ID: 1135837560

View in Genome Browser
Species Human (GRCh38)
Location 16:25840869-25840891
Sequence ACTTGACCACAGATGGCCCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 143
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 133}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1135837560_1135837563 15 Left 1135837560 16:25840869-25840891 CCATGGGCCATCTGTGGTCAAGT 0: 1
1: 0
2: 0
3: 9
4: 133
Right 1135837563 16:25840907-25840929 AGACAGAAGACTCTCATAGTTGG 0: 1
1: 0
2: 0
3: 9
4: 194

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1135837560 Original CRISPR ACTTGACCACAGATGGCCCA TGG (reversed) Intronic
903002728 1:20277794-20277816 TCCTGGCCAAAGATGGCCCATGG - Intergenic
903226970 1:21899331-21899353 ACTTGACCATAGAAGGACCTTGG + Intronic
912134891 1:106648923-106648945 AGTTGATCACAAATGGCCAATGG + Intergenic
918294008 1:183138343-183138365 ACTTGTCAATGGATGGCCCAAGG + Intronic
920690133 1:208140014-208140036 ACTTGACCAGAGGCAGCCCATGG + Intronic
923556448 1:235004450-235004472 CCTTGTCCTCACATGGCCCAAGG - Intergenic
923781982 1:237032920-237032942 ACTTGATCTGAGATGGGCCAAGG - Intergenic
924154747 1:241164318-241164340 AGTTGACCACCAATGGCCAAAGG - Intronic
1068933459 10:62614319-62614341 ACTTGACTACCCATGGCCTAGGG + Intronic
1073524151 10:104163668-104163690 ACTGGACCCCAGCTGGGCCAAGG + Intronic
1074744969 10:116523420-116523442 GGTTGCCTACAGATGGCCCAGGG - Intergenic
1075153720 10:119956957-119956979 CCTTTACCAGTGATGGCCCAGGG + Intergenic
1076121648 10:127941157-127941179 CCTTGACCTCAGATGCCACAGGG - Intronic
1076881003 10:133239231-133239253 ACTTGACCACAGTGGGCCTGGGG + Intronic
1078126053 11:8564632-8564654 AGTTAACCACAGATGGACCCTGG + Intronic
1078851944 11:15171968-15171990 ACATGGCCACAGATGGCCAGGGG + Intronic
1080663914 11:34319136-34319158 ACTCTACAACAGATGACCCAGGG + Intronic
1081012089 11:37826441-37826463 ACTTGACCACAGTTGACACTTGG + Intergenic
1081800063 11:45852360-45852382 AAGGGACCACAGAAGGCCCAAGG + Intronic
1081806247 11:45892368-45892390 AATTAACCACAGGTGTCCCAGGG - Intronic
1084560036 11:69899495-69899517 ACGTGGCCACAGATGGCCTGGGG - Intergenic
1088145366 11:106670390-106670412 ACTAGACCACAGATCCCACAAGG - Intergenic
1091584503 12:1808461-1808483 ATTTGCTCACAGATCGCCCATGG + Intronic
1093553791 12:20447110-20447132 ACTGGAACACAGATGGGCAAAGG + Intronic
1095242343 12:39876091-39876113 AGATGACCAAAGTTGGCCCAGGG - Intronic
1099670673 12:85687904-85687926 ACTTGACTTCAGATGGCCTATGG - Intergenic
1101061633 12:100978526-100978548 AGCTGCCCACAGATGGGCCAGGG - Intronic
1103318874 12:120078846-120078868 ACTGGCCCACAGCTGGTCCAAGG + Intronic
1104603719 12:130171671-130171693 ACTTTTCCACACATGGCACAGGG + Intergenic
1106186623 13:27415480-27415502 ACATGACCCCAGATGTCCCAAGG + Intergenic
1106592631 13:31110625-31110647 ATTTGACCTCAGAGGGCCTAGGG - Intergenic
1106845885 13:33737395-33737417 TGTTGTGCACAGATGGCCCAAGG + Intergenic
1108959629 13:56208564-56208586 AATTGACCACAGATGACACTGGG + Intergenic
1110131306 13:72015015-72015037 ACTAAACCCAAGATGGCCCAGGG + Intergenic
1111605656 13:90535509-90535531 ACTTTACAACAGATAGTCCATGG + Intergenic
1113198200 13:107834288-107834310 AATTGACCACAGTTGTCCCTTGG - Intronic
1113657529 13:112077833-112077855 ACTTAACCAAAGAAGGGCCAAGG + Intergenic
1115704459 14:35984610-35984632 ACTTGACCACTGTAGGACCAAGG + Intergenic
1116164949 14:41323426-41323448 AGTTGATCACCGATGGCCAATGG + Intergenic
1118496407 14:66312074-66312096 ACTATAGAACAGATGGCCCAAGG + Intergenic
1120861004 14:89254873-89254895 AGTGGACAACAGAAGGCCCATGG - Intronic
1122454480 14:101839388-101839410 ACGTGACCACAGGTGGCACAGGG + Intronic
1122510942 14:102267059-102267081 ACTTCACCACGGTAGGCCCATGG + Intronic
1128248389 15:66148530-66148552 ATTTGACCACAGAGGGACCTGGG - Intronic
1128555117 15:68626503-68626525 ACTTGTCCTCAAAGGGCCCAGGG - Intronic
1129073855 15:72974870-72974892 AAGTGAACACAGAGGGCCCAGGG - Intergenic
1129908398 15:79206176-79206198 GCTTGACCACAGAGGGCAGAGGG + Intergenic
1132142353 15:99406227-99406249 ACTTAACCACAGCTCGCCCAGGG - Intergenic
1133600575 16:7336353-7336375 ACTTGGCCATGTATGGCCCAAGG - Intronic
1133616092 16:7478338-7478360 ACTTTACTCCAGGTGGCCCAAGG + Intronic
1134104395 16:11475642-11475664 ACTGGACCTCAGAAGGGCCAGGG + Exonic
1135837560 16:25840869-25840891 ACTTGACCACAGATGGCCCATGG - Intronic
1137629779 16:49934886-49934908 AGTCGACCACAGAGGCCCCAGGG + Intergenic
1137749025 16:50844976-50844998 AGCTGACCACAGATGCCTCATGG + Intergenic
1143215217 17:5219740-5219762 AATTGATCAAACATGGCCCAGGG - Intronic
1143913458 17:10271482-10271504 ACATGACCACATCTAGCCCAAGG - Intergenic
1146180118 17:30692787-30692809 ACTTAACCACTGATAGCCTATGG - Intergenic
1148108076 17:45130017-45130039 CCTTGGCCTCTGATGGCCCAAGG + Intronic
1148159753 17:45443266-45443288 TCTGGGCCACAGATGGCCCTGGG - Intronic
1149544906 17:57496291-57496313 ACATAGCCACAGATGGCCAAAGG - Intronic
1150391039 17:64790138-64790160 TCTGGGCCACAGATGGCCCTGGG - Intergenic
1156439123 18:37166348-37166370 CCTGGGCCACATATGGCCCACGG - Intronic
1159832517 18:73294459-73294481 ACGTGGCCACAAATGGGCCAGGG + Intergenic
1161291100 19:3493882-3493904 ACTTGGCCAAGGATGCCCCAGGG - Intronic
1162978478 19:14222767-14222789 ACTTAACCACTGATAGCCTATGG + Intergenic
1166121552 19:40690249-40690271 CCTTGGCAAGAGATGGCCCAGGG + Intronic
1167368956 19:49069626-49069648 ACTTGACCCAACATGGCCCTAGG + Exonic
1168400101 19:56080708-56080730 TCATGACCACAGATGGGACATGG + Intergenic
925745084 2:7037085-7037107 ACTTGATCACAGAAGGCAGAGGG - Intronic
925990527 2:9250829-9250851 CTTTGCTCACAGATGGCCCATGG - Intronic
931894756 2:66716456-66716478 CACTCACCACAGATGGCCCAGGG - Intergenic
932739337 2:74279848-74279870 ACTTGATAACAGATGGCACGTGG - Intronic
932814471 2:74850902-74850924 ACTTGAGAACAGATGGCACCAGG - Intronic
933611376 2:84439490-84439512 ACTGGAACTCAGATGGCCTATGG + Intronic
936541598 2:113356119-113356141 GTTTAAACACAGATGGCCCAAGG - Intergenic
938500054 2:131827648-131827670 ACTTGCGCACTGTTGGCCCATGG + Intergenic
939861870 2:147430400-147430422 AGTTGACCTCAGGTGACCCAAGG + Intergenic
942636607 2:178013984-178014006 ACTCCACCACACATGGCCTAAGG - Intronic
946305357 2:218853944-218853966 AATTAACCTGAGATGGCCCAGGG - Intergenic
946424915 2:219589192-219589214 CCTGGGCCACATATGGCCCATGG - Intergenic
948412475 2:237774814-237774836 TCTTGGCCACAGCAGGCCCATGG - Intronic
948802316 2:240438476-240438498 ACTAGGCCACAGAGGGTCCAGGG - Intronic
948971379 2:241430168-241430190 ACTTTCCCACATTTGGCCCAAGG + Intronic
1172027284 20:31957075-31957097 ACCAGGCAACAGATGGCCCATGG + Intergenic
1174403046 20:50286205-50286227 TCTAGACCAGAGGTGGCCCACGG - Intergenic
1174762360 20:53218344-53218366 ACTTTACAACAGTTGGCACAGGG + Intronic
1178114055 21:29398861-29398883 ACTTTGCCACAGATGGCCACAGG + Intronic
1182432349 22:30307227-30307249 AAGGGACCACAAATGGCCCATGG + Intronic
1183716934 22:39538562-39538584 CCTTGTCCACAGATGGAGCAGGG - Intergenic
950286020 3:11745246-11745268 ACTTGAGCACAGGAGGCCTAGGG + Intergenic
951705846 3:25543590-25543612 AAATGGCCACAGATGGCCAATGG - Intronic
953500363 3:43427188-43427210 ACTTGTCCACAGGTGGCACAAGG + Intronic
954176472 3:48849242-48849264 ACTTGTTCTCAGATGCCCCACGG + Intergenic
955005433 3:54964301-54964323 ATTTGATTACAGATGTCCCAGGG - Intronic
955087534 3:55717800-55717822 CCTTGACTTCAGATGGCTCAAGG + Intronic
956366269 3:68506398-68506420 ACTTAAGCAGAGATGACCCAAGG + Intronic
956392748 3:68791099-68791121 ATCTGACCACACATGGCCCTGGG + Intronic
958878074 3:99638300-99638322 TCTTGACCACAGATGGGGAAAGG - Intergenic
961380390 3:126492811-126492833 CCTGGAGCACAGATGGCTCAGGG - Intronic
962936282 3:140083786-140083808 TCCTGCCCACAGATGTCCCATGG - Intronic
968489249 4:881244-881266 CCTGGACCACAGAGGCCCCAAGG - Intronic
968902405 4:3437890-3437912 ACTTGTTCACAGATGCCTCATGG + Intronic
969175001 4:5391730-5391752 ACTTGACCACGAATGGGCCTGGG + Intronic
976820926 4:89206258-89206280 ACTTGACTACATATGCCTCAAGG + Intergenic
981815303 4:148824488-148824510 ACTTAACCACAGATTGCCTAAGG + Intergenic
983221885 4:165051780-165051802 ATTTGATCACAGTTGGCCCCTGG - Intergenic
983619743 4:169748205-169748227 ACTTGACCTCAGGTGTTCCATGG - Intronic
986723701 5:10578564-10578586 CCTTGATCAGAGAGGGCCCATGG + Intronic
987049177 5:14135290-14135312 GCTTGCCCTCAGCTGGCCCATGG + Intergenic
988691624 5:33578131-33578153 ACTTGAGCACAGACCACCCAGGG + Intronic
991637106 5:68717020-68717042 ACTTGAACTCAGCTGGACCAAGG - Intergenic
994718961 5:103358614-103358636 TATTGACCACACATGACCCAAGG - Intergenic
996541439 5:124633438-124633460 ACATGACAACAGCTGGCCAAGGG + Intergenic
997633827 5:135390061-135390083 TTTAGACCACAGGTGGCCCAAGG - Intronic
998183960 5:139964838-139964860 GCTTGGCCACTGATGGCTCAGGG - Intronic
999486805 5:152004897-152004919 CCCTGGTCACAGATGGCCCAGGG - Intergenic
999763829 5:154723315-154723337 ACCTGGCCACTTATGGCCCAAGG - Intronic
1001158830 5:169296630-169296652 ACTTGACCACAGAGGTCCTGAGG - Intronic
1003138423 6:3451801-3451823 AGTTGAACACAGATGGTCCCCGG + Intronic
1007028830 6:38607625-38607647 ACTTCTCAAAAGATGGCCCAAGG - Intronic
1013127310 6:107196823-107196845 ACTTGATCACCAATGGCCAATGG + Intronic
1013769988 6:113617542-113617564 AATTGACCACAAGTGGCCTAAGG + Intergenic
1022181510 7:27925158-27925180 ACTTGACTACAAATGGCCTTTGG - Intronic
1026841645 7:73672558-73672580 ACTTGACCTAAGCTGACCCAGGG - Intergenic
1027893014 7:84001363-84001385 CCTGAATCACAGATGGCCCAGGG - Intronic
1033427919 7:141262155-141262177 ACTTTATAAAAGATGGCCCAGGG - Intronic
1035581541 8:743135-743157 ACTTAACCACAGAAGGACAAGGG + Intergenic
1038671063 8:29583436-29583458 ACTTCTCCACAAATGGCCCAGGG - Intergenic
1039695211 8:39903225-39903247 TCATTACCACAGATGGCGCAGGG - Intronic
1039749822 8:40467571-40467593 CCTGGGCCACATATGGCCCATGG - Intergenic
1044819926 8:96149053-96149075 TTTTGCCCACAGATGGCTCATGG - Intronic
1047335117 8:123928566-123928588 ACCTCACCACAGATAGCCCTGGG - Intronic
1047420109 8:124700673-124700695 AGTAGACCACAGAGGGCTCAAGG - Intronic
1049357040 8:142194043-142194065 ACCAGACCACAGAGGGCCCAAGG - Intergenic
1051236239 9:15002258-15002280 ACTCGACCTCAGATGTTCCATGG + Intergenic
1055001217 9:71451026-71451048 ACTTGTCAACAGATGCCGCAGGG - Intergenic
1057412550 9:94829858-94829880 TCATGACTACAGGTGGCCCAAGG + Intronic
1185519537 X:728486-728508 ACCTCACCACAGATGGGCCCAGG + Intergenic
1187242065 X:17522533-17522555 CCTGGACCACAGACGGCCCTGGG - Intronic
1190081446 X:47359724-47359746 ACTTGATCACCAATGGCCAATGG - Intergenic
1190713150 X:53083535-53083557 ACTGGACCACAGATGGGAAAGGG + Intronic
1198221334 X:134605161-134605183 ACTTCACAACAGCTGGCCCAGGG + Intronic
1200738903 Y:6831785-6831807 AGTGGACCACATTTGGCCCATGG + Intergenic