ID: 1135842601

View in Genome Browser
Species Human (GRCh38)
Location 16:25890310-25890332
Sequence GAGGCATCACACACCCATCA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 109
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 106}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1135842592_1135842601 29 Left 1135842592 16:25890258-25890280 CCGACTCTAAATGTTGTCCTCTT 0: 1
1: 0
2: 1
3: 20
4: 269
Right 1135842601 16:25890310-25890332 GAGGCATCACACACCCATCAAGG 0: 1
1: 0
2: 0
3: 2
4: 106
1135842593_1135842601 12 Left 1135842593 16:25890275-25890297 CCTCTTAGCCACCACTATGTATT 0: 1
1: 0
2: 0
3: 11
4: 122
Right 1135842601 16:25890310-25890332 GAGGCATCACACACCCATCAAGG 0: 1
1: 0
2: 0
3: 2
4: 106
1135842594_1135842601 4 Left 1135842594 16:25890283-25890305 CCACCACTATGTATTTCCTTCCA 0: 1
1: 0
2: 2
3: 21
4: 224
Right 1135842601 16:25890310-25890332 GAGGCATCACACACCCATCAAGG 0: 1
1: 0
2: 0
3: 2
4: 106
1135842595_1135842601 1 Left 1135842595 16:25890286-25890308 CCACTATGTATTTCCTTCCATAG 0: 1
1: 0
2: 2
3: 12
4: 217
Right 1135842601 16:25890310-25890332 GAGGCATCACACACCCATCAAGG 0: 1
1: 0
2: 0
3: 2
4: 106

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1135842601 Original CRISPR GAGGCATCACACACCCATCA AGG Intronic
900990771 1:6097198-6097220 GAGGCAAGGCAGACCCATCAGGG + Intronic
904269005 1:29336802-29336824 GAGGTATCACAGCCCCATTAGGG + Intergenic
904676142 1:32200459-32200481 TAGACATCACACAACCAACAGGG + Exonic
904889119 1:33764638-33764660 GAGGAAGCTCACACCGATCACGG + Intronic
905059678 1:35129130-35129152 CAGCCATCACACACACATCTTGG + Intergenic
905974779 1:42166206-42166228 TTGGCTACACACACCCATCAGGG - Intergenic
908761394 1:67515488-67515510 CAGCCATCACACACACACCAAGG - Intergenic
916017903 1:160766610-160766632 CAGGCATCACACATCTATCGAGG - Intergenic
918958033 1:191236263-191236285 GTGGCAGCACTCAACCATCAAGG + Intergenic
923986233 1:239386355-239386377 GGGGCCTCACCCACCCAGCATGG - Intergenic
1071399513 10:85255888-85255910 GACACTTCACACACCCATCATGG + Intergenic
1071663077 10:87525723-87525745 GGGACATCACACACCTGTCATGG - Intronic
1073845702 10:107551442-107551464 GGAACATCACACACCCGTCAGGG + Intergenic
1075517334 10:123119347-123119369 GAGGCATGACTCGTCCATCAGGG + Intergenic
1076467575 10:130695249-130695271 GAGACTTCACACAGCCATCTTGG + Intergenic
1076503490 10:130955705-130955727 GAGACACCACACACCCACTAGGG - Intergenic
1083154071 11:60811614-60811636 AAGGCACCACACACACAACAAGG - Intergenic
1085864886 11:80279449-80279471 GAGGCATCTCCCAACCATCCAGG - Intergenic
1087256650 11:95963531-95963553 GAAGAACCACACAGCCATCATGG + Intergenic
1089640396 11:119843993-119844015 GAAGCAGCACACACCAAGCAGGG + Intergenic
1097185526 12:57194440-57194462 GCGCCATCACACACCCAGCTGGG - Exonic
1097987821 12:65802998-65803020 GAGAAAGCCCACACCCATCAAGG + Intergenic
1107983110 13:45752277-45752299 GAGGCATCAGACACTCAGTAGGG - Intergenic
1113156580 13:107329672-107329694 GGAACATCACACACACATCAGGG - Intronic
1113742732 13:112722570-112722592 GAGGCATCCGAGTCCCATCAGGG + Intronic
1125769196 15:42153882-42153904 GAGGGAACACACAGCCCTCAAGG + Intronic
1126565504 15:50094199-50094221 GATGAATCCCACACACATCAGGG - Intronic
1129238101 15:74235761-74235783 GTGCCATCACTGACCCATCATGG + Intergenic
1130022258 15:80241491-80241513 GAGGCATCAGAAACCCAAAAGGG - Intergenic
1131448474 15:92519131-92519153 GAGGCAGCACTCTGCCATCAGGG + Intergenic
1135842601 16:25890310-25890332 GAGGCATCACACACCCATCAAGG + Intronic
1141854216 16:86670089-86670111 GATGCATCACGCATCCACCACGG - Intergenic
1143593895 17:7902747-7902769 CAGGCCTCCCACACCCACCAGGG - Intronic
1146565252 17:33907290-33907312 AAGACATCCCACTCCCATCAGGG - Intronic
1152144342 17:78559297-78559319 GTGACATCTCACACCCAACAAGG + Intronic
1152889309 17:82871411-82871433 GTGGGCTCACACACCCATGACGG - Intronic
1157517497 18:48321227-48321249 GTGGCATGACACACCCACAAGGG - Intronic
1157913780 18:51644462-51644484 CAGGCTTCACACACCCTGCAGGG - Intergenic
1158538204 18:58327453-58327475 GAGGCATAACTGCCCCATCAAGG + Intronic
1160307494 18:77753702-77753724 AAGGCATCCCACACCCCTCCAGG - Intergenic
1162335704 19:10058959-10058981 GAAGCATCCCACACCCACTAGGG - Intergenic
1163256596 19:16159749-16159771 GAGGCATCACAGGGCCATGATGG + Intergenic
1165939952 19:39410042-39410064 GAGGCTTCGCACACCGACCAGGG + Intergenic
1166887886 19:45972946-45972968 GTCACATCACACACCCCTCAAGG + Intronic
1167312575 19:48745697-48745719 GAAGCATCACAAAGCCATGATGG - Exonic
1168271964 19:55254951-55254973 CCGGCATCACCCACCCAGCAAGG + Intronic
1168448769 19:56446523-56446545 GTGGCATAACATACCCAGCAGGG - Intronic
927097093 2:19755604-19755626 GAGGCCTCCCACATCAATCAAGG - Intergenic
935062883 2:99623506-99623528 AGGGCATCACACGCCCATCCTGG - Intronic
940097717 2:149996812-149996834 GAGGCATCTCACAACAGTCAAGG - Intergenic
940489382 2:154338539-154338561 GAGGCATGACACACCATGCAGGG + Intronic
944458569 2:199920237-199920259 GAGGCACCAGACACCCCTCTAGG - Intronic
1170929116 20:20752866-20752888 ATGGCATCACACACCAATTATGG - Intergenic
1172930699 20:38584329-38584351 GAAGCCACACACACCCTTCAAGG + Intronic
1177120461 21:17132045-17132067 AGGGCACCACACTCCCATCATGG + Intergenic
1179906824 21:44426923-44426945 GAGGGATCACCCCCCCACCAAGG - Intronic
1182236960 22:28883667-28883689 GACGCCTCACAGCCCCATCACGG - Exonic
1184229140 22:43148977-43148999 GAGGCAGCACACCCCCAGCTGGG - Intergenic
1184458974 22:44626429-44626451 AAGGCAGCACACACCCACCTGGG + Intergenic
949600224 3:5590264-5590286 GGGGCATCATAGGCCCATCAGGG + Intergenic
950279420 3:11693690-11693712 GAGCCATCACACACACAAGAGGG + Intronic
950900365 3:16492126-16492148 GTGGCATGACTGACCCATCAAGG + Intronic
951157139 3:19369473-19369495 GCTGTATCACACACTCATCATGG + Intronic
954297946 3:49684592-49684614 GAGGCACCACATACCATTCAGGG + Exonic
954710769 3:52504147-52504169 GTGGGGTCACGCACCCATCATGG - Exonic
954733917 3:52689065-52689087 GAGGCTTCAATCACCTATCAAGG - Exonic
955595086 3:60580833-60580855 CAGGCATCACTCATCAATCATGG - Intronic
960013274 3:112856605-112856627 GAGGCAAGACAGACCCATCTAGG + Intergenic
961432752 3:126894634-126894656 GTGTGAGCACACACCCATCACGG + Intronic
962629049 3:137257691-137257713 GAGGCAGCAGTCACCCACCAAGG + Intergenic
962953931 3:140247042-140247064 GAGACTTCATAAACCCATCAGGG - Intronic
963110893 3:141687036-141687058 GACGCATCCCACGCCCATCCTGG + Intergenic
966726753 3:183115508-183115530 GAGACAACACACACCCAAAATGG - Intronic
968611915 4:1561089-1561111 GAGGCTTCTCACACTCAACATGG - Intergenic
974397638 4:61359413-61359435 GAGGGATCAGACAGCCAACAAGG - Intronic
979540673 4:121877472-121877494 GAGGCATCACATCCCGAGCAAGG + Intergenic
986208582 5:5648806-5648828 GAGATATCACACACACAGCATGG - Intergenic
987304647 5:16625795-16625817 GAGGAATCAAACAGCCGTCATGG - Intergenic
991645919 5:68800193-68800215 GCCTCATCACACACCTATCAGGG + Intergenic
992811306 5:80391304-80391326 GGAGCATCACACACCAGTCATGG - Intergenic
997097364 5:130928272-130928294 GAGGCATCACACCACCTCCAAGG + Intergenic
998359409 5:141572463-141572485 CAGGCATCTCAAACACATCATGG + Intronic
1001659568 5:173380783-173380805 GAGGAAGCACCCACCCTTCATGG - Intergenic
1002011968 5:176290564-176290586 GAGACATGCCACACTCATCAGGG + Intronic
1002215796 5:177631733-177631755 GAGACATGCCACACTCATCAGGG - Intergenic
1003348669 6:5294989-5295011 GAGGCCTAAAACACCCAACATGG + Intronic
1003638524 6:7856963-7856985 GACAAACCACACACCCATCAAGG - Intronic
1006388397 6:33744988-33745010 GAGGCCTCACCCACCCACCAGGG - Intronic
1008705347 6:54151722-54151744 GTGGCATAAGATACCCATCATGG - Intronic
1008747565 6:54691275-54691297 GAGCCACCACACACCCAGCTGGG + Intergenic
1011584332 6:88908602-88908624 GGGGCACCACACTCCCACCATGG + Intronic
1012937587 6:105384225-105384247 CTGGCATGACTCACCCATCAGGG + Intronic
1013650651 6:112191472-112191494 TATGCATCCCAAACCCATCAGGG - Intronic
1024352494 7:48381133-48381155 GAGGCATGACACACCACACAGGG - Intronic
1027417124 7:77985409-77985431 GAGGGAGCACACCCCCACCACGG + Intergenic
1032278941 7:130485851-130485873 CAGGCATCACATACTCAACAAGG - Intergenic
1039452057 8:37683109-37683131 GAGACATCACGCAGGCATCATGG + Intergenic
1040315573 8:46259134-46259156 GGGGCATTACAGACCCATCCAGG - Intergenic
1043270408 8:78326326-78326348 GAAGCATCACACAACCAGAAGGG + Intergenic
1047059472 8:121208252-121208274 GACGAATCACATACCCTTCATGG + Intergenic
1048743489 8:137587987-137588009 AAGGAATCACACACAAATCAAGG - Intergenic
1049498949 8:142950974-142950996 GAGACATCAAACAGCCAGCAGGG - Intergenic
1051219619 9:14834214-14834236 GAGGGATGAGACTCCCATCAGGG + Intronic
1062427261 9:136511732-136511754 CAGGCAGCAAACGCCCATCACGG + Intronic
1190214546 X:48470755-48470777 GACCCATCACAGCCCCATCAAGG + Intergenic
1192014604 X:67315921-67315943 GAGGCATCACCCACCTCCCATGG + Intergenic
1192325386 X:70127911-70127933 AAGCCATCACACACCTATTAGGG + Intergenic
1192396812 X:70790423-70790445 GAGTCAACACACTCCCACCACGG + Intronic
1195373980 X:104207580-104207602 CAGGCATCCCAGACCCATAAAGG - Intergenic