ID: 1135839432

View in Genome Browser
Species Human (GRCh38)
Location 16:25861197-25861219
Sequence CAGTCACAGCAGAAGCAGTG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 428
Summary {0: 1, 1: 0, 2: 4, 3: 38, 4: 385}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1135839430_1135839432 -8 Left 1135839430 16:25861182-25861204 CCATCTTCCTAGTGTCAGTCACA 0: 1
1: 0
2: 1
3: 13
4: 196
Right 1135839432 16:25861197-25861219 CAGTCACAGCAGAAGCAGTGAGG 0: 1
1: 0
2: 4
3: 38
4: 385

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1135839432 Original CRISPR CAGTCACAGCAGAAGCAGTG AGG Intronic
900956350 1:5888355-5888377 CTCTCACATAAGAAGCAGTGTGG + Intronic
900985991 1:6073013-6073035 CAGTCTCAGCAGAGGAGGTGAGG + Intronic
901875326 1:12164163-12164185 CAGGGACAGCAGAGGCAGTGTGG - Intergenic
903705764 1:25284634-25284656 GAGACACAGCTGGAGCAGTGTGG + Exonic
903721474 1:25408786-25408808 GAGACACAGCTGGAGCAGTGTGG - Exonic
903918544 1:26782645-26782667 CAGGCAAAGCAGAAGCAGGGAGG - Intergenic
904413070 1:30336706-30336728 CAGGCCCGGCAGCAGCAGTGGGG + Intergenic
905496443 1:38392488-38392510 TAGACACAACAGTAGCAGTGTGG + Intergenic
905725860 1:40251529-40251551 CAGTCAGAGCAGCTGCAGTAGGG - Exonic
905872798 1:41414812-41414834 CAGGGACAGCACATGCAGTGTGG - Intergenic
906950158 1:50328515-50328537 CAGACAGAGCAGAAGCAGCCTGG + Intergenic
907412288 1:54291276-54291298 CTGTCACAGCAGAGGAGGTGAGG - Intronic
907692674 1:56685275-56685297 CAGTGACAGTAGTAGCAATGGGG + Intronic
909170026 1:72282963-72282985 CAGCAGCAGCAGAAGCAGCGCGG + Intergenic
911370520 1:96989464-96989486 CAGTCACAGCCCCAGCAGAGGGG + Intergenic
911729297 1:101276300-101276322 TAGTAACAGCAAAAGAAGTGGGG + Intergenic
911886062 1:103301024-103301046 CAATCATGGCAGAAGCAATGGGG + Intergenic
911982676 1:104586216-104586238 GAGGCAGAGCAGAAGCAGGGTGG + Intergenic
912189372 1:107319507-107319529 CAGTCACAGCAGGAACAGGTTGG + Intronic
912256766 1:108067602-108067624 CAGTCACAACAGAAGCTCTCTGG + Intergenic
912372831 1:109187043-109187065 CAGACTGAGCAGAACCAGTGCGG - Intronic
912420877 1:109541612-109541634 CAGTCACAGAACAAGAAGTAGGG - Intronic
912611674 1:111052924-111052946 CATTAGCAGCAGCAGCAGTGTGG - Intergenic
913182633 1:116336923-116336945 CAGTGACAGCAGCAGTGGTGGGG + Intergenic
914355671 1:146882231-146882253 CAGACAGAGCAGAAGCACTGGGG - Intergenic
914455724 1:147834544-147834566 CACCGTCAGCAGAAGCAGTGTGG - Intergenic
916455224 1:164964203-164964225 CAGTCCAAGCAAAAGCAGTCAGG + Intergenic
916584251 1:166136479-166136501 CAGAGACAGCAGCAGCTGTGAGG - Intronic
917199004 1:172496098-172496120 CAGTAAAAGCAGAAACTGTGAGG - Intergenic
919568896 1:199221660-199221682 AAGTCATAGCAGCAACAGTGAGG + Intergenic
921151738 1:212408284-212408306 CTGGCACAGGAGAAGCAGTCAGG + Intronic
922115391 1:222608143-222608165 CAGCCACAGCTGAAGCAGGTGGG + Intergenic
922164076 1:223100514-223100536 CAGCCACAGCTGAAGCAGCTGGG - Intergenic
922464374 1:225836737-225836759 CAAACTCAGCAGAAGCAGAGAGG + Intronic
922897303 1:229110314-229110336 CTATAACTGCAGAAGCAGTGAGG - Intergenic
923110043 1:230883130-230883152 TACTCACAGGAGAAGAAGTGTGG + Intergenic
924094107 1:240533536-240533558 AAGTCCCATCAGAAGCACTGAGG + Intronic
924581715 1:245329564-245329586 CAGCCACTGCAGAAGCAGGACGG - Intronic
1063419048 10:5896461-5896483 CCGTCACAGAAAAGGCAGTGTGG + Intronic
1064129831 10:12699294-12699316 GAGTCACAGCAAAAGCAGACCGG - Intronic
1065159341 10:22903020-22903042 CAGTCTCAGCAGCAGCAGAATGG + Intergenic
1065519598 10:26558798-26558820 CAGAAACAACAGAAGCAATGAGG + Intronic
1065879618 10:30027567-30027589 CAGCAGCAGCAGCAGCAGTGAGG - Exonic
1066688447 10:38003209-38003231 CAGTCACAGGAGCAGCACAGAGG - Intergenic
1068369257 10:56092151-56092173 CACTCACAGCAGAAGGTGAGGGG - Intergenic
1068698968 10:60000048-60000070 CATTCACAGCAGGAACAGGGAGG - Intergenic
1069043001 10:63713923-63713945 CAGTCACCCCAGGAACAGTGAGG - Intergenic
1070931304 10:80262770-80262792 TAGTCACAGCAAAAGCAGACAGG - Intergenic
1071664211 10:87538047-87538069 CAGTGACTCCAGAAGCAGAGGGG - Intronic
1071990354 10:91095385-91095407 AAGTCACAGCAGAAGATGTGAGG + Intergenic
1072206442 10:93209213-93209235 CAGTGAGATCATAAGCAGTGAGG - Intergenic
1072317861 10:94221245-94221267 CACTGACATCAGAAGCACTGGGG - Intronic
1072569055 10:96642730-96642752 CCCTCACAGCAGGATCAGTGAGG - Intronic
1072733748 10:97865655-97865677 CAGTGGCAGCAGCAGCGGTGGGG + Exonic
1074034658 10:109726101-109726123 CAGTGAGAGCAGAAGCTTTGAGG - Intergenic
1077214120 11:1388290-1388312 CACTCACAGCAGCAGCAGCGGGG + Intergenic
1079370656 11:19849325-19849347 CAGCTACAGCAGAACCAGTTAGG + Intronic
1080740462 11:35059163-35059185 CAGTGAGAGCAGTTGCAGTGAGG + Intergenic
1081683679 11:45026526-45026548 CAGTCACAGCAGCAACACAGTGG + Intergenic
1081773299 11:45662811-45662833 GAGTCACAGCAGCAGCTGAGCGG + Intronic
1082612402 11:55317110-55317132 CAGTTTTAGCTGAAGCAGTGTGG + Intergenic
1084393144 11:68891651-68891673 AAGTCACAGCATAGACAGTGTGG - Intronic
1085201564 11:74705257-74705279 CAGTGACAGCAATAGGAGTGTGG + Intronic
1085282613 11:75340918-75340940 CAGGGCCAGCAGCAGCAGTGTGG - Intronic
1085334488 11:75680814-75680836 CAGCCATAGCAAAAGCACTGAGG - Intergenic
1086734847 11:90293766-90293788 CAGTCAAAGCACAAGCAGGCTGG - Intergenic
1087188212 11:95225183-95225205 CACTGAGAGCAAAAGCAGTGGGG - Intronic
1087222582 11:95562478-95562500 CATTGACAGGAGATGCAGTGTGG + Intergenic
1087625769 11:100594529-100594551 CACACACAGCAGCAGCAGAGTGG - Intergenic
1088554223 11:111045297-111045319 GACTGACAGCAGAGGCAGTGGGG - Intergenic
1088653704 11:111979243-111979265 CAGGCACGTCAAAAGCAGTGAGG - Intronic
1089508395 11:118980001-118980023 CAGTCCTAGCAGAAGCAGGTGGG - Intronic
1090301274 11:125642075-125642097 CAGTCACTACAAAAACAGTGAGG - Intronic
1090795141 11:130128955-130128977 CACTGACAGGAGAAGCACTGGGG + Intronic
1091214482 11:133892297-133892319 CAGCCACAGCAGAGGCGGAGAGG - Intergenic
1091427248 12:401758-401780 AAGTAACTGCGGAAGCAGTGCGG + Intronic
1091608189 12:1976526-1976548 CATTCACATCATGAGCAGTGAGG - Intronic
1092529404 12:9332072-9332094 CAGCCTCAGGAGAGGCAGTGAGG - Intergenic
1094085113 12:26581931-26581953 CAGTTGCAGAAGATGCAGTGTGG - Intronic
1094523408 12:31216166-31216188 CAGAAGCAGCAGCAGCAGTGAGG - Intergenic
1094687969 12:32737912-32737934 CAGCCTCAGCAGAAGCAGCGGGG - Exonic
1095175062 12:39082239-39082261 CAGTCATAGCATGAGCACTGAGG - Intergenic
1095818441 12:46450485-46450507 CAGCCTCTACAGAAGCAGTGGGG - Intergenic
1096309253 12:50505482-50505504 CAGGAAGCGCAGAAGCAGTGTGG - Intronic
1096966102 12:55629239-55629261 AAGTCAAGGCAGAAGAAGTGAGG - Intergenic
1097186388 12:57198694-57198716 CAGGCACAGCAGACTCAGTGGGG + Intronic
1098586656 12:72162421-72162443 CAGTCACATCAGAATTAGTATGG + Intronic
1098994941 12:77108354-77108376 AAGGCACCACAGAAGCAGTGTGG - Intergenic
1099931673 12:89082537-89082559 TACTCACAGCAAAGGCAGTGAGG - Intergenic
1099979684 12:89584059-89584081 CAGTCACAGCAGGAGCGAGGTGG - Intergenic
1101438067 12:104680827-104680849 CACTCACAGCAGGAACAGGGGGG - Intronic
1101470595 12:104993264-104993286 CAGTCACAACAGAGACAGTAAGG - Intronic
1101529033 12:105557704-105557726 CACTCAGAGCAGCAGGAGTGTGG - Intergenic
1102387593 12:112523002-112523024 CAGTCAAAGCAAAAGCAGACCGG + Intergenic
1102851153 12:116246656-116246678 CAGACACAGCTGAAGCATTGTGG + Intronic
1103557735 12:121776176-121776198 GGCTCACAGCAGAAGCAGAGTGG - Exonic
1103976373 12:124705422-124705444 CACTCACTGAAGAGGCAGTGGGG - Intergenic
1107005389 13:35604067-35604089 CAGTCACGGAAGGAGCAGTTTGG - Intronic
1108196157 13:47997559-47997581 CACTCCCAGCAGCAGCAGTGGGG - Intronic
1109069605 13:57747804-57747826 ACTTCACAGCAGAAGAAGTGTGG + Intergenic
1109074932 13:57822694-57822716 CAGTTACAGAAGAATGAGTGTGG + Intergenic
1109311494 13:60699717-60699739 CAGAAACAGCAGAATGAGTGGGG - Intergenic
1109576478 13:64265229-64265251 CAGTCAAGACAGAAGCAGTATGG + Intergenic
1110628227 13:77675958-77675980 CAGAAGCAGCAGAAGCAGTAAGG + Intergenic
1111785334 13:92779124-92779146 CAATCACAGCAGAAGGAGAAAGG + Intronic
1112037311 13:95508638-95508660 CAGTCACCATAGAAGCAGAGAGG + Intronic
1112943092 13:104890428-104890450 GAGACACAGAAGAAGAAGTGTGG - Intergenic
1113242680 13:108355989-108356011 CAGTCAAAGCAAAAGCAGACAGG - Intergenic
1113529256 13:111008573-111008595 CCGTCACAGCACAAGCAGACTGG - Intergenic
1113913622 13:113856829-113856851 CCGTCCCTGCAGAAGCAGAGAGG - Intronic
1114185083 14:20395130-20395152 GAATCAGAGCAGAAGCAGAGAGG + Intronic
1114652208 14:24292390-24292412 CATTCACAGTAGAAGCAGAGAGG - Intronic
1115418444 14:33164805-33164827 CTGACACAGGAGAAGCAATGGGG - Intronic
1116931367 14:50694382-50694404 CAGCCACAGCAGGAGCAGCTGGG + Intergenic
1117689177 14:58287771-58287793 CAGTCAAAGCAAAAGCAGGCTGG - Intronic
1117707998 14:58493140-58493162 CAGTTACAGCAGAAATAGAGAGG + Intronic
1118522143 14:66596897-66596919 CAATGACACCAGATGCAGTGGGG - Intronic
1118740107 14:68733322-68733344 CAGTTACAGCAGAAGCTGGAAGG + Intergenic
1121201586 14:92122239-92122261 CAGTCGCAGCCGAAGCGGCGGGG - Intronic
1121442249 14:93956587-93956609 CCATCTCAGCAGGAGCAGTGGGG + Intronic
1121853963 14:97249293-97249315 AAGTCACAGCAGTGGCACTGTGG - Intergenic
1122158359 14:99764701-99764723 CAGGCACAGAAGCAGCAGGGTGG + Intronic
1122905028 14:104797657-104797679 CAGTCCCAGCAGCAGCCGTGGGG - Intergenic
1123894009 15:24809946-24809968 CACTCACACCAGTAGAAGTGGGG - Intergenic
1125596584 15:40891146-40891168 GAGGCAAAGGAGAAGCAGTGAGG - Intergenic
1127401059 15:58586335-58586357 CAGTCTCAGCGGCAGCAGGGAGG - Intergenic
1127410705 15:58703790-58703812 CAGTCATAGCAGAAGGAGAAGGG - Intronic
1127474076 15:59315772-59315794 CAGCAACAGCAGCAGCATTGGGG - Intronic
1127867952 15:63047219-63047241 GAGTCTCAGCAGAGGCTGTGAGG + Intronic
1128618302 15:69127709-69127731 GAGTCTGAGCATAAGCAGTGAGG + Intergenic
1130937464 15:88482441-88482463 CATTCACAGGAGAGGAAGTGAGG + Intergenic
1133820916 16:9235786-9235808 AAGTCAAAGCATGAGCAGTGAGG + Intergenic
1135513665 16:23111244-23111266 CAGTCTAAGCTAAAGCAGTGAGG + Intronic
1135839432 16:25861197-25861219 CAGTCACAGCAGAAGCAGTGAGG + Intronic
1137294566 16:47078015-47078037 CGGTCACTGAAGAGGCAGTGAGG - Exonic
1138096853 16:54218708-54218730 CAGAGACAGCAGGTGCAGTGGGG + Intergenic
1138300667 16:55926848-55926870 CAGTCAAAGCAAAAGCAGACTGG - Intronic
1139978346 16:70833212-70833234 CAGACAGAGCAGAAGCACTGGGG + Intronic
1141160149 16:81624010-81624032 CTGTATCAGCAGAAGCAGAGGGG - Intronic
1142293487 16:89203695-89203717 CAGTCACTGTAGAAACAGTATGG - Intergenic
1144262787 17:13539171-13539193 GAGCCACAGCAGAAGCTGTCAGG + Intronic
1146417636 17:32651486-32651508 CAGTCCCAGGATGAGCAGTGGGG - Intronic
1148789971 17:50167533-50167555 GAGTCACAGCAGGAGCCCTGCGG - Intronic
1149026065 17:52028817-52028839 TCGTCACAGCAGAAGCTTTGTGG - Intronic
1151227514 17:72657996-72658018 CAGGCACGGCAGAAGCAGAAGGG + Intronic
1151546587 17:74797036-74797058 CAGCCACAGCAGAGCCAGTTTGG + Intronic
1152202293 17:78954181-78954203 CAGTCACAGCAGACCCCGTGCGG - Intergenic
1152359077 17:79821994-79822016 CATTCACAGCCGCAGCAGTTTGG + Intergenic
1153010245 18:532172-532194 TTGGCACAGCAGAAGCAGCGTGG + Intergenic
1154010854 18:10572558-10572580 CAGCCACAGCAGGGGCAGTAAGG + Intergenic
1157812357 18:50706410-50706432 CAATCACATCAGAATCTGTGGGG - Intronic
1159613111 18:70548111-70548133 CACTCACAGCACACACAGTGTGG + Intergenic
1159643192 18:70887692-70887714 TAGCCACAGCTGGAGCAGTGAGG - Intergenic
1160866178 19:1257143-1257165 CAGCGACAGCAGTAGCAGCGGGG + Exonic
1160870819 19:1277049-1277071 CAGGCACAGCAAAACCAGGGAGG + Intronic
1160887249 19:1355569-1355591 GGGTCACAGCAGAAGCGGGGGGG - Intronic
1161283825 19:3458939-3458961 CAGTCAGGGCAGCAGCAATGGGG - Intronic
1162705462 19:12551604-12551626 GAGTGACAGGAGAAGCAATGCGG + Intronic
1164821665 19:31255696-31255718 CAGGCAGAGCAGCAGCAGAGGGG + Intergenic
1164983105 19:32628740-32628762 CAGTCATCGCAGAAGCAGAGAGG + Exonic
1165002476 19:32776365-32776387 CAGCAACAGCAACAGCAGTGTGG - Intronic
1166634991 19:44443210-44443232 CAGTCACAGAAGAGTCTGTGAGG + Intronic
1166748141 19:45151722-45151744 CAGGCACAGAAGGACCAGTGAGG - Exonic
1167488962 19:49780995-49781017 CAGGGACAGGAGAAGCAGAGAGG + Intronic
1167603490 19:50467639-50467661 AGGGCACAGCAGAAGCAGAGAGG + Exonic
925770934 2:7282584-7282606 AGGTCCCTGCAGAAGCAGTGTGG + Intergenic
926586903 2:14696374-14696396 CAGTCAGAGAAGAAGATGTGAGG - Intergenic
927826650 2:26313999-26314021 CAGAAACAGAGGAAGCAGTGGGG + Intronic
928224073 2:29432378-29432400 CAGTCATAGCAGAAGGGGCGGGG - Intronic
928728075 2:34198655-34198677 CAGTCAAAGCAAAAACAGAGTGG + Intergenic
931799787 2:65747520-65747542 CAGTCAGAGCCCAAGCAGTGGGG + Intergenic
932417653 2:71583531-71583553 AAGTCACAGGCTAAGCAGTGAGG - Intronic
935138309 2:100327702-100327724 CAGGCATAGCCGAAGCAGAGAGG + Intergenic
936539462 2:113338301-113338323 CAGACACAGCAGCAGGACTGGGG - Intergenic
937588839 2:123590061-123590083 GAGACACAGCAGAAGGAGAGTGG + Intergenic
937992771 2:127673683-127673705 CAGCCCCAGCAGCAGCATTGAGG - Intronic
938573771 2:132585464-132585486 CAGTCACGGGAGAAGCGGGGAGG - Intronic
938664637 2:133521952-133521974 CAGTCACATAACAAGCAGAGAGG - Intronic
940236490 2:151516460-151516482 GAGTCTCAGCAGATGCAGAGTGG - Exonic
940627888 2:156198790-156198812 CAGTGACAGCAGAATCACTTTGG - Intergenic
942090038 2:172480940-172480962 GACTCACAGCTGAAGAAGTGTGG - Intronic
942467524 2:176224362-176224384 CAGTCACAGAAGCAGAATTGAGG + Intergenic
942737912 2:179137627-179137649 CTGTAACAGCAGCAGCAGTATGG + Intronic
942982911 2:182103921-182103943 CAGTAACAGGAGAATCACTGAGG + Intronic
943172395 2:184419296-184419318 GAGAAACATCAGAAGCAGTGGGG + Intergenic
943511230 2:188830233-188830255 CAGCCACAGCAGGAGTGGTGAGG - Intergenic
943633061 2:190276105-190276127 CAGTCAAAGCACAAGCAGACTGG + Intronic
945433765 2:209795648-209795670 CAGCCACAGCTGGAGCAGTTGGG - Intronic
945521492 2:210833095-210833117 CAGTTGCAGCAGAAGCAGGTAGG + Intergenic
947032244 2:225809869-225809891 CAGTCAAAGCAAAAGCAGACCGG - Intergenic
947034083 2:225831225-225831247 CAGTCAAAGCAAAAGCAGATGGG + Intergenic
947567799 2:231205937-231205959 CAGTCACAGCAGAGGGAGGGGGG - Intronic
948321233 2:237071543-237071565 CAGTCACAGCAGAATATCTGAGG - Intergenic
948562939 2:238866077-238866099 CAGTAACACCAGATGCAGTGTGG - Intronic
948594592 2:239071595-239071617 CAGTCACAGCAGTAGCAGGCTGG - Intronic
948646920 2:239411153-239411175 CAGTCACCCTAGAAGCAATGAGG - Intergenic
1168969930 20:1924069-1924091 CAGTAACAGAAGAAGCAGCCAGG + Intronic
1169134526 20:3189253-3189275 CAGTCAAATCAGAATCTGTGAGG - Intergenic
1170552275 20:17488424-17488446 TAGTTACAGCAGAGGCTGTGTGG + Intergenic
1172654795 20:36530076-36530098 CTGCCACAGCAGAAGCAGGAAGG - Intergenic
1173998858 20:47359808-47359830 CAAGCACAGCAGAAACAATGAGG + Intergenic
1175786822 20:61717195-61717217 CTGTGACAGCAGCAGCAGTGGGG - Intronic
1176233146 20:64042121-64042143 CAGCCACAGCTGGAGCAGGGGGG - Intronic
1177086445 21:16711124-16711146 TAGTCACAGATGAAGGAGTGTGG - Intergenic
1177251709 21:18599948-18599970 ATGGCACAGCAGAAACAGTGAGG + Intergenic
1178437947 21:32575915-32575937 CACTCCCAGCAGAAGGCGTGTGG - Intergenic
1179075077 21:38113416-38113438 CAGTCACACCAGCAGCATTTTGG + Intronic
1179199162 21:39199405-39199427 TAGCTACAGCAGAAGCATTGCGG + Exonic
1179294530 21:40049369-40049391 GAGTCACAGCAGGAGCAGAGGGG - Intronic
1179441347 21:41396698-41396720 CACTCAGAGCAGGAGCAGAGAGG - Intronic
1180606363 22:17061840-17061862 CAGTTACAGCAGAATGTGTGGGG - Intergenic
1181139623 22:20794911-20794933 CAGTTACAACAGAAGCTGTATGG + Intronic
1181288720 22:21774180-21774202 CAGTCACAGCAAAACCTGTCTGG - Intronic
1181304455 22:21906979-21907001 CAGTCAGGGCAGAATAAGTGCGG - Intergenic
1181577425 22:23803770-23803792 CTCACACAGCAGAAGCAGAGTGG - Intronic
1181594020 22:23902779-23902801 CACTCCCAGCAGAAACACTGTGG - Intergenic
1181832325 22:25570722-25570744 AAGACACAGGAGAAGCAGAGGGG - Intronic
1182015843 22:27038970-27038992 CAGTCACACCACAAGCAAGGGGG - Intergenic
1182053301 22:27329745-27329767 TAGTCATTGCAGAAGCAATGGGG + Intergenic
1182204262 22:28607881-28607903 GAGTGAAAGCAGAAGCAGGGAGG - Intronic
1184234594 22:43176284-43176306 AAGTCCCAGCCCAAGCAGTGGGG + Intronic
1184970527 22:48016692-48016714 AAGTCACATCAGAAGCAGCTGGG - Intergenic
1185180809 22:49361352-49361374 CGGACACAGCAAAAGCAGTCAGG + Intergenic
1185340699 22:50289669-50289691 CAGAGACAGCCGGAGCAGTGGGG - Exonic
949903343 3:8838078-8838100 CAGTCCCAGCCAAACCAGTGAGG + Intronic
951033198 3:17905439-17905461 CAGCCAGATCAGGAGCAGTGAGG - Intronic
951117943 3:18887165-18887187 CAGTCAAAGCAGAAGTTGGGGGG - Intergenic
951297447 3:20956212-20956234 CAGTCAAAGCAGAAGCAGACAGG + Intergenic
952735183 3:36682110-36682132 CTGTCACAACAGCAGCACTGAGG + Intergenic
953410961 3:42690330-42690352 CAGTCACTGCACACGCACTGAGG - Intronic
953688600 3:45098051-45098073 CAGGGACTGCAGAAGCAGAGGGG - Intronic
954293856 3:49663487-49663509 CAGACACAGCAGCAGCAGCAAGG + Exonic
954752414 3:52821146-52821168 CAGCCAGGGCAGGAGCAGTGAGG + Intronic
955484656 3:59423490-59423512 CAGTGACAGCTGAAGCAGAAAGG + Intergenic
955800333 3:62679725-62679747 TAGTCACAGAAGAGGCAGGGAGG + Intronic
957740548 3:84262125-84262147 CAATCACAGGAGAAGCACAGTGG + Intergenic
958513960 3:95088439-95088461 CATTAACTGCAGAAGCAGTGTGG - Intergenic
959139377 3:102466710-102466732 AGATCACAGCAGAAACAGTGTGG + Intronic
960044959 3:113187625-113187647 CTGTCACAGCAGCTACAGTGGGG - Intergenic
962065528 3:131975568-131975590 CAGGGCCTGCAGAAGCAGTGTGG - Intronic
962458020 3:135583108-135583130 CAGTGACAGCAGAGGCTGGGTGG - Intergenic
962927043 3:140004480-140004502 CATTCACAGGAGCAGCAGGGAGG + Intronic
963804896 3:149713739-149713761 CAGTGATAGCAGCAGCAGAGGGG + Intronic
963912110 3:150823698-150823720 AAGTCAAAGCAGGAGAAGTGAGG + Intergenic
964574770 3:158153440-158153462 TAGTTACAGCAGAAACATTGTGG - Intronic
964897478 3:161615102-161615124 CAGTCACATCAGAAGAAGCTAGG - Intergenic
965419137 3:168435513-168435535 CAGTAACAGCAGCAGCAGCAGGG + Intergenic
965709724 3:171544864-171544886 CAGTCACAGAAGTAACATTGAGG - Intergenic
965813212 3:172613064-172613086 CAGTCAAAGCACAAGCAGCCTGG - Intergenic
966855974 3:184193940-184193962 CAGTCAGAGCTGGGGCAGTGGGG - Exonic
969091128 4:4694732-4694754 CAGTCACAGGAGAGGTAATGAGG - Intergenic
969658892 4:8514844-8514866 TAGTAAGAGCAGCAGCAGTGTGG + Intergenic
970098247 4:12489355-12489377 CAGTAACAGCATAAGCATGGAGG - Intergenic
970455526 4:16219996-16220018 CTGGCAGAGCAGAAGCAGCGAGG - Intronic
970466239 4:16325855-16325877 CAGAAAAAGCAGAAGCAGAGAGG + Intergenic
971122076 4:23715908-23715930 AAAACAAAGCAGAAGCAGTGTGG + Intergenic
971869721 4:32219057-32219079 GAGTGAAAGCAGAAGCAGTCAGG + Intergenic
972083432 4:35182708-35182730 CAGCAGCAGCAGTAGCAGTGTGG - Intergenic
973167469 4:47095272-47095294 CAGACCAAGCAGAAGCACTGGGG + Intronic
973758929 4:54100027-54100049 GAGTCACAACAGAAGCCGCGAGG - Exonic
975572424 4:75831793-75831815 CATTCACAGAAAAAGGAGTGGGG - Intergenic
976503153 4:85815065-85815087 CAGTCACAGCTGGAGCAGCTGGG + Intronic
976878953 4:89894875-89894897 CAGTCTTAGCAGATTCAGTGTGG + Exonic
976985512 4:91291521-91291543 CAGTCACGACAGAAGCAAAGGGG + Intronic
977320009 4:95501944-95501966 CAGCCACAGCAGAAGAAGAGAGG + Intronic
977753179 4:100633877-100633899 ATGTCACAGCTGAAGCAGAGAGG + Intronic
977914188 4:102572528-102572550 CAGCCACTGTGGAAGCAGTGTGG - Intronic
978301471 4:107273026-107273048 GCATCACAGCAGAAGCAGGGAGG - Intronic
980335538 4:131468846-131468868 CAGCCACAGCTGAAGCAGCTTGG - Intergenic
980382706 4:132045254-132045276 ATGTCACAGCTGAAGCAGTGAGG + Intergenic
980970074 4:139559304-139559326 CAGCAGCAGCAGAAGTAGTGTGG + Intronic
980994195 4:139764881-139764903 CAGTCACTGAAGCAGGAGTGTGG - Intronic
983523679 4:168737922-168737944 CAGAGACAGCAGCAGCTGTGAGG + Intronic
983667796 4:170201836-170201858 AAGTTACATCAGAACCAGTGAGG - Intergenic
984103318 4:175513977-175513999 CAGTCACAGCAGAAGGTGAAGGG - Intergenic
985164623 4:187079341-187079363 CAGGCACAGCAGCAGCAGGCAGG + Intergenic
985481820 5:116955-116977 CAGACGCAGCGAAAGCAGTGGGG - Intergenic
985560041 5:580639-580661 AAGTCACAGCAGAAGGCGAGAGG + Intergenic
985662040 5:1162148-1162170 AAGTCACAACAGAAGCCGAGGGG + Intergenic
985965168 5:3333932-3333954 CAGTCAAGGCAGAGGCAGGGTGG + Intergenic
986572463 5:9179805-9179827 CTGTAAGAGCAGATGCAGTGTGG + Intronic
986601441 5:9477161-9477183 CAGTCACAGCAGAAGATGAAGGG - Intronic
986844650 5:11738327-11738349 CAATAACAGCAAAAGCAGTTAGG + Intronic
987901248 5:24014648-24014670 CAGGAAAAGCAGAAGCAGTTCGG - Intronic
988110058 5:26807987-26808009 CAGGCACATCAGTTGCAGTGGGG - Intergenic
988729460 5:33956408-33956430 CAGTCAAAGCAAAAGCAGACAGG + Intronic
988963560 5:36392939-36392961 CACTCACAGCAGAAGCCCTCTGG + Intergenic
989786737 5:45341586-45341608 CAGTCAAAGCAAAAGCAGACTGG + Intronic
990124043 5:52492593-52492615 TATTCACAGTAGAATCAGTGGGG - Intergenic
990714555 5:58622372-58622394 CAGTCCCTGCAGAATCAGTGAGG + Intronic
991526971 5:67570015-67570037 CAGCCATTGTAGAAGCAGTGTGG + Intergenic
992109696 5:73481491-73481513 CCCTCACAGCAAAAGAAGTGTGG - Intergenic
992830032 5:80585050-80585072 CAGTCATGGCAGAAGCAAAGGGG - Intergenic
993256045 5:85591402-85591424 CAGTCACGGCAGGAGCAGCTGGG + Intergenic
993956067 5:94234610-94234632 CAATCATAGCAGAAGCAAAGGGG + Intronic
993996099 5:94724915-94724937 AAGCCACAACAGAAGCTGTGAGG + Intronic
994703344 5:103166125-103166147 CAGTCAAAGCAGAAGCAGACTGG + Intronic
994998937 5:107102677-107102699 CAGTTCCAGCAGAAGTATTGGGG - Intergenic
995062287 5:107823781-107823803 CAATCACAGCAGAAGGAGAAGGG - Intergenic
995247023 5:109946120-109946142 CAGACACAAATGAAGCAGTGGGG + Intergenic
995782902 5:115796890-115796912 GAGGCAGAGCAGAACCAGTGAGG + Intergenic
996210501 5:120802828-120802850 CAGTCTGAGGAGAAACAGTGTGG - Intergenic
996774761 5:127121315-127121337 AAGTCACAGCTGAAGCAGCTGGG + Intergenic
998789914 5:145755168-145755190 CAGTCAAAGCACAAGCAGACTGG + Intronic
998961410 5:147490862-147490884 CAGTCATGGCAGCAGCAGGGTGG + Intronic
999822073 5:155238396-155238418 CATTCAAAGCAGAAGTAGGGAGG - Intergenic
1000029735 5:157391191-157391213 CAGTGACAGCAGAGGCACTGAGG + Intronic
1000113010 5:158127154-158127176 CAGGCACTGCAGCAGCTGTGCGG + Intergenic
1000527939 5:162381704-162381726 CGGTCCCAGCCCAAGCAGTGAGG + Intergenic
1001641375 5:173246313-173246335 CAGTCACAGCAAAGGCCCTGTGG + Intergenic
1003572865 6:7267445-7267467 CAGTCTCAGGAGAGCCAGTGAGG + Intergenic
1005319337 6:24637155-24637177 CAGTCAAAGCAAAAGCAGAGTGG + Intronic
1005555208 6:26972576-26972598 GAGTCACAGCAGCAGGATTGAGG + Intergenic
1006242846 6:32700949-32700971 CAATCTGAGCAGAAGCTGTGAGG - Intergenic
1006251110 6:32786329-32786351 CAATCTGAGCAGAAGCTGTGAGG - Intergenic
1006912963 6:37576000-37576022 CAGACAAAGAAGAAGGAGTGTGG - Intergenic
1007836252 6:44676308-44676330 CACTCCCAGGAGAAGCAGTGTGG - Intergenic
1011947319 6:92922514-92922536 CAGTCACATCATAAGCAATTTGG - Intergenic
1012310045 6:97712437-97712459 CTGTCACAGCAGAGGCCATGGGG + Intergenic
1013466504 6:110421859-110421881 CAGTTTCAGTAGAATCAGTGGGG + Intergenic
1013650946 6:112193806-112193828 CATTTATAGCAGCAGCAGTGTGG - Intronic
1013688069 6:112609180-112609202 CAGTCACAGCTGGAGCAGCTGGG - Intergenic
1014104903 6:117550751-117550773 CAGTCACAGCAGTCCAAGTGTGG + Intronic
1014271969 6:119346665-119346687 CATTCAGAGCAGAACCAGTGGGG - Intronic
1015281569 6:131440442-131440464 CTGTCAAAGTAGATGCAGTGGGG - Intergenic
1015815659 6:137208522-137208544 CAGTCACAGCTGGAGCAGCTGGG - Intronic
1015969359 6:138728800-138728822 TAGTTACAGCAGAAGCTTTGAGG + Intergenic
1016218504 6:141634425-141634447 CAGTCAAAGCAAAAGCAGTTTGG - Intergenic
1017694620 6:157001994-157002016 CAGGCAGAGCAGGAGCTGTGTGG - Intronic
1018220479 6:161573119-161573141 GAGTCACAGGAGAAGTTGTGGGG + Intronic
1018441232 6:163815278-163815300 CAGTCACTGCAGAGGCAATGAGG + Intergenic
1019131879 6:169882955-169882977 CATTCTGGGCAGAAGCAGTGAGG + Intergenic
1019664346 7:2243951-2243973 TAGCCACAGCAGGAGCAGAGTGG + Intronic
1019873352 7:3788104-3788126 CAATCGAAGCAGAAGGAGTGAGG - Intronic
1020423431 7:8036062-8036084 CAGCTACAGCAGAAGCAGATGGG - Intronic
1021131140 7:16913976-16913998 CAGTAGCAGCAGCAGCAGTGTGG - Intergenic
1021170398 7:17392263-17392285 CAGTCACAGCAGAAGGTGAAGGG + Intergenic
1021495129 7:21266098-21266120 CAGTCTCAGGAAAACCAGTGTGG + Intergenic
1022844737 7:34198608-34198630 CAGTCACAGCAGTGGCAAAGCGG + Intergenic
1023085203 7:36563282-36563304 CAGTGACAGCAGAAATAGTGGGG - Intronic
1024924680 7:54600423-54600445 CAGTCACATCAGAGGCACTTGGG + Intergenic
1026842865 7:73680257-73680279 CAGGCACGACAGAAACAGTGGGG - Intergenic
1028152622 7:87391657-87391679 CATGCACAGTTGAAGCAGTGAGG + Exonic
1028325166 7:89514942-89514964 CAGTCACAGCAAAAGTAGCCTGG + Intergenic
1028353910 7:89883182-89883204 ATGTCACAGCCAAAGCAGTGAGG - Intergenic
1028514401 7:91660411-91660433 CCGACAGAGTAGAAGCAGTGAGG + Intergenic
1028659533 7:93253605-93253627 AAGGCAGAGCAGCAGCAGTGGGG + Intronic
1029170595 7:98627045-98627067 CGGTGACAGGAGGAGCAGTGTGG + Intronic
1030646158 7:112064159-112064181 GGATCACAGCAGAAGCAATGTGG + Intronic
1030656051 7:112169188-112169210 CAGTCACAGCAGAAGGTGAAGGG - Intronic
1032271013 7:130405924-130405946 CAGACACCGCAGAAGCAGAGAGG + Intronic
1032766074 7:134995169-134995191 AAGTCACAGTAGGAGCAGTAGGG - Intronic
1032786952 7:135208538-135208560 CAGTGACAGTGGCAGCAGTGGGG - Intronic
1033148025 7:138887864-138887886 CAGCAGCAGCAGCAGCAGTGAGG + Intronic
1033287244 7:140051999-140052021 CAGTCACAGCAGAAGTGATCAGG - Intronic
1033706381 7:143889645-143889667 CAGTCAAAGCAAAAGCAGATGGG + Intronic
1034282669 7:149864781-149864803 CTCCCACAGCAGAAGCAGTGAGG + Exonic
1034292568 7:149944711-149944733 CAGTGACAGAGAAAGCAGTGGGG - Intergenic
1034481791 7:151326994-151327016 CAGTCACAGCAAAAGCAGACTGG - Intergenic
1034700933 7:153095128-153095150 CAGTCACGGCAGAAGGAGAAAGG + Intergenic
1034813502 7:154152181-154152203 CAGTGACAGAGAAAGCAGTGGGG + Intronic
1034852060 7:154502576-154502598 CAGTCACAGCAGAAGGTGAAAGG - Intronic
1034946636 7:155266684-155266706 CAGTCACAGCAGAAGCTGGGAGG + Intergenic
1035607937 8:941225-941247 CAGACACAGCAGATGCTGTCTGG + Intergenic
1038584941 8:28779834-28779856 CAGTTACACCAGAAGCACTGGGG - Intronic
1038633982 8:29270763-29270785 CAGTCACAGAAAAAACTGTGGGG - Intergenic
1038707196 8:29905572-29905594 CTGTTACAGCAGCAGCAGTAAGG - Intergenic
1039327385 8:36500431-36500453 CAGTCAAGGTAGAAGGAGTGAGG + Intergenic
1039600037 8:38828734-38828756 AGGACACAGCAGAAGCAGGGAGG - Intronic
1039782182 8:40796662-40796684 CAGTCTCTGCAGCAGCTGTGCGG - Intronic
1041799507 8:61784002-61784024 ATGTCCCAGCTGAAGCAGTGAGG + Intergenic
1041871900 8:62644207-62644229 TAGTAGCAGCAGGAGCAGTGAGG - Intronic
1041948148 8:63470147-63470169 CAGTCTCAGCAGAAAGAGAGAGG + Intergenic
1042764745 8:72308755-72308777 CATTCACAGCAGCAGCAGTGGGG + Intergenic
1044859612 8:96509834-96509856 CTGTCACAGTCTAAGCAGTGTGG + Intronic
1045895487 8:107211027-107211049 CAGTCAAAGCAAAAGCAGACTGG + Intergenic
1046054108 8:109058976-109058998 CAGCCCCAGCAGAGGCCGTGTGG - Intergenic
1047198879 8:122746902-122746924 AAGTCACAGCTCAAGCAGTCAGG + Intergenic
1047215244 8:122870797-122870819 CAGTCACAGCAGAAATGGAGTGG + Intronic
1048315453 8:133358549-133358571 AGGGCACAGCAGCAGCAGTGAGG + Intergenic
1048332802 8:133482547-133482569 AAGTGAAAGCAGATGCAGTGGGG - Intronic
1048346598 8:133580540-133580562 GAGGCTCTGCAGAAGCAGTGAGG - Intergenic
1048513174 8:135080621-135080643 CAGTGTCAGCAGAAGGGGTGGGG - Intergenic
1049587856 8:143440290-143440312 CAGCCACGGCAGCCGCAGTGAGG + Exonic
1050880896 9:10699535-10699557 CTGTCAGATCAGCAGCAGTGGGG + Intergenic
1051143487 9:14003137-14003159 CACTGACACCAGCAGCAGTGTGG - Intergenic
1051231416 9:14959200-14959222 CAATCACAGAAGAAACAGTATGG + Intergenic
1051347330 9:16164002-16164024 AAGTCACAGATGAAACAGTGGGG + Intergenic
1053329498 9:37190210-37190232 CAGTGACAGCAGCAGCAGTGGGG - Intronic
1055459062 9:76499746-76499768 TAATAACAGCAGAAACAGTGAGG - Intronic
1056296053 9:85194030-85194052 CAATCTCAGCAGAAAGAGTGTGG - Intergenic
1056795708 9:89657360-89657382 CAGGCACAGCATCACCAGTGTGG - Intergenic
1056817333 9:89811496-89811518 CCGTCACTGCAGAAGCTGGGTGG + Intergenic
1057220648 9:93256151-93256173 ACATGACAGCAGAAGCAGTGAGG - Intronic
1057270453 9:93647381-93647403 CTGTCCCTGCAGAAGCAGGGAGG + Intronic
1057856703 9:98606439-98606461 CTGGCACATCAGAAGCACTGTGG + Intronic
1057915050 9:99048938-99048960 CATACAAAGCAAAAGCAGTGTGG - Intronic
1058599617 9:106655030-106655052 CATTCACAACAGAACCTGTGTGG + Intergenic
1059328456 9:113519245-113519267 CAGACATGCCAGAAGCAGTGTGG - Intronic
1059682093 9:116595667-116595689 CAGTCACACCACAAGCAGAAAGG - Intronic
1060045585 9:120337513-120337535 CAGGCACAGAGGAAGCAGCGTGG - Intergenic
1060559701 9:124532959-124532981 CAGTAACAGCAGAAGTAGTGAGG - Intronic
1060970885 9:127737198-127737220 GGGTCACAGCAGCAGCAGAGTGG - Intergenic
1062178909 9:135180160-135180182 CAGTGACAACAGGAGGAGTGAGG + Intergenic
1186383311 X:9084057-9084079 CAGTCAGAGAAGAAGATGTGAGG - Intronic
1186562745 X:10630401-10630423 CAGTGATTGCAGAAGCTGTGAGG + Intronic
1186758728 X:12700935-12700957 CAGCCACAGCAGCTGCAGGGAGG - Intronic
1187289564 X:17940068-17940090 CAGTGAGAGCAGAAGCAGGAGGG - Intergenic
1187389781 X:18878365-18878387 CACTCATAGCAGAGGCAGAGTGG - Intergenic
1187584076 X:20640527-20640549 CAGTCACAGCAGAAGGTGAAGGG + Intergenic
1187865204 X:23717466-23717488 CACTCACACAAGAGGCAGTGAGG + Intronic
1188153840 X:26716133-26716155 CAGTCAGAGCAAAAGCAGACTGG - Intergenic
1189207640 X:39255680-39255702 CAGTAACAGCAGAAGCTGCCAGG + Intergenic
1189681552 X:43521676-43521698 CAGTCACAGCACACCCAATGAGG - Intergenic
1189824501 X:44903532-44903554 AAGTCACAGAAGAAGGAGAGGGG - Intronic
1189926468 X:45960095-45960117 CAGTAACAGCAGCAGGGGTGGGG - Intergenic
1190254714 X:48753892-48753914 AGGTCACAGCAGCTGCAGTGTGG - Intergenic
1191208717 X:57862203-57862225 CAGCCACTGCAAAAGCAGTTTGG + Intergenic
1194864896 X:99053806-99053828 CAGTCACAGCTGGAGCAGCTGGG - Intergenic
1195528637 X:105924872-105924894 CAGTGAAAGAAGAGGCAGTGAGG + Exonic
1197323664 X:125065158-125065180 CAGTCAAAGCAAAAGCAGACAGG + Intergenic
1198871522 X:141180761-141180783 GACTCACAACAGAAGCAGTCAGG + Intergenic
1199113300 X:143959576-143959598 CAGCCACAGCTGAAGCAGCTGGG + Intergenic
1199600806 X:149540183-149540205 CAGCCACAGGAGAAGCAGGTCGG - Intergenic
1199649676 X:149939398-149939420 CAGCCACAGGAGAAACAGGGCGG + Intergenic
1200166454 X:154039008-154039030 CAGGCACAGCGGAAGCACAGGGG + Intronic
1201529515 Y:14976811-14976833 TAGTCTTAGCAGAAGCATTGTGG + Intergenic
1201649591 Y:16270690-16270712 CAATCACAGCAGAAGGAGAAAGG - Intergenic