAGAATGACAAACAAGG - Intronic
942985856 2:182140850-182140872 AAGAAAAAGAAAGAAAAGGAGGG + Exonic
942999351 2:182305130-182305152 TTGGAGAAGAGAGACAAGGAAGG - Intronic
943382323 2:187166494-187166516 TTGAAAAAGAAAGCAAAGAAGGG - Intergenic
943403385 2:187447153-187447175 TTAAAAAAGAATTTCCAGGATGG - Intronic
943573830 2:189607308-189607330 TAGAAAAAGAAAGAAAAAGAGGG - Intergenic
943577137 2:189643075-189643097 TAGAAAAAAAAGGAGAAGGAGGG - Intergenic
943964079 2:194308828-194308850 CTTAAAAAGAATGTCAAGTAGGG + Intergenic
944289410 2:197988382-197988404 TGGACACAGAATGAGAAGGAAGG - Intronic
944356764 2:198799088-198799110 TTGAAAAAGAGTAACAAAGTTGG + Intergenic
945122614 2:206473073-206473095 TTTTACAAGAATGACAAGTAGGG - Intronic
945275325 2:207982267-207982289 TTGAGAAAGAAAGAAAAGGAAGG - Intronic
945385678 2:209197490-209197512 TTGGAAAAGTTTGAAAAGGATGG - Intergenic
945521192 2:210829502-210829524 TTCCAAAAGACTGAGAAGGAAGG - Intergenic
945619900 2:212122576-212122598 TGGAAAAAGTAAGATAAGGAGGG - Intronic
946110920 2:217416007-217416029 TTGAAAAAGAAAAACAAAGTTGG + Intronic
946622668 2:221575556-221575578 TAGACAAATAATGATAAGGAGGG + Intergenic
946831502 2:223732711-223732733 TTGAAAGAGACTGACAAAAAAGG + Intergenic
946876173 2:224131948-224131970 CTGAAAAATAATGGCAAGGTCGG - Intergenic
947036299 2:225861073-225861095 TTGAAAAAGAAGAACAAAGTTGG + Intergenic
947308030 2:228768561-228768583 TTGAAAAACAAAAACAAAGATGG - Intergenic
947446268 2:230165282-230165304 TTTGAAAAGAATTACATGGATGG - Intergenic
948106868 2:235421516-235421538 GGGAAAATGAATGACAAGGCTGG - Intergenic
1169644826 20:7798447-7798469 GTCAAAAACAATCACAAGGATGG + Intergenic
1169722693 20:8696436-8696458 TTGAAAAATAAGAACAAAGATGG - Intronic
1169785805 20:9358117-9358139 GTGCAAAAGAATCACAGGGAAGG + Intronic
1169866585 20:10207136-10207158 TTGAAAAAGAAGAACAAAGTTGG - Intergenic
1169927294 20:10796191-10796213 TTGAGAAAGAATGTCTACGAAGG + Intergenic
1170463971 20:16606165-16606187 TTTACAATGGATGACAAGGATGG + Intergenic
1170583591 20:17717022-17717044 TAGAGAAAGAATGAAAATGAGGG - Intronic
1170726372 20:18931040-18931062 TTGAACTAGAAAGAGAAGGATGG + Intergenic
1171048052 20:21829591-21829613 CTGAAAAAGAATGTCAATCACGG - Intergenic
1171066594 20:22022646-22022668 ATGAAACACAATGACTAGGAGGG + Intergenic
1171110578 20:22477650-22477672 TTCAAAAAAATTGAAAAGGAGGG + Intergenic
1171155221 20:22865856-22865878 GTGACAAAGACTGACAAAGATGG - Intergenic
1171168223 20:22992467-22992489 TTGAAAAAGAATTAGATGAATGG - Intergenic
1171300606 20:24056785-24056807 TTGAAAAAGAAGAACAAAGTTGG + Intergenic
1171570526 20:26246257-26246279 TTGATAGAGAATGACAAGAGAGG + Intergenic
1171725326 20:28613668-28613690 TTTCAAAAAAATGAAAAGGAGGG - Intergenic
1171789527 20:29508156-29508178 TTTCAAAAAAATGAAAAGGAGGG - Intergenic
1171858007 20:30366292-30366314 TTTCAAAAAAATGAAAAGGAGGG + Intergenic
1171916708 20:31067059-31067081 ATGGAAAGGAATGGCAAGGAAGG + Intergenic
1172042110 20:32052811-32052833 TTAAAAAAGAAAAAGAAGGAAGG + Intronic
1172413675 20:34745875-34745897 TTGAAAAATTATGTCAAAGATGG - Intronic
1172506763 20:35468424-35468446 TTAAAAAATAATGACATAGAAGG + Intronic
1172692709 20:36801574-36801596 TTAAAAAAAAATGACAAGAAAGG + Intronic
1173093444 20:39999815-39999837 TTGTAAAAGAATAACAAAGTTGG + Intergenic
1173238730 20:41273783-41273805 TTGAAAAAGAAAAACAAAGTTGG - Intronic
1173693846 20:44989984-44990006 TTGAAATAGAAGGACAAAGTTGG - Intronic
1174238105 20:49110843-49110865 TTGTAAGTGAAGGACAAGGATGG + Intergenic
1174533610 20:51233906-51233928 TTGCAATTGAATGACAAGAATGG - Intergenic
1174939243 20:54906276-54906298 TTGAAAAAAAATTACACGAATGG - Intergenic
1175649386 20:60704888-60704910 TTGAATAAAAATGGCAAGAATGG + Intergenic
1176263932 20:64198723-64198745 TGGGCACAGAATGACAAGGATGG - Intronic
1176786373 21:13261055-13261077 TTTGAAAAAAATGAGAAGGAAGG - Intergenic
1176994431 21:15538603-15538625 TTGAAAGAGAATGAAATGTAAGG + Intergenic
1177019301 21:15833441-15833463 TTGAAAAAGAACTAGAAGAATGG + Exonic
1177022676 21:15882931-15882953 TTTCAAAAGATTGAAAAGGAGGG - Intergenic
1177044019 21:16146767-16146789 TAGAAAAATAATGCCAAGAAAGG - Intergenic
1177325305 21:19579375-19579397 AAGAGAAAGAATGAAAAGGAAGG + Intergenic
1177811267 21:25927095-25927117 TTGAAAAAGAATGAATTCGACGG + Intronic
1177981388 21:27919392-27919414 CTGAAAAAGAATAACAAAGTTGG - Intergenic
1177984983 21:27963126-27963148 TTTGAAAAAAATGAGAAGGAAGG - Intergenic
1178179390 21:30142773-30142795 TTGTGAAAGAATGAAGAGGAAGG + Intergenic
1178210192 21:30521621-30521643 TTGAATTAGAATGATAAGAAAGG + Intergenic
1179110587 21:38442107-38442129 TTGAAAGAAAATGTCAAGGCCGG + Intronic
1179364737 21:40747674-40747696 TTCCAAAAAATTGACAAGGAGGG + Intronic
1179424601 21:41265168-41265190 TTGAAAAAAAAAAAAAAGGAAGG - Intronic
1179680219 21:43014807-43014829 TTGAAAAGGAATCACAGGGTGGG - Intronic
1179948052 21:44692908-44692930 TTGAAAAAGAGGGACAAAGCTGG + Intronic
1181088125 22:20453588-20453610 TTGAAAAAGAACGATAAGATGGG - Intronic
1181122262 22:20679041-20679063 TTTGAAAAGAAGGAAAAGGACGG - Intergenic
1181180164 22:21062024-21062046 TTCGAAAAGAAGGAAAAGGACGG + Intronic
1181443612 22:22951722-22951744 TTGAAAATTAATGACAAGGAAGG + Intergenic
1181525936 22:23487308-23487330 TTGAAAAAGAAAAAAAAGAATGG - Intergenic
1181914607 22:26269574-26269596 ATGAAAAATAAAGGCAAGGACGG - Intronic
1181915968 22:26280188-26280210 TTGAAAAATAATAAAAAGAATGG - Intronic
1182195894 22:28517141-28517163 TTGAAAAAGACTTACAATAAAGG + Intronic
1182595926 22:31420384-31420406 TTTAAGAAGAAGGACAAGGGAGG + Exonic
1182638229 22:31746207-31746229 TTGAAAAATAAGTACAAGGCTGG - Intronic
1183429519 22:37757363-37757385 TTGAAAAACAAAAACAAGAACGG + Intronic
1183609350 22:38887648-38887670 TTGAGAAAGAATAACAAAGCTGG + Intergenic
1183940352 22:41291190-41291212 ATGAAAGAGATTGAAAAGGATGG + Intergenic
1184448212 22:44566356-44566378 TTGAAAAAGAAGAACAAAGTTGG + Intergenic
1184702693 22:46187320-46187342 TTGGAATATAAAGACAAGGAGGG - Intronic
1184961142 22:47929641-47929663 TTGAAATAAAATGAAAATGAAGG + Intergenic
1203297176 22_KI270736v1_random:51518-51540 GTGAAAAGGAATGGGAAGGAGGG + Intergenic
949153278 3:796814-796836 TTGAAATAGAAAAAAAAGGATGG + Intergenic
949561545 3:5207326-5207348 TTAAAAAAGAAAGAAAAGGAGGG - Intronic
949572295 3:5305251-5305273 GTGAAAAAGAATGATCAAGATGG - Intergenic
949921298 3:9004469-9004491 TTGAAAACGAAGGACAAAGTTGG + Intronic
950148523 3:10668620-10668642 TTTAAAAAGGAGGTCAAGGAAGG - Intronic
950216840 3:11166285-11166307 TTGAAAAAGAAAGACAAGAAGGG + Intronic
950299024 3:11858333-11858355 TTGAAAAAGAATAAAATAGAAGG - Intergenic
950537905 3:13591700-13591722 TTGAAAAAGAAGAACAATGCTGG - Intronic
950537984 3:13592438-13592460 TTGAAAAAGAAGAACAACGCTGG - Intronic
951030866 3:17880436-17880458 TTGAAAAAAAATGACTGGTATGG + Intronic
951098784 3:18662723-18662745 TTGAAAAAAAATTAAATGGAAGG + Intergenic
951365132 3:21771782-21771804 TTGAAAATAAATAACAAAGATGG + Intronic
951616416 3:24550905-24550927 TTTAAAAAGACATACAAGGATGG - Intergenic
951748270 3:26004007-26004029 TGGAAACAGAATGACAACCAAGG - Intergenic
951865836 3:27306264-27306286 ATGACAAAGGATTACAAGGATGG - Intronic
952022260 3:29038133-29038155 TTGAAACAGAAAGAGAATGAAGG - Intergenic
952180446 3:30911243-30911265 TTGAATAAGAGTGAAATGGAGGG + Intergenic
952935394 3:38393964-38393986 TTTAAAAAGAAAAGCAAGGAGGG - Intronic
953741022 3:45539332-45539354 TTAAAAAAGAAAGAGAAGGCTGG + Intronic
953893936 3:46779653-46779675 TTGAAAAAGAATAACAAAATTGG + Intronic
954301823 3:49704398-49704420 TTGAAAATAAATGAAAAAGAAGG + Intronic
954600011 3:51859879-51859901 TTGAAAAAGAAAAACAAAGTGGG + Intergenic
954911375 3:54113689-54113711 TTGAAAGAGGAGGAGAAGGAGGG - Intergenic
954918384 3:54167956-54167978 TGGAAAAAAAATGACAAGGAAGG - Intronic
954965938 3:54610923-54610945 TTGAAAAAAAATGTCCAGGCAGG - Intronic
955035970 3:55268271-55268293 TTGAAAAAAAAAAAAAAGGATGG - Intergenic
955458071 3:59146867-59146889 TTGAAAAAGAACAACAAAGCTGG - Intergenic
955701651 3:61687615-61687637 ATGAAAAAGAATGAGAAGTTAGG + Intronic
955864588 3:63369731-63369753 ATAAAAAATAATGACATGGAAGG - Intronic
956378374 3:68639968-68639990 TTACAACAGAATAACAAGGATGG + Intergenic
956382908 3:68685122-68685144 AGAAAAAAGAATGAAAAGGAAGG - Intergenic
956657702 3:71568090-71568112 TAAAAAAAGAAAGAAAAGGAAGG + Intronic
957108875 3:75927104-75927126 TTGATAAAGAATGACAAGAGAGG - Intronic
957265016 3:77952088-77952110 TTTATAAAAGATGACAAGGAAGG - Intergenic
957275248 3:78082609-78082631 TAGAGAAATAATGACAAAGAGGG - Intergenic
957276817 3:78100652-78100674 TTCAACAAGAAAGACAATGATGG - Intergenic
957633631 3:82752189-82752211 TTGAAAAATAATTAAAAGGTTGG - Intergenic
957843879 3:85705166-85705188 TTAAATAAGAATGAAAAGAAGGG - Intronic
957862257 3:85969228-85969250 TTGGAAAAGTAGGACAATGAGGG - Intronic
957889240 3:86333492-86333514 GTGAAAAAGAAAGAGAGGGAAGG + Intergenic
958101028 3:89011022-89011044 TTGAAAAAGAAGGACAAAGCTGG + Intergenic
958666523 3:97146246-97146268 CTAAGAAAGAATGTCAAGGAAGG - Intronic
958884566 3:99711435-99711457 TTGAAAAAGAAAGGCGAGAATGG - Intronic
958960023 3:100500795-100500817 TTTAAAAAAAATGACCAGCAAGG + Intronic
959411303 3:106025951-106025973 ATGAAAAAGAAAGAGAAGGAAGG + Intergenic
959428792 3:106225628-106225650 TTGAAAAAGAAGCACAAAGTTGG - Intergenic
959499908 3:107094316-107094338 TTGAAAAGGAATGATGAGAAGGG - Intergenic
959746628 3:109782731-109782753 TTGAGAAATAAAGTCAAGGAGGG + Intergenic
959988352 3:112601889-112601911 TATAAAAAAAATTACAAGGAAGG - Intergenic
960010958 3:112834329-112834351 GTCAATAAGAATGACAATGAAGG - Intronic
960034786 3:113091578-113091600 GAGAAAAAGAAAGAGAAGGAGGG + Intergenic
960199876 3:114819395-114819417 TGAAAAAAGAAAGATAAGGAAGG + Intronic
960490315 3:118309630-118309652 TTAAAAAAGAATGAGAACAATGG + Intergenic
960588081 3:119339454-119339476 TTGAAAAAGAAAGATAAAGTGGG + Intronic
960674793 3:120183483-120183505 AGGAAAAAGAAGGAAAAGGATGG - Intronic
960710531 3:120523040-120523062 TTGAAAAATAATAACATGGTTGG + Intergenic
960771358 3:121195988-121196010 TTGAACAAGAATAACAACGCTGG - Intronic
960851885 3:122064168-122064190 TTGACAAAGCAGGACAACGAAGG + Intronic
960939969 3:122927182-122927204 TTAAAAAAGAAAGAGAGGGAGGG - Intronic
961912395 3:130332280-130332302 TTGAAAAAGAAGAACAAAGCTGG + Intergenic
962433319 3:135340949-135340971 TTGAAAAAGAAAAACAAAGTTGG + Intergenic
962453598 3:135544020-135544042 TTGAAGAAGAATAACAAAGATGG - Intergenic
962459579 3:135597125-135597147 TGGAGAAAGAAAGACAAAGAAGG - Intergenic
962607149 3:137042057-137042079 TGGAAAAAGAGTGAGAAGGGAGG - Intergenic
962736977 3:138334097-138334119 TTGAAAAAGAAAAACAAGGTTGG - Intergenic
962822263 3:139061271-139061293 TTTAAAAAGAATGACAAAGTTGG - Intronic
963180004 3:142344949-142344971 CTGAAAAAGAAAAACAAAGAGGG + Intronic
963181701 3:142363733-142363755 TTGAAAAAGAAGGACAAAGTTGG - Intronic
963217192 3:142761608-142761630 TTCAAAAATACTGAAAAGGAGGG - Intronic
963431286 3:145207685-145207707 ATGAAAAAGAAAAAGAAGGAGGG + Intergenic
963809297 3:149758912-149758934 TTGAAAAACAATAACAAAGTTGG + Intergenic
964285216 3:155110156-155110178 TTGAAAAGGACTGGAAAGGAGGG + Intronic
964409702 3:156384887-156384909 GTGAAAAAGCATGGGAAGGAGGG + Intronic
965113550 3:164458259-164458281 TTGAAAAAGAAGAACAAAGCTGG - Intergenic
965138277 3:164802709-164802731 TTGAAAGAGAATGAAAAAGTTGG + Intergenic
965275172 3:166672714-166672736 TTGCAAAGAAATGAAAAGGATGG - Intergenic
965303832 3:167038771-167038793 TTGACAAATAATGCCCAGGATGG - Intergenic
965739962 3:171863934-171863956 TGGAAAAAGAATCACAATGCAGG + Intronic
966098331 3:176234091-176234113 TTGAAAAAGAATAACAATTTTGG + Intergenic
966292414 3:178375384-178375406 ATGAAAAAGAATGACATGAAAGG + Intergenic
966306518 3:178541961-178541983 TTTAAAGAGAATGACAGGGTGGG - Intronic
966654727 3:182342909-182342931 TTGTAAAAGAATGGAAAGAAGGG - Intergenic
966666513 3:182477860-182477882 TAGAAAAAGACTGAGAAGGAGGG - Intergenic
966922349 3:184620924-184620946 TTGAAAAAGGAGTACAATGAGGG + Intronic
967001954 3:185344305-185344327 TTGAAAAGGAGAGACATGGACGG + Intronic
967106730 3:186260517-186260539 TGGAAAAAAAAAGAAAAGGAGGG + Intronic
967167683 3:186797315-186797337 TTGAACAAGATTCACAATGAAGG + Intronic
967316948 3:188158583-188158605 TTAAAAAAGAATGATAGGAAAGG - Intronic
967336688 3:188352048-188352070 TAGAAGAAAAATGACAAGGGGGG - Intronic
968106840 3:196007287-196007309 CTGAAAAAGAAAGAGAAAGAAGG - Intergenic
968560107 4:1275485-1275507 TTGAAAAAGAAGAATAAGGCTGG + Intergenic
968604586 4:1527512-1527534 TTGAAAAAGAATAACAAAATTGG - Intergenic
969178218 4:5416265-5416287 TTCAAGAAACATGACAAGGAAGG - Intronic
969923502 4:10562786-10562808 TTGAAAAATAATGATAATGCAGG - Intronic
969957376 4:10904836-10904858 TTGAAAAAGAAGAACCAGGTAGG + Intergenic
970209410 4:13693109-13693131 TAAAAAAAAAAAGACAAGGAAGG - Intergenic
970715929 4:18922870-18922892 TAGGAAGGGAATGACAAGGAAGG + Intergenic
970879225 4:20908389-20908411 TTCAAAAAGACTGACGAGGCCGG - Intronic
970952594 4:21774630-21774652 GGAAAAAAGAATGAAAAGGAAGG - Intronic
971005342 4:22368135-22368157 TTGAAAAAGAAGAACAAAGTTGG + Intronic
971053827 4:22891046-22891068 TTGAAAAAAAATGAGACGAATGG - Intergenic
971435117 4:26613128-26613150 ATAAAAAAGAAAGATAAGGAAGG - Intronic
971551230 4:27958704-27958726 TTGAAAGAGTTTGAGAAGGATGG - Intergenic
971558403 4:28042292-28042314 TTAAAAAACAATAACAAAGATGG - Intergenic
971625284 4:28911721-28911743 TTTAAAAAGCATGACAAAGGAGG + Intergenic
971733772 4:30419237-30419259 TTGAAAAAGAATAAAGAAGAAGG + Intergenic
971827216 4:31640658-31640680 TTGAAGGAAAATGACAAGTAAGG - Intergenic
971877889 4:32327936-32327958 AGGAAAAAGCATCACAAGGATGG + Intergenic
972199034 4:36690956-36690978 GTGAAAAAAAAGGACAAAGAAGG - Intergenic
972210088 4:36825790-36825812 GTAAAAAAGAAAGACAAAGAAGG + Intergenic
972598549 4:40551571-40551593 TTAAAAAAGAAAGGAAAGGAGGG + Intronic
973977561 4:56278208-56278230 TTGAAAAAGGAGAACAAAGATGG + Intronic
974112011 4:57536747-57536769 TTGAAAAAAAATGAGACGAATGG - Intergenic
974213290 4:58810858-58810880 TTAAAAAAAAATTACAAAGATGG - Intergenic
974239902 4:59233538-59233560 TTGAATAAGAGTGATAAGGGAGG + Intergenic
974447294 4:62001455-62001477 TTGAAGAAAAACAACAAGGAAGG + Intronic
974537977 4:63193675-63193697 TTAAAAAAGAATTGCCAGGAAGG - Intergenic
974655003 4:64807046-64807068 ATGAAAAAGAATCAAAAGAAAGG + Intergenic
974788896 4:66659633-66659655 GTAAAAAAGAAAGACAAGGAGGG - Intergenic
974797583 4:66772858-66772880 TAAAAAAAAAAAGACAAGGAAGG - Intergenic
975320841 4:73009084-73009106 TTGCAAAGGAAAGACAATGAAGG - Intergenic
975424822 4:74213901-74213923 AGAAAAAAGAATGAAAAGGAAGG - Intronic
975471260 4:74771164-74771186 TAGAAAAAGAAAGAAGAGGAGGG + Intronic
975783332 4:77862550-77862572 AAGAAAAAGAATAAGAAGGAAGG + Exonic
976147182 4:82053417-82053439 TTGAAAAAAAATGAAAAGAAAGG + Intergenic
976147407 4:82055599-82055621 TTGAAGAAGTAAGACAAGGAAGG + Intergenic
976783334 4:88786832-88786854 GTGAAAAAGAATGCGAATGAGGG + Intronic
977189747 4:93984875-93984897 AAGAAAAAGAAAGAGAAGGAAGG + Intergenic
977524012 4:98122715-98122737 TCCAAAAAAAATGAAAAGGAGGG - Intronic
977597684 4:98901536-98901558 TTGAAGAAGAATGCCTATGAAGG - Intronic
977953946 4:103005339-103005361 ATGAAAAAAGATGACAAAGAAGG + Intronic
978354551 4:107857901-107857923 TTTAAAAAGAATGGAAAGCACGG - Intronic
978461284 4:108956289-108956311 CTGAAAATCAATGACAAGAATGG + Intronic
978595905 4:110376899-110376921 GTGAAAAAGAAGGAGAAAGAAGG - Intronic
978642596 4:110889246-110889268 TTGGAAATTAAAGACAAGGATGG + Intergenic
979229285 4:118328452-118328474 TAGAGATAGAATCACAAGGAAGG - Intronic
979314456 4:119245082-119245104 ATGAAAAACTATGACAAGCATGG - Intronic
979576318 4:122295549-122295571 TTCCAAAAAAATGAAAAGGAGGG + Intronic
979896434 4:126163827-126163849 TAGAAAAAGTATGAAAAGGTAGG - Intergenic
979979533 4:127237550-127237572 TGGAAAAAGAAAGAAAAGGAGGG + Intergenic
980155515 4:129099640-129099662 TTAATAGAGAATGACCAGGAGGG + Intronic
980333318 4:131437596-131437618 TTGCAAAAAATTGAAAAGGAGGG - Intergenic
980385348 4:132082874-132082896 ATGAAAAAAAATGACAAAAAAGG - Intergenic
980688710 4:136263111-136263133 ATCAAAAAAAAGGACAAGGAGGG + Intergenic
980741690 4:136958061-136958083 CTGAAAAACATTGACAAAGATGG + Intergenic
981036429 4:140174318-140174340 TTGAAAAAGAATGAATTGGGAGG - Intergenic
981141997 4:141279304-141279326 TTGAAAAAGAAAACTAAGGAAGG - Intergenic
981337012 4:143580092-143580114 TTAAAAAAGAATGAAAAAAAGGG + Intronic
981520293 4:145654261-145654283 TTTAAAAATCATGACAAAGACGG + Intronic
982063206 4:151625155-151625177 GGGGAAAAGAATGACAAGGCTGG - Intronic
982063919 4:151634462-151634484 TTGAAAAAGAAGGAAAAAGTTGG + Intronic
982279837 4:153672096-153672118 TCGAAAACAATTGACAAGGAGGG - Intergenic
982400354 4:154959943-154959965 TTGAATCAGGATGACAATGATGG - Intergenic
982542144 4:156687201-156687223 TTGAACAAGAAGGCAAAGGATGG + Intergenic
982733562 4:158981153-158981175 AGAAAAAAGAATGAAAAGGAAGG + Intronic
982905047 4:161057395-161057417 TTGAAGTAGGATGAGAAGGATGG - Intergenic
983041118 4:162928532-162928554 TTGAAAAATAATTACATTGATGG + Intergenic
983138363 4:164115076-164115098 TTACAAAAGACAGACAAGGAAGG + Intronic
983300674 4:165921478-165921500 TTAAGAAAGAAAGAGAAGGAAGG - Intronic
983408539 4:167365576-167365598 TTGAAGAAGAGTGAAAAAGACGG + Intergenic
983607647 4:169608168-169608190 TTGAAAAAGAAGAGCAATGAAGG + Intronic
983665815 4:170181056-170181078 TTGAAGAAGAAAGAAATGGAAGG + Intergenic
984003411 4:174279553-174279575 TTGAAAAAGAACAACAAAGCTGG + Intronic
984471529 4:180181801-180181823 TAGAAAAAGAGTGACAAAGGGGG + Intergenic
984724344 4:183006154-183006176 TTGAAAAAGAAGAACAAAGCTGG + Intergenic
985238045 4:187898440-187898462 TCAAAAAAGAAAGAAAAGGAAGG + Intergenic
985323073 4:188735530-188735552 CTGAAGAAGAAAGAAAAGGAAGG - Intergenic
985334729 4:188879469-188879491 GTGAAAAATTGTGACAAGGAAGG + Intergenic
985356028 4:189120269-189120291 TTCCAAAAGATTGAAAAGGAGGG + Intergenic
985435253 4:189924103-189924125 TTTCAAAAAAATGAAAAGGAGGG + Intergenic
985934582 5:3086655-3086677 TTGAAAAAGAAGAACAAAGATGG + Intergenic
986227663 5:5831373-5831395 TTCCAAAAGATTGAGAAGGAGGG + Intergenic
986463840 5:8001062-8001084 TTGAATAAGAATGGCAAGAGTGG + Intergenic
986852659 5:11831259-11831281 TTGAAAAAGAAAAACAAAGCTGG + Intronic
987225810 5:15840352-15840374 TTGGAAAAGAATGAGGAGGAGGG - Intronic
987228902 5:15871740-15871762 AGAAAAAAGAATGAAAAGGAAGG + Intronic
987240215 5:15989257-15989279 TTGAATAAAAGTGACAAGAATGG + Intergenic
987566489 5:19594649-19594671 TTGAAAAAGAAGAACAAAGCTGG - Intronic
987612745 5:20228151-20228173 TTGATAAGGAATGACAAAAAAGG - Intronic
988130577 5:27098746-27098768 TTGAAATAGAATCACAGGAAAGG - Intronic
988167207 5:27609163-27609185 ATGAAGAAGAATGAAAGGGAAGG + Intergenic
988630237 5:32922024-32922046 TTGAAAAAGAACAACAAGCTTGG - Intergenic
988717363 5:33841269-33841291 TACAAAAAGGATGAAAAGGAAGG - Intronic
988972095 5:36478944-36478966 TTTAGAAAGAAGGAAAAGGAAGG - Intergenic
989130123 5:38099042-38099064 TTGAAAAATACTGACAAGCTTGG - Intergenic
989365889 5:40654648-40654670 TTCCAAAAGATTGAGAAGGAGGG + Intergenic
989975890 5:50586378-50586400 TAAAAAAAGAAATACAAGGAAGG - Intergenic
990014748 5:51046093-51046115 TTGGAAAAGTAAGACAGGGAAGG - Intergenic
990132388 5:52602450-52602472 TTTAAAAACAATGAGAAGAATGG + Intergenic
990180912 5:53159443-53159465 TTGAAAAAGAACAACAAAGCTGG + Intergenic
990239696 5:53804019-53804041 TTGAAAAAAAATTACACGAATGG + Intergenic
990477998 5:56180355-56180377 TTGAAAAAGAATAAAGTGGAAGG - Intronic
990488914 5:56284895-56284917 CTGAAAGAGAATGCCAAGGGAGG - Intergenic
990498371 5:56370989-56371011 TTGAAAAAGAATAACAAAGCTGG + Intergenic
990531173 5:56674919-56674941 TGGATAAAAAAAGACAAGGAAGG + Intergenic
990859729 5:60313540-60313562 TTCAAAAAAACTGACTAGGAGGG + Intronic
991235967 5:64397860-64397882 ATGAAAAAAAATGACAGAGATGG + Intergenic
991266881 5:64730121-64730143 GTCAAAAAGACTGACAAAGAAGG + Intronic
991681037 5:69139666-69139688 CTGAAGTAGAATGACAAGGACGG - Intergenic
992031830 5:72728845-72728867 TTGAAAAAAGATGAGAAGAATGG + Intergenic
992133615 5:73720344-73720366 TTGAAAAAGAAGAAAAAGGAAGG + Intronic
993087792 5:83384967-83384989 TTGAAAAAGAAGAACAAAGTTGG + Intergenic
993766957 5:91871852-91871874 TTGAAAAAGTAAGAGAAAGAAGG - Intergenic
993957952 5:94260188-94260210 TTGCAATAGAATTACAATGAGGG + Intronic
993959476 5:94279551-94279573 TAGAAAAAGAATGGGAAGAAAGG - Intronic
993984371 5:94580136-94580158 TTGAAAAATAAAGACATAGAAGG + Intronic
994134499 5:96269857-96269879 TTTAAAAAAATTGAGAAGGAGGG + Intergenic
994287780 5:97991294-97991316 TTTAAAAAGCTTGAGAAGGAGGG + Intergenic
994347086 5:98699925-98699947 TAGAAAAAGATTGATCAGGAAGG + Intergenic
995070001 5:107909483-107909505 TTGAACAACAATGAGAATGATGG + Intronic
995128024 5:108599536-108599558 GTGACATAGATTGACAAGGATGG + Intergenic
995369928 5:111407827-111407849 TTAAGAAAGAATGACTAGGCTGG + Intronic
995502430 5:112822243-112822265 TTGAAAAAAAATGACAAAATGGG + Intronic
995788348 5:115855852-115855874 TTTTAAAAGAATGATGAGGATGG + Intronic
996195687 5:120604309-120604331 ATGATAAAAAAGGACAAGGAAGG - Intronic
996364563 5:122687295-122687317 TGGAGGAAGAATGACAAGGGAGG - Intergenic
997221740 5:132172935-132172957 TTGAAAAAGAATGAAGTTGAAGG + Intergenic
997620842 5:135292636-135292658 CTGAAAAAGAATAACAAAGTTGG - Intronic
997683657 5:135773804-135773826 TAGAAACAAAATCACAAGGAGGG - Intergenic
997760341 5:136441577-136441599 TTGAAAAAGAAGAACAAAGTTGG - Intergenic
997904361 5:137800482-137800504 TTGAAAAATTATTACAAGAAGGG - Intergenic
998410436 5:141906382-141906404 TTGAAAAAGAAGAACAAAGCTGG + Intergenic
998732424 5:145095122-145095144 TTGAAAAAGAAGAACAAAGTAGG + Intergenic
998814797 5:146002455-146002477 TTAAAAAAGAAAGAAAAGGAAGG + Intronic
999060512 5:148629379-148629401 TTGATCAAGCATGACATGGAAGG + Intronic
999307952 5:150532820-150532842 ATTATAAAGAATGTCAAGGACGG - Intronic
999339723 5:150759525-150759547 TTCAATAAGTATGAAAAGGAGGG + Intergenic
999367512 5:151032815-151032837 TGGAAGAAGAATGATAAGAAGGG + Intronic
999502224 5:152158977-152158999 GGAAAAAAGAATGAAAAGGAAGG - Intergenic
999579424 5:153019414-153019436 TTGAGAAAGAATAACAAAGTTGG + Intergenic
999586095 5:153091131-153091153 GTGAAAATGAAAGACAAAGAAGG - Intergenic
999724562 5:154425495-154425517 TTCAAAAAGAATAACAAAGCTGG + Intergenic
999806745 5:155088470-155088492 TGTAAACAGAAAGACAAGGATGG + Intergenic
1000469832 5:161627572-161627594 TAGAAAAAGAGAGAGAAGGATGG - Intronic
1000788379 5:165574045-165574067 ATGAAAACAAATGAAAAGGAGGG - Intergenic
1001239712 5:170058903-170058925 TTGGAAAAGTATAACAATGATGG + Intronic
1001685144 5:173588720-173588742 TTGAAAAATAAGGACAAGATTGG + Intergenic
1002221406 5:177685612-177685634 TGGCAAAGGAATGAGAAGGAAGG - Intergenic
1002326352 5:178410421-178410443 TTGAAAAAGAAGAACAAAGTTGG + Intronic
1002463830 5:179393515-179393537 TTGAAAAAGAATAACAAAGTTGG + Intergenic
1002902519 6:1421599-1421621 TTGAAAAAGAAGAACAAAGTTGG - Intergenic
1002977544 6:2097641-2097663 TTGTCAAAGTATGACATGGATGG - Intronic
1003151827 6:3559071-3559093 ATAAAAAAGAAAGACAAGAAGGG + Intergenic
1003639587 6:7865412-7865434 TTTGAAGAGAATGAGAAGGAGGG - Intronic
1003681548 6:8262377-8262399 TGGAAAAAGAATCACCAGGGTGG + Intergenic
1003787190 6:9499669-9499691 TTAAATAAGAATGACACAGATGG + Intergenic
1003880128 6:10472765-10472787 TTGAGAAAGAAGGACAAAGCTGG + Intergenic
1004077391 6:12357016-12357038 TTGAAAAAAAATGGTAAGAAGGG + Intergenic
1004195321 6:13499222-13499244 TGGAAAAAGAAGTACAAGGATGG + Intergenic
1004231519 6:13837949-13837971 TTTAAAGAAAATGATAAGGAAGG - Intergenic
1004408767 6:15360799-15360821 TTAAAAAAGAAAGACTAGGTTGG - Intronic
1005010428 6:21330507-21330529 TTTAAAAACAATGACTAGGCCGG - Intergenic
1005122952 6:22411027-22411049 TTCAAAAGGACTGACAATGATGG - Intergenic
1005318670 6:24629888-24629910 TTTAAATAGCATGACAAGGCCGG + Intronic
1005353228 6:24957571-24957593 TTCCTAAAGAATGAGAAGGAGGG + Intronic
1005444674 6:25909855-25909877 CTGAAAAAGATTGACTAGAATGG - Intergenic
1005764769 6:29000182-29000204 TAGAAAAATAATGAAGAGGAAGG - Intronic
1006252985 6:32806357-32806379 AGAAAAAAGAATGAAAAGGAAGG - Intergenic
1006711941 6:36081681-36081703 TTGAAAAAGAAGAACAAAGCTGG - Intronic
1006818778 6:36873944-36873966 TTTACAAAGTAGGACAAGGAAGG - Intronic
1006868318 6:37227365-37227387 GGGAAAAAGAATGGGAAGGAAGG - Intronic
1006901400 6:37504411-37504433 TGCAAAAAGAAAGAAAAGGAAGG + Intergenic
1007004425 6:38347067-38347089 TTTAAAAAGAAAGAACAGGAGGG - Intronic
1007060165 6:38932725-38932747 GAGAAAAAGAATGACAAGGGAGG + Intronic
1007271424 6:40640439-40640461 GGGAGAAAGAATGAGAAGGAGGG - Intergenic
1007441208 6:41861996-41862018 TTTAAAAAGAGTGACATGGCCGG - Intronic
1008142036 6:47843214-47843236 TTGATAAAAGATGACAGGGAAGG - Intergenic
1008173544 6:48237993-48238015 TTCCAAAAGATTGAGAAGGAGGG + Intergenic
1008185412 6:48383901-48383923 TTACAAAAGATTGAGAAGGAAGG - Intergenic
1008386425 6:50896813-50896835 TTGAAAAAGAAAAACAAAGTTGG - Intergenic
1008550934 6:52629968-52629990 TTGAAAAAGAACAACAGGTAGGG + Intergenic
1008757710 6:54817418-54817440 TGGAAGAAGGATGACAAGGCAGG - Intergenic
1008897440 6:56573189-56573211 TTGAAACTGAATGACAAGTTTGG + Intronic
1009170559 6:60394066-60394088 TTGAAAAGATATGACAAGCATGG + Intergenic
1009889115 6:69658660-69658682 TTAAAAAAAAAAGACAAAGAAGG + Intergenic
1009916516 6:70003629-70003651 TTAAAAAAAAAAGACAAAGAAGG - Intronic
1009956279 6:70458269-70458291 TTGAAAGAGAATGAGAAAAAAGG - Intronic
1010349921 6:74861234-74861256 ATGAAATAGAATGATAAAGATGG - Intergenic
1010364366 6:75032093-75032115 TTGAAAAAGGATTAGAAGAATGG + Intergenic
1010576860 6:77542317-77542339 TTCAAAAAGAATAACAAGATTGG + Intergenic
1010587420 6:77670634-77670656 GTGAAAAAGCATGAAAAGGCAGG - Intergenic
1010795967 6:80116747-80116769 TTGAAAAAGAATTACCAGTCTGG + Intronic
1011068452 6:83355866-83355888 TTGATCAAGAATAACAGGGATGG - Intronic
1011085573 6:83536918-83536940 AGGAAAAAGAAAGAAAAGGAAGG - Intergenic
1011204007 6:84872081-84872103 AGGAAAAAGAATGCCAAGGTTGG + Intergenic
1012136395 6:95562362-95562384 TCTAAAAAGAATTAAAAGGAGGG + Intergenic
1012186056 6:96218478-96218500 GTGAAAACAAAAGACAAGGAGGG - Intergenic
1012205707 6:96458067-96458089 CTGAAATGGAGTGACAAGGAAGG - Intergenic
1012455639 6:99401437-99401459 AAGAAAAAGAAAAACAAGGAAGG - Exonic
1012575995 6:100799212-100799234 TGCAAAAACAATGAAAAGGAGGG + Intronic
1012641306 6:101620069-101620091 TGAAAGAAGAATGACAAGGGAGG - Intronic
1013627847 6:111955337-111955359 TTAAAAAGGAATGACCAGTAAGG + Intergenic
1013991770 6:116262130-116262152 TCCAAAAAAAATGAAAAGGAGGG - Intronic
1014229473 6:118887186-118887208 TTGAAAAAAAAGAACAAGGTTGG + Intronic
1014356053 6:120411634-120411656 ATGAAAAAGAAAGAACAGGAAGG + Intergenic
1014714069 6:124843158-124843180 TTGAATAAGAAAGATAAGAAAGG - Intergenic
1014726188 6:124974756-124974778 TTCACAAAGATTGACCAGGATGG - Intronic
1014889093 6:126819980-126820002 TTGAAACAAAATGACAATAACGG + Intergenic
1015249990 6:131117273-131117295 TTGAAAAAGAACCAAATGGATGG + Intergenic
1015637041 6:135287373-135287395 TGGATAGAGAATGACAAAGATGG + Intronic
1016535023 6:145100186-145100208 GTGACAAAGAAAGGCAAGGAGGG + Intergenic
1016691001 6:146937585-146937607 CAGATAAAGAATGATAAGGAAGG - Intergenic
1017305330 6:152911722-152911744 TTCAAAAAAATTGAGAAGGAGGG - Intergenic
1017424376 6:154305537-154305559 TTGAAAAGGAAAGCCCAGGATGG - Intronic
1017506404 6:155072583-155072605 TTGAAAAAGAATAACGAGTTTGG + Intronic
1019053720 6:169204894-169204916 TTGAAAAAGAAGAACAAAGTTGG - Intergenic
1019091846 6:169543046-169543068 TGTAAGAAGAATGAGAAGGAAGG + Intronic
1019288918 7:240345-240367 TTGATAAAGGATGATAATGATGG + Intronic
1019419004 7:941843-941865 TTAGAAAAAAAAGACAAGGACGG + Intronic
1019868808 7:3738487-3738509 TTGCAAAAGAATAACAAGATAGG - Intronic
1019971119 7:4541684-4541706 TTGAAGAAGGAAAACAAGGAAGG - Intergenic
1020108068 7:5431615-5431637 TTGAAAGAAAATGCCAAAGAAGG - Intronic
1020643835 7:10789451-10789473 TTGAAAAGGAATGCCAATTATGG + Intergenic
1020702548 7:11501013-11501035 ATAAAAAAAAAAGACAAGGAAGG + Intronic
1020852141 7:13367582-13367604 CACAAAAAGGATGACAAGGAAGG - Intergenic
1020870483 7:13623173-13623195 TAGAATAATAATAACAAGGAGGG - Intergenic
1021099842 7:16575114-16575136 CAGAAAAAGAAAGAAAAGGAGGG + Intronic
1021371706 7:19857189-19857211 TTCCAAAAAAATGAAAAGGAGGG + Intergenic
1021630617 7:22642372-22642394 TTGAATAGAAATGACAAGAATGG + Intergenic
1021824430 7:24534149-24534171 TTCCAAAAAATTGACAAGGAAGG - Intergenic
1021916669 7:25440628-25440650 TTGCAAAAAATTGAAAAGGATGG - Intergenic
1022604207 7:31792373-31792395 TTGAATAAGCATGAGGAGGATGG + Intronic
1022612006 7:31885179-31885201 TTGAAATAAATTTACAAGGAAGG + Intronic
1022718363 7:32919606-32919628 TTGAAAAAAAAAAAAAAGGATGG + Intergenic
1022949605 7:35323615-35323637 TTGAAAAAGAAGAACAAAGTTGG - Intergenic
1023224423 7:37953848-37953870 CTCAACAAGAATGACAAGAATGG - Intronic
1023263660 7:38382499-38382521 TTGAAAATGAAGGAGATGGAGGG - Intergenic
1023468511 7:40486719-40486741 TTGAAAAAAAAAAAAAAGGAAGG - Intronic
1023556501 7:41428968-41428990 TTTAAATAGAATGACATGAAAGG + Intergenic
1023671812 7:42585465-42585487 TTGAAAAAAAATTACACGAATGG - Intergenic
1023745579 7:43319547-43319569 GTGATAGAGAGTGACAAGGAAGG - Intronic
1023877740 7:44297779-44297801 TTGAAAAAGAAAAACAAAGTTGG + Intronic
1024800159 7:53067880-53067902 TTGAAAAAAAAGGATGAGGATGG + Intergenic
1025195832 7:56932213-56932235 TTGAAAAAGAAAAACAAGGTTGG - Intergenic
1025248628 7:57336886-57336908 TTAAAAAAAAATGAGAAAGATGG - Intergenic
1025297123 7:57783998-57784020 TTTAAAATGAATGAAAAGGAGGG - Intergenic
1025621861 7:63180332-63180354 TTGAAAAGGAATAAAATGGAGGG + Intergenic
1025676117 7:63644722-63644744 TTGAAAAAGAAAAACAAGGTTGG + Intergenic
1025856393 7:65283676-65283698 TTCAAAAAAATTGAAAAGGAGGG + Intergenic
1025869338 7:65416021-65416043 TTGAAAAAGGATTAGATGGATGG + Intergenic
1026221706 7:68404136-68404158 TTGAAAAAGAACAACAAAGCTGG + Intergenic
1026234245 7:68512168-68512190 TTTAAAAAGACTGGCGAGGACGG + Intergenic
1026835707 7:73637807-73637829 TGGAAAAAGAATGTCAGGCAGGG + Intergenic
1027143038 7:75673317-75673339 TTGAAAAAGAAGAACAAGGCCGG - Intronic
1027201476 7:76066576-76066598 TTGAAAAATAAAATCAAGGACGG - Exonic
1027411134 7:77918945-77918967 TTGGAGAAGAAGGACAAGGAAGG + Intronic
1027482586 7:78717215-78717237 TGGAGAAAAAAAGACAAGGAGGG - Intronic
1027655711 7:80928731-80928753 AAAAAAAAGACTGACAAGGAAGG - Intergenic
1028209432 7:88055200-88055222 TTGGAAAAGACTGAGAGGGAAGG + Intronic
1028272933 7:88815909-88815931 TTGAGAAAGAATGACCAAAATGG - Intronic
1028328584 7:89559607-89559629 TGAAAAAAGAAAGAGAAGGAAGG + Intergenic
1028648412 7:93122789-93122811 AGAAAAAAGAATGAAAAGGAAGG + Intergenic
1028826593 7:95280797-95280819 GTGAAAAGGAAAGAAAAGGAAGG + Intronic
1028983317 7:96990846-96990868 TTTAAAAAGAAAGAGAGGGAGGG + Intergenic
1029805354 7:102990355-102990377 CTGAAAAAGCAAGACAAGAAGGG + Intronic
1029978847 7:104859319-104859341 TTCAAAAAGAGTGACTAGGTAGG - Intronic
1030114549 7:106053459-106053481 TTGAAAAGGCAAGACAAGGAGGG - Intergenic
1030181769 7:106716922-106716944 CTGAAAAAGAATGTCCAGAAAGG + Intergenic
1030255339 7:107504532-107504554 TTGCAAAAGATTGAGAAAGAGGG - Intronic
1030275668 7:107719008-107719030 GAGAAAAAGAATGACAATTAGGG + Intergenic
1030616867 7:111746404-111746426 TTGACAAAGAATGCCTAGTAAGG + Exonic
1030673221 7:112360024-112360046 TTGAAAAAGAAGAACAAGGTTGG + Intergenic
1030920014 7:115371777-115371799 TTGAAAAAGTATAACAAAGTTGG + Intergenic
1031182791 7:118438088-118438110 AAGAAAATGAATGAAAAGGAAGG + Intergenic
1031370372 7:120958229-120958251 TTTAAAAAGAAAGGCAGGGAAGG - Intronic
1031568525 7:123329719-123329741 TATAAAAAGACTGGCAAGGAGGG + Intergenic
1031581602 7:123481982-123482004 TTGAAAAAAAGTGACACGAAAGG + Intronic
1031631230 7:124045563-124045585 TAGAAAAAATATGGCAAGGAAGG + Intergenic
1031893976 7:127326869-127326891 TGGAAAAAGAATAACAATAAAGG + Intergenic
1032112600 7:129089350-129089372 TTGAAAGAGAATAACAAAGTTGG - Intergenic
1032136026 7:129279004-129279026 TTGAAAAAGAAATACAAAGCTGG - Intronic
1032321478 7:130889925-130889947 TTTAAAAATAAAGACAAGGTGGG + Intergenic
1032378507 7:131449695-131449717 GGGAAAAAGAATGGGAAGGAGGG - Intronic
1032987036 7:137349002-137349024 AAGAAAAAAAATGAGAAGGAGGG + Intergenic
1033065893 7:138153603-138153625 TTGAAAAAGAATAATAGTGAGGG - Intergenic
1033507070 7:142014355-142014377 TTGAAAAATAATGACACGTTTGG + Intronic
1033572649 7:142647584-142647606 TTGCAAAGGAAAGAAAAGGAGGG - Intergenic
1034332263 7:150293104-150293126 GTGGGAAAGAATGAAAAGGATGG - Intronic
1034455748 7:151168651-151168673 AAGAAAAAGAATGTAAAGGACGG - Intronic
1034510988 7:151534514-151534536 TTGAAAAAGAAGAACAAGGTTGG - Intergenic
1034665773 7:152816773-152816795 GTGGGAAAGAATGAAAAGGATGG + Intronic
1034746080 7:153524959-153524981 GTGAAGAAGAATCACAAAGATGG + Intergenic
1035099770 7:156386953-156386975 TTGAAGAAGAAACACAAGGCAGG + Intergenic
1035303947 7:157917755-157917777 TTCAATAAAAGTGACAAGGAAGG + Intronic
1035631951 8:1114233-1114255 TTAAAAAAAACTGAAAAGGAGGG - Intergenic
1035882124 8:3254764-3254786 TTGAAAAAAAATTACATGAATGG - Intronic
1036144555 8:6242754-6242776 TTGAAAAAGAATGTTAAGGTGGG + Intergenic
1036783481 8:11668251-11668273 TTGGAAAAGAAGGACAAAGTGGG + Intergenic
1036977502 8:13430497-13430519 TTTCAAAAGAATGAAAATGAGGG - Intronic
1037214196 8:16428610-16428632 TTTTAAAAGAATGACAATTATGG - Intronic
1037258952 8:16985739-16985761 TTCAAAAAGAAAGAAATGGAAGG + Intergenic
1037297683 8:17418408-17418430 GTGAAAAAGGAAGAGAAGGATGG - Intergenic
1037406496 8:18547984-18548006 AGGAAAAAGAATGAAAAGGAAGG - Intronic
1037763861 8:21759591-21759613 TTAAAAAAGAATGACCAGCTGGG + Intronic
1037978922 8:23236495-23236517 TTGAAAAAGAAGAACAAAGCTGG + Intergenic
1038197710 8:25383175-25383197 TATAATAATAATGACAAGGATGG + Intronic
1038221003 8:25607789-25607811 TTGATAAAAAAAAACAAGGATGG + Intergenic
1038238914 8:25789575-25789597 TTGAAAAAGAAGAACAAAGTTGG - Intergenic
1038514331 8:28172089-28172111 TTGAAAAAGAAGCACAAAGTTGG - Intronic
1038570052 8:28653826-28653848 TTGAAAAAGAAAAACAAAGTTGG - Intronic
1038751155 8:30297292-30297314 TTTAAAAATTATGACAAGGCTGG - Intergenic
1039063153 8:33588264-33588286 TTGGAAAAGAATGCCAATGTTGG + Intergenic
1039244625 8:35595569-35595591 TTGAACAAGACCCACAAGGAAGG + Exonic
1039319477 8:36413011-36413033 TTGAAAAAAAATTAGAAGAATGG - Intergenic
1039358766 8:36851021-36851043 TTGAAAAAGAATAACAAAGTTGG - Intronic
1039438002 8:37573907-37573929 TTGAATAAGAATAACTAGCATGG + Intergenic
1039536581 8:38320886-38320908 TTGAAGCAGAATCACAGGGATGG + Intronic
1039747674 8:40444425-40444447 TTGAACAACAATGAGAAAGAAGG - Intergenic
1040822465 8:51578668-51578690 TTGAAAAAAAATAAAATGGAAGG + Intronic
1040909047 8:52499785-52499807 ATAAAAAAGACTGACAAGGACGG - Intergenic
1040967389 8:53097857-53097879 TTGAAAAAGAAGAACAAAGCTGG + Intergenic
1041020830 8:53636626-53636648 TTAAAAAAGAGTGAAAAGAAGGG - Intergenic
1041057627 8:54003417-54003439 TTGAAAAAGAAGAACAAAGTTGG + Intronic
1041231658 8:55758366-55758388 TTGTAAAAGAATGACAACTGAGG - Intronic
1041396785 8:57399835-57399857 TGGAAAAGGAAAGACAGGGAAGG - Intergenic
1041532767 8:58890517-58890539 TTGAGAAATAATGACAATAAAGG + Intronic
1041607954 8:59806784-59806806 TTGAATAAGGGTGATAAGGATGG - Intergenic
1041768283 8:61443679-61443701 TTGAAAAAGAATAAAGTGGAAGG - Intronic
1041827515 8:62113077-62113099 TTGAAAAAGAAGAACAAAGTTGG - Intergenic
1041868586 8:62606449-62606471 TTCAAAAAGTATTTCAAGGAAGG + Intronic
1042071107 8:64935050-64935072 TTGAAAAAGAATAAAATGGGAGG - Intergenic
1042209222 8:66362001-66362023 TTCAAAAAGAGTCACAAGGAAGG + Intergenic
1042231818 8:66564210-66564232 TTGAAAAGGAATTTAAAGGAAGG - Exonic
1042781234 8:72493501-72493523 TTGAAAAATGGTGAGAAGGATGG - Intergenic
1043080897 8:75763708-75763730 AGAAAAAAGAATGAAAAGGAAGG + Intergenic
1043570120 8:81593612-81593634 CAGAAAAAGCTTGACAAGGAGGG - Intergenic
1043741814 8:83823931-83823953 TTGTCAATGAATGAAAAGGAAGG - Intergenic
1043764238 8:84109399-84109421 ATGAAAAAGAAAAATAAGGAAGG - Intergenic
1043840502 8:85097968-85097990 TTGAAAAAGAAGAACAAAGCTGG + Intergenic
1044196389 8:89381430-89381452 TTTTAAAAAAATGAGAAGGAAGG - Intergenic
1044789053 8:95827416-95827438 TTGAAAAAGAAGGAAAAAGTTGG - Intergenic
1044867374 8:96585517-96585539 TTGAAGAGAAATGAGAAGGATGG + Intronic
1044943889 8:97372366-97372388 TTGAAAAGGAATAACAAGGCTGG + Intergenic
1045145975 8:99345305-99345327 TTGAAAAAGAAGGTTAAGGTGGG - Intronic
1045316665 8:101049308-101049330 AAGAAAAAGAAAGAGAAGGAAGG - Intergenic
1045524953 8:102933598-102933620 TTGGAGAAGAATCACCAGGATGG - Intronic
1046124649 8:109889828-109889850 TTGAAAAAGAAAGACAATTTTGG - Intergenic
1046426932 8:114065963-114065985 TTAAAAAATAATAAAAAGGATGG - Intergenic
1046495203 8:115005114-115005136 TTGAAAAAGAAGAACAAAGGTGG - Intergenic
1046526914 8:115392480-115392502 TTGACAAACAATGACAGGGGTGG + Intergenic
1046733742 8:117753622-117753644 TTAAAATAAAGTGACAAGGAAGG + Intergenic
1046785070 8:118257178-118257200 CAGAGCAAGAATGACAAGGAGGG - Intronic
1047159367 8:122360121-122360143 ATGATAAAAAATGACAAAGAAGG - Intergenic
1047264973 8:123298160-123298182 TTGAAAAAGAAGAACACAGAGGG + Intergenic
1047536628 8:125726149-125726171 TTGAATAAACATGAAAAGGAAGG - Intergenic
1047637577 8:126781336-126781358 ATGAATATGAAGGACAAGGAGGG + Intergenic
1047986035 8:130234679-130234701 TTGGAAAAGAGTCACATGGAGGG + Intronic
1048559895 8:135523103-135523125 CTGAAAAAGAAGGACAAAGGTGG - Intronic
1048617037 8:136087007-136087029 TTGAAAAAGAAGAACAAAGCTGG - Intergenic
1048785983 8:138050893-138050915 TTGAAATAGAAAAACAAAGAGGG + Intergenic
1048890102 8:138939251-138939273 ATGAGACAGAATGATAAGGAAGG + Intergenic
1049270031 8:141690639-141690661 TGAAAAATAAATGACAAGGAAGG + Intergenic
1049358149 8:142198847-142198869 TTGGAAAGGCCTGACAAGGAAGG + Intergenic
1049456658 8:142695330-142695352 TTGAAAAAGAAAAACAACGGTGG + Intergenic
1049565703 8:143337554-143337576 TTGAAAAAGAATAACAAAGTTGG + Intronic
1049896654 9:116000-116022 TTCTAAAAGAATGAATAGGAGGG - Intergenic
1050426872 9:5520140-5520162 TTGAAAAAGACTAACAAAGTTGG + Intronic
1050496954 9:6252970-6252992 TTGAAAAAAGATGAAAAGAAAGG + Exonic
1050689510 9:8209466-8209488 TTGAAAATGAATGAGAAATATGG - Intergenic
1050689794 9:8213569-8213591 TTGAAAAAGAAGAACAAAGTAGG + Intergenic
1050716308 9:8530423-8530445 TTGGAAAAGATTTACAAAGAAGG - Intronic
1050739292 9:8801899-8801921 TTAAAAAAGAAAGAAAGGGAAGG + Intronic
1050845389 9:10210499-10210521 ATGGGAAAGAATGCCAAGGAGGG + Intronic
1050846167 9:10222811-10222833 TTCAGAAAGAAAGAAAAGGAAGG + Intronic
1050914958 9:11120284-11120306 TTGAAGAACAAGGACAAAGATGG - Intergenic
1051061951 9:13055118-13055140 TAAAAAATGAATAACAAGGAAGG - Intergenic
1051301196 9:15652788-15652810 TTGAAAAAGAAGAATAAAGATGG - Intronic
1051317287 9:15854137-15854159 TTGAAAAAAAATGAAGAGAAGGG - Intronic
1051826269 9:21223722-21223744 ATAAAAAAGAATGACCAGAAGGG + Intronic
1052096435 9:24390169-24390191 GGAAAAAAGAATGAAAAGGAAGG - Intergenic
1052108400 9:24548101-24548123 TGTAAAAGGAATAACAAGGAAGG + Intergenic
1052138726 9:24949765-24949787 TTGATATAGAATTTCAAGGAGGG - Intergenic
1052321021 9:27167654-27167676 TTGAAGAATAAAGACAAGGATGG - Intronic
1052460708 9:28759327-28759349 TTGAAAATGAAGGACAAAGAGGG + Intergenic
1052515084 9:29470502-29470524 TAAAAAAAAAATGACAAAGAAGG - Intergenic
1052519489 9:29526901-29526923 TTGAAAAAGAAAAACAAAGTGGG - Intergenic
1052659994 9:31416493-31416515 ATGAAAGAGAATGAAAGGGAAGG - Intergenic
1052809960 9:33049170-33049192 TTGAAAGAGAAGGACAAAGTTGG + Intronic
1052840068 9:33285504-33285526 TGGAAAAAGAATAACAGGGCTGG - Intergenic
1053031142 9:34779562-34779584 TTGAAAAAGAAGAACAAAGTTGG + Intergenic
1053493580 9:38531237-38531259 TTGAAAAAGAATTACCAAGTTGG + Intergenic
1053724262 9:40981567-40981589 TTTCAAAAAAATGAAAAGGAGGG + Intergenic
1054341707 9:63870434-63870456 TTTCAAAAAAATGAAAAGGAGGG - Intergenic
1054747525 9:68869679-68869701 TAGAAAAAGATTGCCAAGGCTGG + Intronic
1054845597 9:69793695-69793717 TTGAGAAAGAAACAGAAGGAAGG - Intergenic
1055220518 9:73925325-73925347 TTAAAATAGAAGGAAAAGGATGG - Intergenic
1055220695 9:73927232-73927254 TTAAAATAGAAGGAAAAGGATGG + Intergenic
1055437648 9:76308661-76308683 TACAAGAAGAATGACAAGGCTGG - Exonic
1055545077 9:77362555-77362577 TTGAAAAAGAAGGACAAAGTAGG - Intronic
1055555938 9:77473714-77473736 TTGAAAAAGAAGGACAAAGTTGG + Intronic
1055841959 9:80515967-80515989 TTCCAAAAAATTGACAAGGAGGG - Intergenic
1056088058 9:83174585-83174607 TTCAAAAAGAATAACAAAGTTGG - Intergenic
1056159712 9:83876614-83876636 TTGAAAAAGAAGAGCAAGGTGGG + Intronic
1056171729 9:83991923-83991945 TTGAAAAAGAAAAACAAAGTTGG - Intronic
1056318153 9:85411035-85411057 TTGAAAAAGAACAACAAAGTTGG + Intergenic
1056350864 9:85747314-85747336 TTGAAAAAGAAGAGCAAGGTGGG - Intergenic
1056577059 9:87863526-87863548 TTGAAAAAGAAGGTCATGGAAGG - Intergenic
1056844340 9:90024534-90024556 GTGAAAAAGAAAGACAAGAAAGG - Intergenic
1057100628 9:92355479-92355501 TGCAAAAATAATGACATGGAAGG + Intronic
1057232291 9:93330466-93330488 TTGAGAAATAAGGACAAAGAAGG + Intronic
1057589105 9:96356472-96356494 TTGAAAAAGAAGAACAAAGTTGG + Intronic
1057609703 9:96529826-96529848 TTGAGAAAGAATAAAAAGGTTGG - Intronic
1057674318 9:97126058-97126080 TTGAAAAAGAATTACCAAGTTGG + Intergenic
1057737152 9:97673778-97673800 TTGAAAATGAAAGATGAGGAAGG + Intergenic
1057747003 9:97760397-97760419 TTGAGAAAGAAGGGTAAGGATGG - Intergenic
1057969391 9:99539422-99539444 TTGAAAAAGAAGCACAAAGTTGG + Intergenic
1057977420 9:99620881-99620903 GCAAAAAAGAATAACAAGGAAGG + Intergenic
1058477490 9:105352923-105352945 GAGAAAAAGAATGACAAATAAGG + Intronic
1058663675 9:107289184-107289206 TTGAAAAAGGAAGGGAAGGAAGG - Intronic
1058796032 9:108499015-108499037 TTGAAAAAAAATTACACGAATGG + Intergenic
1059222513 9:112638202-112638224 TTGAAAAAGAAAAATAAAGAAGG + Intronic
1059594479 9:115703603-115703625 TTGAAAAAGAAGAACAAAGTTGG + Intergenic
1059983696 9:119800738-119800760 TTGAAAAGTAATTACAAGCAGGG - Intergenic
1060494604 9:124109055-124109077 TTGCAACAGCATCACAAGGATGG + Intergenic
1060674537 9:125500898-125500920 ATGAAAAAAAATGACAGGGGCGG + Intronic
1060701970 9:125762163-125762185 AAGAAAAAAAATGACAAGAAGGG - Intronic
1061554027 9:131355430-131355452 TTGAAAAAGAATAATAAAGGTGG - Intergenic
1061691386 9:132334792-132334814 TTGCAAAAGAATAACAAGGCAGG + Intronic
1203450538 Un_GL000219v1:110452-110474 TTTCAAAAAAATGAAAAGGAGGG - Intergenic
1185602070 X:1347064-1347086 TTGAAAAAGAAGGTGAATGAAGG + Intronic
1186109057 X:6236751-6236773 GTGGAAAAGCATGACCAGGAAGG - Intergenic
1186774703 X:12853476-12853498 GAGAAAAAGAATGAAAAGGAAGG - Intergenic
1186911049 X:14166095-14166117 TTGAAAAAGAAGAGCAAAGAGGG - Intergenic
1186952132 X:14638181-14638203 TTGGAGAAGTATGAAAAGGAAGG + Intronic
1187186247 X:16989001-16989023 TTGAAAAAGAATAATAAAGCAGG + Intronic
1187228802 X:17400938-17400960 TTGAAAAAGAAGGACAAAGTGGG + Intronic
1187270387 X:17775344-17775366 GTGAAAGGGGATGACAAGGAAGG - Intergenic
1187320121 X:18230364-18230386 GTGAAAGGGGATGACAAGGAAGG + Intergenic
1187351465 X:18521981-18522003 TTGAAAAAGAATAACAAAGTTGG - Intronic
1187438744 X:19297520-19297542 TTGAAAAAGAAGAACAAAGTTGG - Intergenic
1187575957 X:20555547-20555569 TTGGAAAAGAAGAACAAAGAGGG + Intergenic
1187733998 X:22285885-22285907 TAGAAATAGAATAACAAGGAAGG - Intergenic
1188106247 X:26150896-26150918 TTTTAAAAGAATGACACAGAAGG - Intergenic
1188222080 X:27553505-27553527 TTTAAAAAAAAAGACAAAGAAGG - Intergenic
1188796837 X:34477546-34477568 TTGAATAAGAATGATGAGAAAGG + Intergenic
1189030920 X:37449210-37449232 TTGAAAGAGAATGACATTAAAGG - Intronic
1189567021 X:42253251-42253273 TTGAAAAAGAAGAACAAAGTTGG + Intergenic
1189749922 X:44210384-44210406 TTGAAAAAGAAGAACAAAGTTGG + Intronic
1189834007 X:45002868-45002890 TTGGAGAAGAATGAAAAGGGGGG - Intronic
1189866806 X:45338888-45338910 TTCCAAAAGACTGAGAAGGAGGG + Intergenic
1189890906 X:45601225-45601247 TTCAAAAAGAAGGACCAGCAAGG + Intergenic
1190151295 X:47952006-47952028 TTGAGAAAGAAAGACAAAGCTGG + Intronic
1190176064 X:48150721-48150743 TTGAAAAAGAAGAATAAGGTGGG + Intergenic
1190182074 X:48201233-48201255 TTGAAAAAGAAGAATAAGGTGGG - Intronic
1190201220 X:48363025-48363047 TTGAAAAAGAAGAATAAGGTGGG - Intergenic
1190202483 X:48375152-48375174 TTGAAAAAGAAGAATAAGGTGGG - Intergenic
1190202656 X:48376858-48376880 TTGAAAAAGAAGAATAAGGTAGG + Intergenic
1190207882 X:48418552-48418574 TTGAAAAAGAAGAATAAGGTAGG - Intergenic
1190208055 X:48420258-48420280 TTGAAAAAGAAGAATAAGGTGGG + Intergenic
1190210686 X:48444302-48444324 TTGAAAAAGAAGAATAAGGTGGG + Intergenic
1190576545 X:51845314-51845336 ATGAAAAAGAATGACTCTGAAGG + Intronic
1190580333 X:51887393-51887415 TTGAAAAAGAAAGATAAAGTGGG + Intronic
1190605436 X:52137849-52137871 TTGAAAAAGATTAACAAAGTTGG + Intergenic
1190661655 X:52660168-52660190 TTGAAAAAGAAGAATAAGGTGGG - Intronic
1190669300 X:52725742-52725764 TTGAAAAAGAAGAATAAGGTGGG - Intergenic
1190670117 X:52732662-52732684 TTGAAAAAGAAGAATAAGGTGGG + Intergenic
1190811189 X:53885761-53885783 TTCCAAAAAAATGAAAAGGAGGG - Intergenic
1191048143 X:56161661-56161683 TTGAAAAAAAATTACACGAATGG - Intergenic
1191120192 X:56895153-56895175 TTGAAAAACAATTAGAAGAATGG + Intergenic
1191610797 X:63110526-63110548 TTAAAAAAAAAAGACAAAGAAGG + Intergenic
1191731402 X:64339666-64339688 TTGAAAATGTAAGACAAAGAGGG + Intronic
1191787438 X:64932107-64932129 TTAAAAAAAAAAGACAAGCAAGG - Intronic
1191919229 X:66236648-66236670 TTGCAAAAAAATGAGAAGGAGGG - Intronic
1192083916 X:68075539-68075561 TTGAAAAAGAAAAACAAAGTTGG + Intronic
1192242509 X:69344798-69344820 TTGAAAAAGAAGAAAAAAGATGG - Intergenic
1192379161 X:70597327-70597349 TTTAAAAAGAAGAACAATGAGGG + Intronic
1192387579 X:70687873-70687895 AAGAAAAAGAAAGAAAAGGAAGG + Intronic
1192586508 X:72322860-72322882 TCGAAAAAGAAGGACAAAGTTGG - Intergenic
1192594774 X:72394945-72394967 TTGACAAAGATTGCCAAGGGTGG - Intronic
1193353190 X:80485334-80485356 TTTGAAAAGAATGAGAAGGTAGG - Intergenic
1193451424 X:81674309-81674331 TTGAAAAAGAAGAACAAAGTTGG - Intergenic
1193457100 X:81744373-81744395 TTGAAAAAAAATTACATGAACGG + Intergenic
1193582625 X:83284730-83284752 TTGAAAAAAAATTAGAAGAATGG - Intergenic
1193587212 X:83340067-83340089 TTGAAAAAAAATTACAGAGACGG + Intergenic
1193945682 X:87730491-87730513 TTGAAAGAGGGTGAAAAGGATGG - Intergenic
1194043179 X:88969328-88969350 AAGAAAAAAAAAGACAAGGAAGG + Intergenic
1194058059 X:89162680-89162702 AGAAAAAAGAATGAAAAGGAAGG - Intergenic
1194305575 X:92243541-92243563 CTGAAAAAGAATAAAATGGAAGG - Intronic
1194368508 X:93039314-93039336 TTCCAAAAAATTGACAAGGAGGG - Intergenic
1194370165 X:93061416-93061438 TTGAAAAAGAATTAGACGAATGG + Intergenic
1194564361 X:95465607-95465629 TTGAAAAAGTTTTAGAAGGATGG - Intergenic
1195056823 X:101154184-101154206 TTGAAAAAGAAGAACAAGTTGGG - Intronic
1195155395 X:102117817-102117839 ATGATAAAGAAAGACAAAGAAGG + Intergenic
1195214991 X:102690774-102690796 TTGAAAAAAAATTAGAAGAATGG - Intergenic
1195443715 X:104926416-104926438 TTCAAAAGCAATGACAAGAAAGG - Intronic
1195685660 X:107582805-107582827 TTGAAAAAGAAGTACAAAGTAGG - Intronic
1195723460 X:107890011-107890033 TTGAAAAAAAATTACATGAATGG - Intronic
1195726298 X:107920542-107920564 TTGCATGAGAATGAAAAGGAAGG - Intronic
1195943628 X:110186461-110186483 TTGAAAAAGAAAAACAAAGTAGG + Intergenic
1195972243 X:110485868-110485890 TTGAAAAAGAAGAACAAAGTTGG - Intergenic
1196239295 X:113322757-113322779 TTGAAAAAGAATAACAAAGCTGG + Intergenic
1196295649 X:113993898-113993920 ATGGAAAAGAACGAAAAGGAGGG - Intergenic
1196313282 X:114194248-114194270 TTGAAGAAGAATAACAAAGTTGG + Intergenic
1196434394 X:115661749-115661771 TTATAAAAGAAAGAGAAGGACGG + Intergenic
1196628957 X:117913547-117913569 TTTAAAAAGAACAACAAGGCCGG + Intronic
1197031763 X:121824656-121824678 TCTCAAAAGAATGAGAAGGAGGG + Intergenic
1197086675 X:122484916-122484938 TTGAAAAAGAATGAAGTTGAAGG + Intergenic
1197142005 X:123127899-123127921 TTAAAAAAAAAAGACAAAGAAGG + Intergenic
1197436559 X:126435648-126435670 TTGACAAAGAATGAGAATGTTGG + Intergenic
1197478115 X:126948035-126948057 TTGAAAAAAGATGAGAAGAATGG + Intergenic
1197496420 X:127187859-127187881 TTGAAAAAGAAGAACAAAGTTGG - Intergenic
1197532438 X:127646089-127646111 TTGACAAAAAATAAAAAGGAAGG + Intergenic
1198116501 X:133549785-133549807 GAGAAAAAGAAGGACAGGGAGGG - Intronic
1198116513 X:133549829-133549851 GAGAAAAAGAAGGACAGGGAGGG - Intronic
1198513831 X:137383856-137383878 TTGAAAAAGAAGAACAAAGTTGG + Intergenic
1198514022 X:137386143-137386165 TACAAGAAGAATGACAAGGAGGG + Intergenic
1198518754 X:137431834-137431856 GAGAAAAAGAGTGAGAAGGAAGG + Intergenic
1198532533 X:137560343-137560365 TAGAAAAAGAAGGACAAAAAAGG - Intergenic
1199113997 X:143968547-143968569 TTGAAGAAGAGAGAAAAGGAAGG + Intergenic
1199453686 X:148002763-148002785 GTGAGAAAGAAGGATAAGGAAGG + Intronic
1199891660 X:152089204-152089226 TTGTAGAAGAATTATAAGGAAGG - Intergenic
1200676711 Y:6155591-6155613 TTCCAAAAAATTGACAAGGAGGG - Intergenic
1201223793 Y:11796772-11796794 TTGAATAGGAATGGCAAGAATGG + Intergenic
1201245743 Y:12002340-12002362 TTGAAAAAAAATTACATGAATGG - Intergenic
1201384984 Y:13430246-13430268 TTGCAAAAAAATGAGGAGGAGGG - Intronic
1201590784 Y:15612118-15612140 TTGAAAAAAAATTACATGAATGG + Intergenic
1201679001 Y:16621578-16621600 TTGAAAAATGATGATAAGAAAGG + Intergenic
1202346394 Y:23932538-23932560 TTAATTAAGAAGGACAAGGATGG - Intergenic
1202524377 Y:25737552-25737574 TTAATTAAGAAGGACAAGGATGG + Intergenic