ID: 1135842718

View in Genome Browser
Species Human (GRCh38)
Location 16:25891341-25891363
Sequence CTGTGGGTCAGGCATTTAGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 289
Summary {0: 1, 1: 1, 2: 6, 3: 45, 4: 236}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1135842711_1135842718 29 Left 1135842711 16:25891289-25891311 CCAGTACGAAACCTAGTGGCTTG 0: 1
1: 0
2: 0
3: 3
4: 33
Right 1135842718 16:25891341-25891363 CTGTGGGTCAGGCATTTAGGAGG 0: 1
1: 1
2: 6
3: 45
4: 236
1135842712_1135842718 18 Left 1135842712 16:25891300-25891322 CCTAGTGGCTTGAAATGACTATT 0: 1
1: 0
2: 0
3: 16
4: 159
Right 1135842718 16:25891341-25891363 CTGTGGGTCAGGCATTTAGGAGG 0: 1
1: 1
2: 6
3: 45
4: 236

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1135842718 Original CRISPR CTGTGGGTCAGGCATTTAGG AGG Intronic
900412427 1:2518836-2518858 CTCTGCGTCAGGCATGTGGGTGG + Intronic
901331396 1:8411662-8411684 TTGTAGATCAGGAATTTAGGTGG - Intronic
901529462 1:9844122-9844144 CTGGGGTTCAGGCAATAAGGGGG - Intergenic
901535610 1:9881155-9881177 CTGTGGTTCAGCCATGCAGGAGG - Intronic
902127380 1:14227289-14227311 CTATGGGTCAGGAATTCAGAAGG + Intergenic
902263023 1:15241096-15241118 CTGTGGGTCAGGAATTGGGCAGG - Intergenic
902888860 1:19426759-19426781 CTGTGGGTCAGGAGTTCAGGAGG - Intronic
903379335 1:22885949-22885971 CTTTGGGTCAGGCACTAAGCTGG + Intronic
903814949 1:26058096-26058118 CTGTAGGCCAGGCACTGAGGTGG - Intronic
904675562 1:32197262-32197284 GTGTGAGTCAGGCAATTATGTGG - Exonic
905952201 1:41961299-41961321 ATGTGGGTCAGGGATTCAGGTGG - Intronic
908118051 1:60960525-60960547 CTGCAGGTCAGGCATTGGGGTGG + Intronic
908600418 1:65732921-65732943 CTGTGTGTCAGGCATTACGCTGG - Intergenic
910922200 1:92360274-92360296 CTGTGGTCCTGGCAATTAGGTGG + Intronic
912096228 1:106148239-106148261 CTGTAGGTCAAGAATTTGGGCGG - Intergenic
912385726 1:109270345-109270367 CTTCGGGTCAGGCATGGAGGAGG - Intronic
913479757 1:119276700-119276722 CTGTAGGGCAGGCACTCAGGAGG + Intergenic
915011079 1:152686928-152686950 CACTGGGGCAGGCATTTAGGGGG - Exonic
916571154 1:166028944-166028966 CTGTCGGTCAGGAATTTGGGAGG + Intergenic
917664008 1:177206263-177206285 CTGTGGGTCAGAAATTTGGGTGG - Intronic
918279782 1:182993129-182993151 CTGTAGGTCAGGTATTCAAGTGG + Intergenic
919464051 1:197910935-197910957 TTGTGGGTCAGGCGTGGAGGCGG + Intergenic
920044055 1:203122182-203122204 CTGTGGGTGAGGCCTTTCAGTGG + Intronic
920541751 1:206784117-206784139 GACTGGCTCAGGCATTTAGGAGG + Intergenic
920714535 1:208327324-208327346 AAGAGGGTAAGGCATTTAGGGGG - Intergenic
921034915 1:211367721-211367743 CTTTTGGTCAGGCAGGTAGGTGG + Intronic
921397575 1:214684855-214684877 TTGTTGGTCAGGCATTTTGTAGG + Intergenic
924106892 1:240658196-240658218 CTGTGAGTCAGGAATTCAGGAGG + Intergenic
924486403 1:244487685-244487707 TTGTGGGACAGGGATTAAGGAGG + Intronic
924540000 1:244971144-244971166 CGGCGGGGCAGGCATTTCGGAGG - Intronic
1064519886 10:16189986-16190008 CTGTAGGTCAGACATTTCAGTGG - Intergenic
1065072892 10:22045710-22045732 CTGTGGGTCAGGAATCCAGAAGG - Intergenic
1067551555 10:47240068-47240090 CTCTGGGGCAAGGATTTAGGGGG - Intergenic
1067724880 10:48762511-48762533 CTGTGGGTCAGGGATTCAGAAGG + Intronic
1069862518 10:71480494-71480516 CTGTTGGAGAGGCATTGAGGTGG + Intronic
1071575828 10:86725461-86725483 CTGTGTGTCAGGCATTGTGCTGG + Intronic
1074592946 10:114831112-114831134 CTGTGTGTCAGGCATTGTTGAGG + Intronic
1075724704 10:124605306-124605328 CTCTGGGTCAGGCCTGTGGGGGG + Intronic
1076898287 10:133324972-133324994 CTGTGGGCCACACATCTAGGAGG + Intronic
1079545158 11:21624986-21625008 ATGTGGGTCACGCATTTTGTTGG + Intergenic
1080502117 11:32880737-32880759 CAGTGGCTCAGGCCTTTGGGAGG + Intergenic
1080998880 11:37642518-37642540 CTGAGGATCAGGCCTTCAGGAGG - Intergenic
1081476533 11:43438413-43438435 CTGTGGCTCATGCATTTGGGAGG - Intronic
1081934528 11:46895791-46895813 CTATGGGTCAGGCATTTGAACGG - Intronic
1081991128 11:47338233-47338255 CTGGGGGTGATGCCTTTAGGAGG - Intronic
1084032593 11:66489661-66489683 CTCTGGGTCAGGAATGCAGGTGG + Intronic
1084403972 11:68960546-68960568 GTGTGGGTCAGGCACGGAGGTGG - Intergenic
1085769025 11:79308768-79308790 CTGTGGGTCTCGCACTCAGGAGG - Intronic
1086063046 11:82720104-82720126 CTGAGGGCCAGGCATATAGCAGG - Intergenic
1088190485 11:107222931-107222953 GTGTGATTAAGGCATTTAGGGGG - Intergenic
1088901623 11:114122155-114122177 CTGTATGTGAGGCATATAGGAGG + Intronic
1089348614 11:117808327-117808349 CTATGGGTCAAACCTTTAGGAGG + Intronic
1089422756 11:118343991-118344013 CTGTAGGTAATGAATTTAGGAGG - Intergenic
1091186834 11:133655022-133655044 CTGTGTGTCAGGAAATGAGGAGG - Intergenic
1091775263 12:3180913-3180935 CTGTGTGCCAGGCGCTTAGGTGG + Intronic
1093176617 12:15919935-15919957 CTGTGGGGCAGTCCATTAGGCGG - Intronic
1097650906 12:62296303-62296325 CTGTGGGTCAGTAGTTAAGGAGG - Intronic
1098021358 12:66159530-66159552 CTGAGTGTCAGGAATTTGGGAGG - Intronic
1099501284 12:83417556-83417578 CTATGGGTCATGCATTTATGTGG + Intergenic
1102508894 12:113401207-113401229 CTATGAGTCAGGCATTTTGCTGG - Intronic
1102727363 12:115077498-115077520 CTGTGGGTCAGGAATTTGGATGG - Intergenic
1103429963 12:120875161-120875183 CTGTGGGTTAGGCATTTGGATGG - Intronic
1103731965 12:123033721-123033743 CTGGGGGTCAGGCCTTTTAGGGG - Intronic
1103909291 12:124343257-124343279 CTCTGGGGCTGGCATTTACGGGG + Intronic
1103973440 12:124686796-124686818 CTGTGGGTCTGGAATCTCGGGGG + Intergenic
1106003669 13:25749158-25749180 AGGTGGGCCAGGCATTTGGGAGG + Intronic
1106209787 13:27631145-27631167 CTGTGGGTCAAGAATCTGGGTGG + Intronic
1107630646 13:42339284-42339306 CCTTGGGTCAGGCAAGTAGGAGG + Intergenic
1111971706 13:94923693-94923715 TTGTGGGTCAGGAATTCAGATGG - Intergenic
1112694819 13:101936222-101936244 TCGTGGGTCAGGCATTAAGAAGG - Intronic
1113407496 13:110055190-110055212 CTGTGGATCAGGCATCTTGCTGG - Intergenic
1113811613 13:113146171-113146193 CTGTGTGTCAGGCACTGAGCCGG + Intronic
1114393562 14:22336462-22336484 CTCTGGGTCAGAAATTGAGGTGG - Intergenic
1117142381 14:52802657-52802679 ATGTGGGTAAGCCAATTAGGAGG + Intergenic
1117928516 14:60812343-60812365 CTGTGGGTTAGGAATTTAAGTGG + Intronic
1118287815 14:64492461-64492483 CGGTGGCTCATGCCTTTAGGAGG - Intronic
1118752096 14:68814967-68814989 CTGTGGGTGAGGCATGAACGGGG + Intergenic
1119853244 14:77881152-77881174 CTTTGGGTCAGGAATTTGGGAGG + Intronic
1122260763 14:100520770-100520792 GTATGTGTCAGGCATTTAGCTGG + Intronic
1122260924 14:100522624-100522646 GTATGTGTCAGGCATTTAGCTGG + Intronic
1123034274 14:105465518-105465540 CTGAGGGTCTGGGGTTTAGGTGG + Intronic
1123785695 15:23669979-23670001 ATGTGTGTGAGGCATTTAGTAGG + Intergenic
1124399396 15:29335117-29335139 CTGTGAGTGAGGAATTTAGCAGG - Intronic
1125310324 15:38372098-38372120 CTGTGGGTCTGGAATTCAGGAGG - Intergenic
1126197696 15:45950305-45950327 GTGTGGGTCCTGCATTTGGGTGG + Intergenic
1126360517 15:47841074-47841096 CCGTAGCTCCGGCATTTAGGGGG - Intergenic
1127982533 15:64045692-64045714 CTCTGGGCTAGGCATTTTGGAGG - Intronic
1128175374 15:65550687-65550709 CTGTGGGTTAGGACTTCAGGAGG + Intronic
1128819299 15:70637753-70637775 GTGTGGGTCATACATTTATGTGG - Intergenic
1128828364 15:70742907-70742929 CTGTAGGTCAGAAGTTTAGGTGG + Intronic
1128869373 15:71141237-71141259 CTGTGGGTCAGGCACTGTGCTGG + Intronic
1130076893 15:80696595-80696617 CTGTGGGGCAGGAAGTTAGCTGG + Intronic
1131244940 15:90782722-90782744 CTGGGGGTTAGGATTTTAGGGGG + Intronic
1133838809 16:9389846-9389868 CTGTGGGTCAGGAATCAGGGTGG - Intergenic
1134745880 16:16587855-16587877 ATGTGGGTCTGGCATTGGGGAGG + Intergenic
1134999599 16:18765887-18765909 ATGTGGGTCTGGCATTGGGGAGG - Intergenic
1135842718 16:25891341-25891363 CTGTGGGTCAGGCATTTAGGAGG + Intronic
1136186491 16:28591567-28591589 CTGTGGGGCAGGCAGACAGGAGG - Intronic
1136188976 16:28604291-28604313 CTGTGGGGCAGGCAGACAGGAGG - Intergenic
1137420133 16:48326326-48326348 CTGTGGGTTAGGGATGGAGGAGG - Intronic
1138648720 16:58444695-58444717 TTCTGGGTCAGGCATTTAGGTGG - Intergenic
1138729435 16:59178580-59178602 CTGTGGGTCAGACATTCAACAGG + Intergenic
1139396184 16:66640997-66641019 CTGTGTGTCAGGAATTTGGGGGG - Intronic
1140312712 16:73865178-73865200 CTGTGGGTCAACAATTTTGGTGG - Intergenic
1142145262 16:88490374-88490396 CTGTGTGCCAGGCATATAGCCGG + Intronic
1145883560 17:28368266-28368288 CTGTGGCTGAGGAGTTTAGGGGG - Intronic
1147917169 17:43895557-43895579 CTATGTGTCAGGCATTTTGTAGG + Intronic
1148178794 17:45588560-45588582 CTGTGGGTCAGGAATCTGGGAGG - Intergenic
1148270362 17:46257889-46257911 CTGTGGGCCAGGAATCTGGGAGG + Intergenic
1148513292 17:48191949-48191971 CTGAGGGTGAGGCATTGAGTGGG + Intronic
1149693186 17:58595770-58595792 CTGTGGGTCAGGAATTTGACAGG - Intronic
1149780884 17:59395595-59395617 CTGGGGGCCTGGCAGTTAGGTGG + Intronic
1149984173 17:61334847-61334869 CAGTGGGTCAAGCATTTACTGGG - Intronic
1150766559 17:68007045-68007067 CTGTGGGCCAGGAATCTGGGAGG - Intergenic
1150782060 17:68132091-68132113 CTGTGTGTCAGGCATTTTTCAGG - Intergenic
1155511704 18:26584570-26584592 CTATGTGTCAGGCATTGAGCTGG + Intronic
1155742311 18:29303788-29303810 CTCTGCCTCAGGCATTTAGAAGG + Intergenic
1157888706 18:51394120-51394142 CTGTGGGTCAGGAATTTGGGAGG + Intergenic
1157967094 18:52220616-52220638 CTGTGGGTCAGGAAGTTGGCTGG - Intergenic
1158603010 18:58870937-58870959 CTGTGAGTCTGGAATTTAGGAGG + Intronic
1158812801 18:61057187-61057209 CTGTGTGTCCTGCATTTAGTTGG - Intergenic
1159381738 18:67668864-67668886 CTGGGGTTCAGGCCTTTGGGAGG + Intergenic
1162432799 19:10639262-10639284 CTGTGTGTCAGGCATCGAGGTGG + Intronic
1166190621 19:41174233-41174255 CGGTGGCTCAGGCCTTTCGGAGG - Intergenic
1166872857 19:45881466-45881488 CTGGGGGTCAGGCTTCTTGGAGG + Intergenic
1167142483 19:47661525-47661547 GTGTGGGGCAGGCATATAGGAGG + Intronic
1167358153 19:49016493-49016515 CTGTGGGTCTGGCCCTGAGGTGG + Intronic
1167359648 19:49023383-49023405 CTGTGGGTCTGGCCCTGAGGTGG + Intronic
1167361483 19:49032702-49032724 CTGTGGGTCTGGCCCTGAGGTGG - Intronic
1167362171 19:49036083-49036105 CTGTGGGTCTGGCCCTGAGGTGG + Intronic
1167363913 19:49044775-49044797 CTGTGGGTCTGGCCCTGAGGTGG - Intronic
1167364585 19:49048152-49048174 CTGTGGGTCTGGCCCTGAGGTGG + Intronic
1167365870 19:49054788-49054810 CTGTGGGTCTGGCCCTGAGGTGG + Intronic
926530075 2:14033225-14033247 CTGTGGGTCAGAAATTAGGGAGG - Intergenic
927810830 2:26179469-26179491 CTGTGGGGCAGGCATGGAGAAGG + Intronic
928134868 2:28680640-28680662 CTCTGGGCCAGGCATTTAACAGG - Intergenic
928624507 2:33125895-33125917 CTGTGGTTCAGGAATTTAGAGGG + Intronic
929626672 2:43415749-43415771 CGGTGGGTCAGGCAAGGAGGAGG + Intronic
930373452 2:50534041-50534063 CTGTGGGCCTGGCATTGTGGGGG - Intronic
932609173 2:73186142-73186164 CTGGGGGTCAGGAATTTGGGCGG + Intergenic
935074616 2:99728863-99728885 CTGTGGTGCACTCATTTAGGAGG + Intronic
935812108 2:106808579-106808601 CTGTGATTCAGGCATTCGGGTGG + Intronic
936715392 2:115181353-115181375 CTGTTGGTCAGGAGTTCAGGTGG + Intronic
937637557 2:124173209-124173231 TTGTGTGTCAGGCAATAAGGAGG - Intronic
939269258 2:139916606-139916628 CTATGGGTGAGGCCTTTAAGAGG + Intergenic
939295531 2:140259139-140259161 CTGTGCTTCAGGCATTTGAGTGG - Intronic
939878634 2:147605274-147605296 ATTTGGGTCAGGAATTTGGGAGG - Intergenic
940320409 2:152370857-152370879 CTATGGGTCAGGAATTTGGGTGG + Intronic
940753912 2:157659995-157660017 GTATGTGTCAGGCATTTATGCGG + Intergenic
941023580 2:160436486-160436508 CTGTGGCTCAGGAATTTGGAGGG - Intronic
941904636 2:170708875-170708897 CAGTGGGTAAGGCTTTTTGGTGG - Intergenic
942191616 2:173476174-173476196 CTGTGGGTCAGAAATTCATGAGG - Intergenic
942543718 2:177041025-177041047 CTGTGTGTCAGGTTTTTAGAAGG - Intergenic
943420655 2:187663979-187664001 CTGTGGGTTAGGCCTCTAGCAGG - Intergenic
944500573 2:200355153-200355175 CAGTGGCTCTGGCATTGAGGGGG - Intronic
944738412 2:202589244-202589266 CTCTGGGACAGGCATTTCTGTGG - Intergenic
944939179 2:204604832-204604854 TTGTGGGTCAGGAATTTGGATGG + Intronic
945100382 2:206257668-206257690 CTGTGGGCCAAGCCTTTAGAAGG + Intergenic
947126900 2:226878719-226878741 CTGTGGGTCAGGAATTCAGAAGG - Intronic
948403665 2:237702055-237702077 CTGTGGGGCTGGCATTAATGTGG + Intronic
1169625718 20:7566072-7566094 CTGTGGGACAGGTATTTTGCTGG - Intergenic
1170157071 20:13278707-13278729 CTGTGGGTCAGGAATTTGACTGG + Intronic
1170420160 20:16184640-16184662 CTGTGGGTCAGAGATTTGGGTGG - Intergenic
1170455680 20:16530644-16530666 CTGTGGGTCAGGAATCTGGGTGG - Intronic
1170512836 20:17096685-17096707 CTGTGGGTCAGGGGTTTGGATGG - Intergenic
1170757429 20:19216824-19216846 CTTTGGGTCAGGAATTTGGATGG + Intronic
1171348069 20:24481253-24481275 CTGTGGGTCAGGAATTTGAAAGG + Intronic
1171394095 20:24819867-24819889 CTGTGGGTAAGGAATTTGGAAGG - Intergenic
1171979785 20:31619532-31619554 CTGTGGGTCAGGGATTAAAGTGG - Intergenic
1172240134 20:33407727-33407749 CTGTGGGTCAGAAATTTGAGAGG - Intergenic
1172756399 20:37288068-37288090 CTGTGAGGCAGGCATTCAAGTGG + Intergenic
1172809859 20:37639667-37639689 CTGTGGATCAGGGATTCAGAAGG + Intergenic
1173270658 20:41531846-41531868 GTGTTGGTCAGGCATGAAGGAGG - Intronic
1173363095 20:42361802-42361824 CTGTGGGTCAGGAATGCAAGAGG - Intronic
1173745494 20:45433617-45433639 CTGTAGGTCTGGAATTCAGGCGG - Intergenic
1175518961 20:59587558-59587580 CTGTGGGTCAGGGGTGCAGGTGG + Intronic
1175603523 20:60294335-60294357 CTGGGGGACAGACCTTTAGGTGG + Intergenic
1175693682 20:61085003-61085025 CTGTGGATCAGGGATCCAGGTGG - Intergenic
1175749245 20:61483816-61483838 CTGTGGGTCAGCAATTTCGACGG - Intronic
1177199975 21:17943333-17943355 CTGTAGGGCAGGCTTTGAGGAGG - Intronic
1178257181 21:31064825-31064847 CTGTGGGTCAGGAATTCACAAGG - Intergenic
1182534974 22:30994208-30994230 CTGTGGGTCAGGAATTGGGCAGG + Intergenic
1182618668 22:31605724-31605746 CTGTGGTTCAGGTACTTGGGAGG + Intronic
1184171391 22:42761759-42761781 CTGGGGGTCTGGCATCTATGGGG - Intergenic
1184601741 22:45547887-45547909 CTCTGAGTCAGGGATATAGGTGG - Intronic
1184792416 22:46708217-46708239 CTGTGAGTCTGGAATTTGGGTGG + Intronic
1184825302 22:46946545-46946567 CTGTGGATGAGGCAGTGAGGCGG - Intronic
1185214820 22:49592701-49592723 CTATTGGTCAGACACTTAGGTGG - Intronic
1185266241 22:49905853-49905875 CTTTGGGGCAGGCACTTAGGAGG - Intronic
949837154 3:8281427-8281449 CTGTGGGCCAGGCCTAGAGGTGG - Intergenic
953087323 3:39682785-39682807 CTTTAGGTCAAGCATCTAGGAGG + Intergenic
953328256 3:42030747-42030769 TTGTTGGTCAGGCAGTTAGTAGG + Intronic
954396677 3:50296821-50296843 CTGTGGGGAAGGCATTAAGCAGG + Exonic
955416835 3:58700108-58700130 CTCTTGGTCAGGAATTTGGGAGG + Intergenic
955852309 3:63233865-63233887 CTTTGGGTCAGGCATATAATTGG - Intronic
956441019 3:69280336-69280358 CTGTGGGTCAAGCATTTCAGAGG - Intronic
957252713 3:77794233-77794255 CTGTGGGTCAGGAATTTAGGGGG - Intergenic
959002203 3:100977344-100977366 CTGTGGATCAGGTACTTGGGAGG + Intronic
960525081 3:118700708-118700730 CTGTAGGTCAGAAATCTAGGTGG + Intergenic
961996989 3:131256653-131256675 CTGTAGGTCATGAATTTAGGAGG + Intronic
962319095 3:134376255-134376277 CTGTCTTTCAGGCATTTGGGAGG + Intergenic
962769386 3:138598469-138598491 CTGTGGGTCAGGAATACAGTAGG + Intergenic
963001743 3:140688058-140688080 CTGTGGGTCAGGCCTGTAGGTGG - Exonic
963970752 3:151426937-151426959 CTGTAGTTCAGCTATTTAGGAGG - Intronic
967560255 3:190909427-190909449 CTGTGCGCCAGACATTCAGGAGG - Intergenic
967830535 3:193915619-193915641 CTGTGGTTGAGGCTTTAAGGTGG - Intergenic
968439007 4:612212-612234 CTGTGGCTCAGGCATTGGGGAGG + Intergenic
968976692 4:3825790-3825812 CTGTGGGGCAGAAATTCAGGAGG - Intergenic
969683277 4:8655244-8655266 CTGGGGGTTAGGAATTTGGGGGG + Intergenic
970891439 4:21049311-21049333 CTGTGGGTCAAGGATTTGGAGGG - Intronic
970912564 4:21294249-21294271 CTGGTGCTCAGGCATTCAGGAGG - Intronic
971198435 4:24491407-24491429 TTATGTGTCAGGCATATAGGTGG - Intergenic
974658198 4:64852690-64852712 TTGTAGGTGAGGCCTTTAGGAGG + Intergenic
975296508 4:72740585-72740607 TTGTGGGTCAGGAATTTGAGAGG - Intergenic
977635301 4:99291537-99291559 CTGTGTGTCAGGCACTAAGCTGG + Intergenic
979721856 4:123909647-123909669 CTGTGGCTCAGGAATTTGGAAGG + Intergenic
980119270 4:128710841-128710863 ATGTGGGGCAGGCATTGGGGTGG + Intergenic
981039896 4:140213418-140213440 CTGTGGGTCAGGAGTCTGGGTGG + Intergenic
981118979 4:141026505-141026527 CTGTGGCCAAGGAATTTAGGTGG + Intronic
981338775 4:143596263-143596285 GTGTGGGCCATGAATTTAGGAGG + Intronic
981675532 4:147339004-147339026 CTGTAGGTCAGGAATTTGGGAGG + Intergenic
982342547 4:154317398-154317420 CTGTCAGTTGGGCATTTAGGTGG + Intronic
983399628 4:167246406-167246428 CTGTGGGTCAGGAATTCAGGAGG - Intergenic
983714771 4:170767184-170767206 TTGTGGATGAGGAATTTAGGAGG + Intergenic
985347587 4:189022900-189022922 CTGTGGATCAGGAATTCTGGTGG - Intergenic
987053248 5:14166113-14166135 TTGTGGGGCAGGAATTTAGGGGG + Intronic
994745546 5:103673795-103673817 CTGTGGGTCAGCCTTTTACTTGG + Intergenic
996117389 5:119633598-119633620 CTGCAGGTCATGCATTTGGGTGG - Intronic
997969730 5:138391456-138391478 CTGGGGTACGGGCATTTAGGAGG - Exonic
998078530 5:139255860-139255882 CTGAGGGTCAGGAATTCAGGAGG - Intronic
998533570 5:142908270-142908292 CTGTGGGTCACGAATTCAGGGGG + Intronic
1004059541 6:12179146-12179168 TTGTGGGACAGGCAATCAGGAGG + Intergenic
1004320989 6:14631296-14631318 CTGTGGGTCAGGCATTCAGCAGG + Intergenic
1005799024 6:29400303-29400325 CTGTGGGTCAGAAATTGGGGAGG + Intronic
1006881451 6:37343574-37343596 CTGTGGGTCAGGGATTCAGGTGG + Intergenic
1007096267 6:39215117-39215139 CTCTGGGCCATGCATTTGGGTGG + Intronic
1008728510 6:54451696-54451718 CTGTGGCTTAGGCAATTAGTTGG + Intergenic
1010589141 6:77692405-77692427 CTGTGTGTCAGGCTTTGAGCTGG - Intronic
1014644124 6:123953389-123953411 CCGTGGGCCAGGCAGTTTGGTGG + Intronic
1016738644 6:147507231-147507253 CTGTGTGTTTGGCATTTGGGTGG - Intergenic
1018134418 6:160765871-160765893 CTGTTGGCCAGGCATTAAGTTGG - Intergenic
1019951684 7:4378310-4378332 CTGTGGGTCATGAATTCAGGAGG + Intergenic
1022892298 7:34713996-34714018 CTGAGGGTCAAGAATTTAAGTGG + Intronic
1024996434 7:55276161-55276183 TTGTGGGTCAGGAATTCAGGAGG - Intergenic
1027551884 7:79608458-79608480 CTGTAAGTCAGGAATTTGGGAGG - Intergenic
1028098738 7:86794549-86794571 CTGAGGATCAGGCATTGAGAAGG + Intronic
1028542378 7:91956440-91956462 TTGTTTGTCTGGCATTTAGGAGG - Intronic
1030536515 7:110773326-110773348 CTGTGTCTCAGCCAATTAGGAGG - Intronic
1031059367 7:117032959-117032981 CTTTGGGTCAGGCAGATAAGGGG + Intronic
1031327201 7:120416587-120416609 CACTGGGTCAGGCATATAGTAGG - Intronic
1031454737 7:121965172-121965194 CTGTGGGTCAGGAGCTGAGGAGG + Intronic
1031615315 7:123872669-123872691 CTGTGGCTCAAGCTTTCAGGTGG + Intronic
1033215588 7:139491153-139491175 CTGTGGCTCAGGGATATGGGGGG + Intergenic
1033548571 7:142424905-142424927 CTGAGGTTCAAGCATTTAGCAGG + Intergenic
1034526632 7:151667875-151667897 CTGTGGGTCAGCAATTTGGGTGG - Intronic
1035165277 7:156985717-156985739 CTGTGGGCCAGGCATGGAGGCGG - Intergenic
1036006886 8:4674834-4674856 CTGGAGGTGGGGCATTTAGGAGG + Intronic
1037658542 8:20907780-20907802 CTCAGTGTCAGGCATTTTGGTGG + Intergenic
1038514057 8:28169345-28169367 CTGTGGGTCAGAAATTCAGCAGG + Intronic
1040773240 8:51005728-51005750 CTGTGGGTTTGGCATCTATGGGG - Intergenic
1041504997 8:58586925-58586947 CTGTGCTTCAGGCACTTTGGCGG - Intronic
1041830861 8:62151743-62151765 TTGTGGGTCAGGAATTTGGCAGG + Intergenic
1041979093 8:63835073-63835095 CTGTGGGACAGACTTTTAAGTGG + Intergenic
1042303220 8:67308207-67308229 CTGTGTGTCAGGAATTCAGATGG - Intronic
1044642158 8:94394493-94394515 CTGAGTGTCAGGCATTTTGCTGG - Intronic
1045055203 8:98362742-98362764 CTGTGTGATAGGAATTTAGGTGG - Intergenic
1046516443 8:115267916-115267938 CTGTGGGTCAGTAATTCAGGAGG - Intergenic
1047513387 8:125532487-125532509 CTGTGGGTCAGGAATCTGGGTGG + Intergenic
1048559387 8:135516716-135516738 CTGTTGATAAGACATTTAGGTGG + Intronic
1049483698 8:142840292-142840314 CAGTGGGGGAGGCATTCAGGTGG + Intronic
1050821651 9:9886976-9886998 TTGTGGATCAGGAATTTGGGAGG - Intronic
1050877085 9:10651819-10651841 CAGTGGGTCAGGCTTTCAGGTGG - Intergenic
1052108902 9:24554882-24554904 CTGGTGGACAGGCACTTAGGGGG + Intergenic
1053273394 9:36765684-36765706 CTGTGGGACAAGCATCCAGGAGG + Intergenic
1055407450 9:75989526-75989548 CTGAGGGTCAGGAATTCAGACGG + Intronic
1059306670 9:113358836-113358858 CTGTGGGTAAGGCATTAAAGTGG + Intronic
1059914508 9:119084302-119084324 TTGTGGGTCAGGAAGTTGGGCGG + Intergenic
1060486943 9:124053869-124053891 ATGTGTGTCAGGCCTTTTGGTGG + Intergenic
1062703116 9:137918435-137918457 CTGTGGGTCAGGAATCTGGGAGG + Intronic
1187289426 X:17939027-17939049 CTGTGAGCCAGGTATTCAGGCGG + Intergenic
1187340736 X:18419408-18419430 CTGAGTGTCAGGAATTCAGGAGG + Intergenic
1187572775 X:20521676-20521698 CAGTGGGTCAGGAATTCAGGTGG + Intergenic
1189874717 X:45423791-45423813 ATCTGGGTCAGGGATTTGGGTGG - Intergenic
1189908457 X:45785401-45785423 CTCTGAGTGAGGCATTTAGGAGG - Intergenic
1191255897 X:58279532-58279554 CAGGGGGTCAGTCATTCAGGGGG - Intergenic
1195399839 X:104449384-104449406 CAGTGGGTCTGGCATATAGTAGG + Intergenic
1197858501 X:130945262-130945284 CTGAGGGTTAGGAATTCAGGAGG + Intergenic
1198620506 X:138503387-138503409 CTGAGGGTCAGTAATTTAAGAGG - Intergenic
1199033358 X:143026431-143026453 CTCATGGTCAGGCAGTTAGGCGG + Intronic