ID: 1135845544

View in Genome Browser
Species Human (GRCh38)
Location 16:25915105-25915127
Sequence AGCAGACATGTGGCCACATC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 291
Summary {0: 1, 1: 0, 2: 2, 3: 30, 4: 258}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1135845544_1135845552 4 Left 1135845544 16:25915105-25915127 CCAGATGTGGCCACATGTCTGCT 0: 1
1: 0
2: 2
3: 30
4: 258
Right 1135845552 16:25915132-25915154 CACAGGATTGCTGGCAGTGGAGG 0: 1
1: 0
2: 2
3: 21
4: 294
1135845544_1135845551 1 Left 1135845544 16:25915105-25915127 CCAGATGTGGCCACATGTCTGCT 0: 1
1: 0
2: 2
3: 30
4: 258
Right 1135845551 16:25915129-25915151 GGGCACAGGATTGCTGGCAGTGG 0: 1
1: 0
2: 3
3: 40
4: 402
1135845544_1135845550 -5 Left 1135845544 16:25915105-25915127 CCAGATGTGGCCACATGTCTGCT 0: 1
1: 0
2: 2
3: 30
4: 258
Right 1135845550 16:25915123-25915145 CTGCTGGGGCACAGGATTGCTGG 0: 1
1: 0
2: 1
3: 26
4: 274

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1135845544 Original CRISPR AGCAGACATGTGGCCACATC TGG (reversed) Intronic
900568677 1:3347765-3347787 AGCAGGCATCAGGCCAGATCTGG - Intronic
900877827 1:5358283-5358305 TGCAGACATGAGGTCACTTCTGG - Intergenic
902110793 1:14076616-14076638 AGAGGACATCTGGCCATATCTGG - Intergenic
902241136 1:15090246-15090268 AGGTGATATGTGGCCAAATCTGG - Intronic
904070624 1:27793818-27793840 CGCAGACACTTTGCCACATCTGG - Intronic
904562664 1:31409248-31409270 AGCAGTCATGGGGCCACATCTGG - Intergenic
904929658 1:34076535-34076557 AGGGGACATTTGGCCACATCTGG - Intronic
905044648 1:34986027-34986049 ATCAGACATCTGGCCAAATTTGG - Intronic
905475413 1:38223610-38223632 AGCAGACAAATGGCCAGATATGG + Intergenic
905652160 1:39663735-39663757 AGCAGACATCTGGCCCAAGCTGG + Intronic
908208578 1:61876655-61876677 AGTATACATGTGGCCACATCTGG - Intronic
910431149 1:87160863-87160885 TGCACACCTGTGGCCACATGGGG + Intronic
911978378 1:104533612-104533634 AGGAGTGAGGTGGCCACATCAGG - Intergenic
913452986 1:119004980-119005002 AGCAGACTTGTTGCCACCTCTGG - Intergenic
914924417 1:151872136-151872158 AGCAGACATGGGGGCACTGCAGG - Intergenic
915004338 1:152622846-152622868 CGCAGAACTGTGGCCACAGCTGG + Exonic
918682159 1:187369204-187369226 AGCAGACCTGTGTCCAAATCAGG - Intergenic
922531256 1:226347055-226347077 AGGGGACATTTGGCAACATCTGG + Intergenic
923250995 1:232179791-232179813 ACCAGGCATGTGGGCACCTCTGG - Intergenic
924489188 1:244518607-244518629 AGCACACAGATGGCCACATTGGG + Exonic
1064106268 10:12503293-12503315 CGCAGCCACCTGGCCACATCAGG - Intronic
1065961065 10:30734761-30734783 TGCAGGCATGTAGCCAAATCAGG + Intergenic
1065990430 10:31004081-31004103 AGGAGACATCTGGCAATATCTGG + Intronic
1067056913 10:43057878-43057900 TCCAGAGATGTGGCCCCATCTGG + Intergenic
1068768484 10:60793008-60793030 AGGAGACATTTGGCAATATCTGG - Intronic
1068791284 10:61033997-61034019 AGCAGACATCCTGCCAGATCCGG + Intergenic
1069492280 10:68871278-68871300 AGAAGACAGGTGGCCCCACCCGG - Intronic
1070500898 10:77071522-77071544 GGGAGACACGTGGCTACATCTGG + Intronic
1071113702 10:82192525-82192547 AGCTGACCTGTGGACACATTTGG + Intronic
1071726091 10:88199475-88199497 AGGAGACATTTGGCAATATCGGG - Intergenic
1072809930 10:98453553-98453575 AGCAGTCATTTGGTCCCATCTGG - Intergenic
1073454889 10:103630404-103630426 ACCACAGATGTGGGCACATCTGG + Intronic
1074501206 10:114026449-114026471 GGCAGACATTTGGCCATGTCTGG - Intergenic
1075051772 10:119187576-119187598 AGGGGACATTTGGCAACATCTGG - Intergenic
1077519069 11:3020567-3020589 GGCTGACTTGAGGCCACATCTGG + Intronic
1079449660 11:20588956-20588978 GGCAGACATGTGGCCAACTTTGG + Intergenic
1080992625 11:37557618-37557640 AGCAGACCTGATGCCAAATCTGG + Intergenic
1082922428 11:58510076-58510098 AGGGGACATTTGGCCACGTCTGG - Intergenic
1083760607 11:64814847-64814869 AGGGGACATTTGGCAACATCTGG - Intergenic
1084197717 11:67533797-67533819 AGCAAACATGTGGCCAAAAAAGG - Intergenic
1084616881 11:70242417-70242439 AGAAGTCAAGGGGCCACATCTGG + Intergenic
1084686621 11:70699856-70699878 ACTAGTCACGTGGCCACATCTGG - Intronic
1086399530 11:86449059-86449081 AGCAGAAATCTGGCCCCATATGG + Intronic
1086439293 11:86812396-86812418 GGCAGACATGAGGCCATTTCTGG + Intronic
1087232792 11:95684909-95684931 AGCAGATGTGTGCCCACATGTGG + Intergenic
1088637301 11:111835073-111835095 AGCAAACCTGCAGCCACATCTGG - Intronic
1088821494 11:113461119-113461141 AGCACACAGGTGGCAACATTTGG - Intronic
1090615445 11:128510344-128510366 TGCAGACATGTGTCCATATCTGG + Intronic
1090739286 11:129642639-129642661 AGAATACATGTGGCCACTTTGGG + Intergenic
1091588534 12:1829530-1829552 AGCTGACACGTGGCTAGATCTGG - Intronic
1093957819 12:25241812-25241834 AGGGGACATTTGGCAACATCTGG - Intronic
1094045147 12:26159037-26159059 AGCAGCCATGTGACCAGCTCTGG + Intronic
1096970289 12:55660016-55660038 AGGGGACATTTGGCCATATCTGG - Intergenic
1098913777 12:76236758-76236780 CTCAGGCATGTGGCCACACCTGG + Intergenic
1101360762 12:104024677-104024699 AACAGACATTTCGCCACATGTGG - Intronic
1101760074 12:107651197-107651219 GGCAGACATGACGTCACATCTGG + Intronic
1102467835 12:113140734-113140756 AGCAGACATGGGGGTACAGCTGG + Intergenic
1103068134 12:117917127-117917149 AGGGGACATTTGGCAACATCTGG - Intronic
1103117238 12:118346622-118346644 AGCAGAAATGTGGACTCAACAGG + Intronic
1104781604 12:131424256-131424278 ATCAGACATGTGGATATATCAGG + Intergenic
1104927736 12:132322309-132322331 AGCAGAGATGTCCCCACCTCAGG - Intronic
1106274528 13:28191292-28191314 AGCTTACTTGTGGCAACATCTGG - Intronic
1106498314 13:30303422-30303444 TTCAGGCATGTGGCCACACCCGG - Intronic
1107748154 13:43534719-43534741 AGGAGACATGTGGCAATTTCTGG + Intronic
1110241387 13:73271084-73271106 AGGAGACATGTGGCAATGTCTGG - Intergenic
1112614594 13:100990367-100990389 AGGGGGCATTTGGCCACATCTGG + Intergenic
1112805041 13:103155478-103155500 AGAAGACATTTGGCCATATCTGG - Intergenic
1114475945 14:22994965-22994987 AGGAGACATTTGGAAACATCTGG - Intronic
1114827060 14:26093875-26093897 ATCACACATGTGGCCATATGAGG + Intergenic
1114964935 14:27945730-27945752 AGCAGACATGTGAGCAGATGTGG - Intergenic
1119467184 14:74867516-74867538 AGCAAACATCTGGTAACATCTGG - Intronic
1119591497 14:75892502-75892524 AGGAGACATTTGGCAATATCTGG + Intronic
1120705650 14:87742846-87742868 AGCAAACATGTGCTCACCTCTGG - Intergenic
1122049185 14:99043487-99043509 ATTAGAAATGTGGCCACTTCTGG + Intergenic
1122780433 14:104141147-104141169 AGCAGCCATGTCCACACATCTGG - Intronic
1122906328 14:104803268-104803290 AGCAGACATCTGGCCGCCTCAGG - Exonic
1122921300 14:104881405-104881427 AGCAGACATGGGGCCAAAGCTGG - Intronic
1124186117 15:27531041-27531063 AGAAGAGATGTGTCCACATTAGG + Intronic
1124922660 15:34041388-34041410 ACCAGACATTTGCCCAAATCAGG - Intronic
1129174588 15:73830789-73830811 AGCAAGGATGTGGCCTCATCTGG - Intergenic
1130774472 15:86964433-86964455 AGGAGACATTTGGCCATGTCTGG - Intronic
1130898376 15:88188340-88188362 AGCAGACATTTGACAATATCTGG + Intronic
1131922583 15:97345804-97345826 AGCAGACATTTGGCAATATCTGG - Intergenic
1132929326 16:2450965-2450987 GGCAGACAGGGGGTCACATCCGG - Intronic
1134004282 16:10807499-10807521 AGGGGACACTTGGCCACATCAGG + Intronic
1135845544 16:25915105-25915127 AGCAGACATGTGGCCACATCTGG - Intronic
1136076564 16:27821227-27821249 AGCAGAGATCTGGCCACACTGGG - Intronic
1138674076 16:58638415-58638437 ACCAGTCCTGTGGCCCCATCTGG + Intergenic
1139124343 16:64059420-64059442 AGGAGACATTTGGCAATATCTGG - Intergenic
1140524803 16:75613750-75613772 AGGAGACTTTTGGCAACATCTGG - Intronic
1142208471 16:88795448-88795470 AGCCGGCATGTGCCCTCATCTGG + Intergenic
1142308198 16:89297474-89297496 ACCAAACATCTGGCCTCATCCGG + Intronic
1143504739 17:7357325-7357347 AGTAGACATTTTGCAACATCTGG + Intergenic
1144209224 17:13000616-13000638 AGAGGACATTTGGCAACATCTGG - Intronic
1144261138 17:13522004-13522026 AGGAGACATTTGGCCACGTCTGG - Intronic
1144340744 17:14309080-14309102 AGCGGACACGTGGCAACGTCGGG - Intronic
1145997409 17:29112620-29112642 ACTAGGCCTGTGGCCACATCTGG + Intronic
1146003208 17:29143979-29144001 AGCAGACATATGGCCACAAAGGG - Intronic
1148830060 17:50425665-50425687 AGCTGACATCTGGCCTCAGCTGG + Intergenic
1157585538 18:48798794-48798816 AGCAGACACTTGGCAACGTCTGG + Intronic
1158395378 18:57075343-57075365 AGAGGACATCTGGCAACATCTGG - Intergenic
1159158254 18:64610548-64610570 AGGAAATATGTGCCCACATCTGG - Intergenic
1160622511 18:80180827-80180849 AGCAGACATGTGGTGATGTCTGG + Intronic
1160755144 19:753023-753045 TGCTGACCTGTGGCCACAGCAGG + Intronic
1161348030 19:3777686-3777708 TGCAGGCATGTGGCCACAGGAGG + Intergenic
1161834360 19:6635597-6635619 AGGAAACATTTGGCAACATCTGG + Intergenic
1162779279 19:12998237-12998259 AGCAGAGATGGGGCCAAAACTGG - Intronic
1165487863 19:36106172-36106194 AGCAGGCATCTGGCCACATGGGG + Intergenic
1167141122 19:47651400-47651422 AGCAGCAATGTGGCCACCCCAGG - Intronic
925347179 2:3179342-3179364 GGCAGCCAGGTGGCCACTTCAGG + Intergenic
925404771 2:3598901-3598923 ATCAGATATGTGTCCACATTTGG + Intronic
927028932 2:19100419-19100441 AGCAGTGATGTGTTCACATCAGG + Intergenic
929207889 2:39318954-39318976 AGGAGACATTTGGCAATATCTGG + Intronic
929263374 2:39891796-39891818 AACTGACATGTGGCAATATCTGG - Intergenic
930614374 2:53578418-53578440 AACAGTAAGGTGGCCACATCTGG + Intronic
931788952 2:65646329-65646351 AGCAGCCAGGTGGTCACATTGGG + Intergenic
933115985 2:78472485-78472507 GACAGACATGGGGCCACATTAGG + Intergenic
933294432 2:80472970-80472992 AGCAGACAAGTGGGCACAGTAGG - Intronic
933704580 2:85280185-85280207 AGGAGACATTTGGCAAAATCTGG + Intronic
935723365 2:105999242-105999264 AGCAGGCTGGTGGCCACAACTGG - Intergenic
938088360 2:128416613-128416635 AGCAGGCATGTGGCAGCAGCTGG + Intergenic
939849484 2:147287294-147287316 CCCAGTCATTTGGCCACATCTGG + Intergenic
940192195 2:151053794-151053816 AGCAGAAATGTGCCAACACCTGG + Intergenic
942069659 2:172304756-172304778 ACCAGGCATGTGGGCACCTCAGG + Intergenic
945939453 2:215933519-215933541 AGGGGACATTTGGCCATATCTGG - Intergenic
946448559 2:219760736-219760758 AGCCGATATGTAGCCATATCTGG + Intergenic
946624280 2:221594226-221594248 AGCACACATGTGGCAATGTCTGG - Intergenic
947134427 2:226963107-226963129 AGGAGACAACTGGCAACATCTGG - Intronic
947704385 2:232262493-232262515 AGAAGACATTTGGCCATGTCTGG + Intronic
948282040 2:236754321-236754343 TGAAGACAAGTGGCCACAGCTGG - Intergenic
1168781595 20:496223-496245 AGCAGACATCAGGCCAAATTTGG - Intronic
1168836916 20:883704-883726 AGCAGACATTCAGCCTCATCTGG + Intronic
1169015625 20:2290465-2290487 AGCCTACAAGTGGCCACAACAGG - Intergenic
1169771958 20:9210721-9210743 AACATATATGTGGCCAGATCAGG + Intronic
1171405481 20:24909729-24909751 AGCAGTGATGTGCCCACATGGGG + Intergenic
1173710350 20:45150217-45150239 AGCAAAAATGTTGCCACCTCTGG - Intergenic
1173907402 20:46638921-46638943 AGGAGACATGTGGCAATGTCTGG - Intronic
1174415669 20:50364968-50364990 AGGAGACATGTGGCAATATCTGG + Intergenic
1174436327 20:50509934-50509956 GGCAGACATCTGGCCAGAGCTGG + Intergenic
1174588947 20:51630020-51630042 AGGAGACATGTGGCAATGTCTGG + Intronic
1175125449 20:56748007-56748029 AACAGACATCTGGCCAGATTTGG - Intergenic
1175147750 20:56909665-56909687 AGGAGACATCTGGCAACATCTGG - Intergenic
1175166518 20:57048151-57048173 AGGGGACATCTGGCGACATCTGG + Intergenic
1175261970 20:57680360-57680382 AGGGGACATCTGGCCATATCTGG + Intronic
1175364125 20:58439646-58439668 AGGACACATGTGGCAATATCTGG - Intronic
1175373966 20:58512377-58512399 TGGAGACATGTGGTCATATCTGG + Intronic
1175495915 20:59414047-59414069 AGAAAACACGTGGCAACATCGGG + Intergenic
1175613310 20:60370391-60370413 AGGAGACATTTGGCAACATCTGG + Intergenic
1175821769 20:61913821-61913843 AGCAGCCAGGTGGGCACAGCCGG + Intronic
1178387316 21:32163459-32163481 AGGAGACTGGTGTCCACATCTGG + Intergenic
1178902384 21:36607604-36607626 AGGGGACATTTGGCAACATCTGG + Intergenic
1182729082 22:32473118-32473140 AGCAGTAAAGTGGACACATCAGG + Intergenic
1182958188 22:34447000-34447022 AGGAGACATTTGGAAACATCTGG - Intergenic
1183296220 22:37031074-37031096 AGGGGACATCCGGCCACATCTGG - Intergenic
1183786749 22:40033638-40033660 AGGGGACATGTGGTAACATCTGG - Exonic
1184473090 22:44706997-44707019 GGCAGAGATGTGTCCCCATCGGG + Intronic
1184497591 22:44851168-44851190 ACCAGACATTTGTCCACTTCCGG + Intronic
949586990 3:5450959-5450981 AGAAGACATGTGGACATTTCTGG + Intergenic
952016037 3:28958815-28958837 AGCAGGCATGTTGCCCCTTCGGG + Intergenic
952091519 3:29892499-29892521 AGCAGACATTTGGCAATGTCTGG - Intronic
954276894 3:49548124-49548146 ATCAGTCAGGTAGCCACATCTGG - Intergenic
954646829 3:52136698-52136720 AGCAGACAAGTGACCACACAAGG + Intronic
956100041 3:65758592-65758614 AGGAGACATCTGGCAACGTCTGG + Intronic
956587287 3:70878253-70878275 AGGAGACATTTGGCAATATCTGG - Intergenic
958789430 3:98633866-98633888 AAGAGACATTTGGCAACATCTGG - Intergenic
960940222 3:122928503-122928525 AGCAGACAGGTGGGCACCTCAGG - Exonic
962036382 3:131656029-131656051 AACAGTATTGTGGCCACATCTGG - Intronic
962265971 3:133944614-133944636 GCCAGCCATGTGGCCACACCTGG + Intronic
962284998 3:134077991-134078013 AGCAGACATCCTGCCACACCTGG + Intronic
963750162 3:149169645-149169667 AGGGGACATCTGGCAACATCTGG - Intronic
965617909 3:170613499-170613521 ACCAGTCATGTGGGCACACCTGG - Intronic
965666955 3:171105410-171105432 AGGAGACATTTGGCAAAATCTGG - Intronic
966134736 3:176685514-176685536 AGCAAACAAGAGGCAACATCAGG + Intergenic
966825504 3:183961759-183961781 AGAAGACATTTGGCAGCATCTGG + Intronic
966830189 3:184001533-184001555 AGAGGACATGTGGCAATATCTGG + Intronic
967048928 3:185764298-185764320 AGCAGGAATGTGACCTCATCAGG + Intronic
967197569 3:187041911-187041933 AGCAGACATGTAGCCAACTAAGG - Intronic
967224034 3:187274404-187274426 AGCAGACCTGAGACAACATCAGG + Intronic
967976189 3:195035909-195035931 AGCAAACACGTGGCCTCAGCTGG + Intergenic
969293626 4:6256313-6256335 GCCAGACATGAGGCCACAGCCGG + Intergenic
969966308 4:11000425-11000447 AGGAGACATTTGGCAATATCTGG - Intergenic
970254118 4:14149300-14149322 AGCAGTCATGTGTGCACATATGG - Intergenic
970265512 4:14279495-14279517 AGCAGTGATGTGGCTACATAGGG + Intergenic
970553281 4:17205989-17206011 GGAATACATGTGGTCACATCGGG + Intergenic
971809303 4:31403170-31403192 AGAAGACATGTGGGAATATCTGG + Intergenic
972251666 4:37308923-37308945 AGCTGCCATGTGCCCCCATCAGG - Intronic
975288192 4:72645230-72645252 AGTGGACATTTGGCAACATCTGG - Intergenic
976614207 4:87059647-87059669 AGAAGACAAATGGACACATCTGG - Intronic
976854788 4:89590861-89590883 GACATAGATGTGGCCACATCTGG + Intergenic
978717362 4:111861966-111861988 AGCAGACATGTGTTCACAGCCGG + Intergenic
981084705 4:140671191-140671213 AGGAGACATCTGGCAACATCTGG + Intronic
981227116 4:142310050-142310072 ACCATACATATGGCCACAGCTGG + Intronic
982756212 4:159221473-159221495 AGTAGTCATGTGGCTACTTCAGG + Intronic
983737270 4:171077543-171077565 ACCAGAGATGTCTCCACATCTGG + Intergenic
983912821 4:173259087-173259109 AGGGGGCATGTGGCAACATCTGG - Intronic
985606326 5:860059-860081 AGCAGACCTCTGGCCACTGCAGG - Intronic
985758942 5:1734859-1734881 AGCAGACATGGGACCCGATCGGG + Intergenic
986151496 5:5133966-5133988 AGCAGTCATGTGGGTACAGCAGG + Intergenic
986329592 5:6707725-6707747 AGGGCACATGTGGCCACGTCTGG - Intergenic
987373550 5:17215486-17215508 AGGAGACATTTGGCGATATCTGG + Intronic
987692697 5:21287883-21287905 AGCAGGTATGTGTCCACATTGGG + Intergenic
989106608 5:37868871-37868893 AGGAGACATCTGGCAAAATCTGG - Intergenic
991747658 5:69762164-69762186 AGCAGGTATGTGTCCACATTGGG - Intergenic
991750071 5:69793160-69793182 AGCAGGTATGTGTCCACATTGGG + Intergenic
991799236 5:70342018-70342040 AGCAGGTATGTGTCCACATTGGG - Intergenic
991801644 5:70372965-70372987 AGCAGGTATGTGTCCACATTGGG + Intergenic
991826952 5:70637061-70637083 AGCAGGTATGTGTCCACATTGGG - Intergenic
991829361 5:70668018-70668040 AGCAGGTATGTGTCCACATTGGG + Intergenic
991891595 5:71341445-71341467 AGCAGGTATGTGTCCACATTGGG - Intergenic
992158851 5:73981155-73981177 AGCAGAAATCTGGCCACTTATGG - Intergenic
993974751 5:94465014-94465036 AGCAGAAATAATGCCACATCTGG + Intronic
994531034 5:100971404-100971426 AGCATCCCTGTGGCCACAACTGG - Intergenic
994672651 5:102781007-102781029 AGGAGACATTTGGCAACATCTGG - Intronic
995139957 5:108724847-108724869 AGGAGACATTTGGCAACGTCTGG + Intergenic
995373733 5:111450495-111450517 AACAGACATGTGGCCAGATGCGG + Intronic
995452814 5:112321193-112321215 AGGAGAGATGTTGCCAGATCAGG + Intronic
996540393 5:124625476-124625498 AGCAGACATGTGCTCACTCCAGG + Intergenic
997465385 5:134084552-134084574 AGCAGGCATGTGGGGACCTCTGG - Intergenic
998563242 5:143191870-143191892 AGCCGACAAGTGGCCATATGTGG + Intronic
999703616 5:154250874-154250896 ACCAGACATGTGGCAAATTCTGG - Intronic
999723851 5:154418748-154418770 TGCAGACAGGTGGCCAAAGCAGG - Exonic
1002417150 5:179126555-179126577 AGGGGACATTTGGCCACGTCTGG + Intronic
1004411585 6:15386167-15386189 AGCAGAGAAGTGGTCAAATCAGG + Intronic
1004537608 6:16518183-16518205 AGCAGAAATATGGCCAGAGCAGG + Intronic
1005019304 6:21402333-21402355 AGCAGCCACCTGGCCACATATGG + Intergenic
1005256291 6:24006989-24007011 AGAGGACATGTGGCCACGTCTGG + Intergenic
1006718210 6:36133443-36133465 AGCAGACTTGAGGCCCCATTTGG + Intronic
1006806612 6:36793298-36793320 AGCAGAGCGGGGGCCACATCTGG + Intronic
1009007424 6:57805255-57805277 GGCAGACAGGTGGCCAACTCTGG - Intergenic
1009037701 6:58137822-58137844 AGTGGACATCTGGCCATATCTGG - Intergenic
1009526425 6:64751794-64751816 AGCAGACTTGCTGCCACATATGG - Intronic
1011776017 6:90731443-90731465 AGAGGACATTTGGCAACATCTGG - Intergenic
1013515452 6:110881359-110881381 AGAAGACATGTGGCAACATTTGG - Intronic
1013809522 6:114028607-114028629 ACAAGACATTTGGCAACATCTGG - Intergenic
1015285767 6:131485200-131485222 AGCAGCCATGACTCCACATCTGG - Intergenic
1015310654 6:131763516-131763538 AGAAGACATGTGTTCATATCTGG + Intergenic
1017404399 6:154102677-154102699 AGGAGACATTTGGCAATATCTGG - Intronic
1017767743 6:157620682-157620704 AGCAGGAATGTGGCCACAATGGG - Intronic
1017809641 6:157975674-157975696 CGCAGACATGTGCCCACAGAGGG - Intergenic
1018662008 6:166097070-166097092 AACAGAAATGAGGCCAAATCTGG + Intergenic
1019742729 7:2682758-2682780 AGAAGAGATGAGGCCGCATCTGG - Intronic
1021878335 7:25069620-25069642 AGCAGGTAGGTGGCCACAACAGG + Intergenic
1023059016 7:36311756-36311778 GGCAGCCCTGTGGCCACAGCAGG - Intergenic
1025254908 7:57377835-57377857 AGGAGACATGTGGCAATATCTGG - Intergenic
1026038192 7:66844867-66844889 CGCAGACGCGTGGCCACAGCCGG - Intergenic
1026155135 7:67819653-67819675 AGCACAGATGAGGCCATATCAGG - Intergenic
1027569047 7:79839322-79839344 AGCAGCAATGTGTCAACATCAGG + Intergenic
1030208385 7:106972724-106972746 AGCAGACACCTGGCCGGATCCGG + Intergenic
1030688008 7:112506298-112506320 AACAGAGATGTGGCTATATCTGG + Intergenic
1031258600 7:119488409-119488431 AGCAGACATGTGTCCATAGCAGG + Intergenic
1032384894 7:131515119-131515141 AGGAGACATTTGGCAATATCTGG - Intronic
1033929623 7:146506436-146506458 AGCAGAAATTGGGCCACGTCGGG - Intronic
1035170580 7:157015227-157015249 AGCAGACCTGGGCCCACCTCAGG - Intergenic
1035278011 7:157759415-157759437 AGCAGACCTCTGTCCACCTCGGG - Intronic
1036097605 8:5741298-5741320 AGCAGACAGGTGCCCACAAGGGG + Intergenic
1038930844 8:32191968-32191990 AGCAGACATGGACCCACTTCAGG + Intronic
1041765190 8:61411793-61411815 AGCAGAGATGTCGCCCCATGTGG + Intronic
1045632978 8:104148629-104148651 AGCAGACAAATGGGCATATCAGG + Intronic
1046553600 8:115748296-115748318 TTCAGTCAGGTGGCCACATCTGG - Intronic
1046617053 8:116489271-116489293 AGGGGACATTTGGCCACGTCTGG - Intergenic
1046638021 8:116694428-116694450 AACAGACCAGTGGCCACAGCAGG - Intronic
1047484949 8:125320954-125320976 AGCAGACATATGGCCAGAGCAGG + Intronic
1047721569 8:127644925-127644947 AGCTGACATGTGACCACAGCAGG - Intergenic
1048269379 8:133016415-133016437 AGGGGACATTTGGCCACATCTGG - Intronic
1048651916 8:136487444-136487466 AGCAGAAACCTGGACACATCTGG - Intergenic
1049271752 8:141699827-141699849 AGCAGACCTGGGGCCACAGAGGG - Intergenic
1049399625 8:142419097-142419119 GGCAGAGATGTGGCCGCACCTGG + Intergenic
1051012902 9:12439822-12439844 AGCTGACATGTGTCTAAATCTGG - Intergenic
1051255222 9:15206025-15206047 AGCAGACGGGTGGGCAGATCAGG + Intronic
1052284770 9:26772585-26772607 AGAAGACATATGTCCACATTTGG + Intergenic
1056094722 9:83241198-83241220 GGCAGAGATGTGGGAACATCTGG + Intergenic
1057691264 9:97288618-97288640 AGGAGACATGTGCACACATCAGG - Intergenic
1060728316 9:126020951-126020973 AGCAGAGAAGTGGTCACAACAGG - Intergenic
1061529239 9:131197371-131197393 AGCAGACCTGTGGCACCTTCTGG + Exonic
1062148401 9:135004137-135004159 AGGAGACATTTGGCAATATCTGG + Intergenic
1185573757 X:1154310-1154332 AGCAGCCATGCGCCCACAGCAGG - Intergenic
1186071514 X:5826198-5826220 AGTGGACATGTGGCAATATCTGG + Intergenic
1186201790 X:7162674-7162696 AGGAGACATTTGGCAACATCTGG - Intergenic
1186239597 X:7552318-7552340 AGGAAACATTTGGCCATATCTGG + Intergenic
1186476281 X:9860077-9860099 AGGAGACATGTGGTAACATCTGG + Intronic
1187045512 X:15644695-15644717 AGGAGACATTTGGCAATATCTGG - Intronic
1195221820 X:102751675-102751697 ATTAGACATTTGGCTACATCTGG + Exonic
1195423377 X:104699988-104700010 ACTAGTCATGTGGCCACATCTGG + Intronic
1196109464 X:111930633-111930655 AGCAGCAATGTGGCTACAGCAGG + Intronic
1196164074 X:112519067-112519089 AGCCGGCAAGTGGCAACATCTGG - Intergenic
1196908977 X:120467421-120467443 AGGGGACATTTGGCAACATCTGG - Intronic
1197159375 X:123306785-123306807 GGCAGATATGTGGGCACAGCTGG - Intronic
1199049782 X:143223473-143223495 AGCAGACATTTGGCAGTATCTGG + Intergenic
1199167938 X:144699637-144699659 AGCTGAAATGTCACCACATCAGG + Intergenic
1200735170 Y:6786396-6786418 AGCAGTGAGGTGGACACATCAGG + Intergenic
1200760745 Y:7036678-7036700 GGAAGACATTTGGCAACATCTGG - Intronic