ID: 1135847994

View in Genome Browser
Species Human (GRCh38)
Location 16:25936305-25936327
Sequence TCAGATATGCAGATGATACA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 214
Summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 196}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1135847991_1135847994 17 Left 1135847991 16:25936265-25936287 CCTACTAAGTGATTTGGTGGGGA 0: 1
1: 0
2: 0
3: 6
4: 74
Right 1135847994 16:25936305-25936327 TCAGATATGCAGATGATACAAGG 0: 1
1: 0
2: 1
3: 16
4: 196
1135847993_1135847994 -6 Left 1135847993 16:25936288-25936310 CCTAGAAGGCTCACTAATCAGAT 0: 1
1: 0
2: 0
3: 14
4: 97
Right 1135847994 16:25936305-25936327 TCAGATATGCAGATGATACAAGG 0: 1
1: 0
2: 1
3: 16
4: 196

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1135847994 Original CRISPR TCAGATATGCAGATGATACA AGG Intronic
901102772 1:6732095-6732117 TCAGATAGGCAGCTGTTCCATGG + Intergenic
901292306 1:8133452-8133474 TCAGAAATGCAGATGATCTGTGG - Intergenic
901741159 1:11342910-11342932 TCAGGCATGCAGATCAGACATGG + Intergenic
902180372 1:14683794-14683816 TCAGCAATGCTGAGGATACAGGG - Intronic
905523853 1:38621884-38621906 TCAGAGATGCAGGTGAGATAAGG - Intergenic
908950083 1:69550145-69550167 TCAGATACGTAGATTATATAAGG + Intergenic
909534102 1:76715899-76715921 TCAGAAAAGCAGCTAATACATGG + Intergenic
910568065 1:88667599-88667621 TCAGAAATGAAGTTGCTACATGG - Intergenic
914723167 1:150306041-150306063 TCTGATGTGCAGATGATTCTGGG + Intronic
914963234 1:152225858-152225880 TCAGATGTCCAGAGGAAACACGG - Intergenic
915192132 1:154160315-154160337 TCACATATGCAGATGATTTTAGG - Intronic
915888550 1:159749413-159749435 TTAGATAGGCAGCTGATACCTGG - Intergenic
917623975 1:176827218-176827240 TTAGATCTGGAGATAATACAGGG - Intronic
921473311 1:215574634-215574656 TGAGATTTGCAGATGAAATAAGG + Intronic
923523862 1:234757671-234757693 TCAGATTTGCAGAAGAAACACGG - Intergenic
923909497 1:238425063-238425085 TCGGATATACAGATCATGCATGG - Intergenic
924634997 1:245777700-245777722 TAAGCTATGCAGAAGACACAGGG - Intronic
1064643237 10:17435107-17435129 TCAGATATGCAGCAGCAACAAGG - Intronic
1066302569 10:34109731-34109753 ACAGAAATGCAGAAGAGACACGG + Exonic
1066414579 10:35208876-35208898 AGAGAAATGCAGATGATACCTGG + Intronic
1067163943 10:43849862-43849884 TCAGATATGCAGGTGGCACCAGG - Intergenic
1068077230 10:52271443-52271465 TCAGAGAAGCAGATCATGCAGGG + Exonic
1068438899 10:57026323-57026345 TCAGAGAAGAAGATGACACAAGG - Intergenic
1068698151 10:59991313-59991335 TCACATATGCAAATGATAGCTGG + Intergenic
1069184108 10:65400860-65400882 TCATATGTGCAGATTTTACAGGG - Intergenic
1069806739 10:71130922-71130944 TCAGATTTACAGAGGACACAAGG + Intergenic
1071370361 10:84945055-84945077 TCATACATACAGATGAGACAAGG + Intergenic
1073317838 10:102595396-102595418 TTGCATATGCAGAAGATACAAGG - Intronic
1073874134 10:107901908-107901930 AGAGATAGCCAGATGATACAAGG + Intergenic
1074713624 10:116198532-116198554 TAAGATATGCAGGAGATAAATGG + Intronic
1076712946 10:132348825-132348847 TCAGTTATGCAGAAAATAAATGG + Intronic
1080460253 11:32448543-32448565 TCAAATAGGCAAATAATACAGGG - Intergenic
1081273056 11:41110999-41111021 TCAGAGATGCAGATGCTGAAGGG + Intronic
1082967450 11:58981353-58981375 TAATATATGCTGATTATACAAGG + Intronic
1086596103 11:88573006-88573028 CTAGAAATGCAGATGAAACATGG + Intronic
1087524087 11:99285547-99285569 TTAAATAAGCAGAGGATACAAGG + Intronic
1087666289 11:101052958-101052980 TCATATGTGCAGCTGATACCAGG - Intronic
1088208522 11:107424290-107424312 ACAGCTAGGCAGATGATAGATGG - Intronic
1098192941 12:67969540-67969562 TCACATTTGCACATGATATAAGG + Intergenic
1098609044 12:72432390-72432412 TCACATGTGCAGATGATCAAAGG + Intronic
1100628146 12:96358302-96358324 ACAGATATGCAGATTATGCAGGG + Intronic
1101762855 12:107673371-107673393 TCAATTATCCAGATAATACAAGG + Intergenic
1101852533 12:108415601-108415623 GCAGAGATGGAGATGATGCATGG - Intergenic
1102229248 12:111250931-111250953 TCATATATGGAGATGAGACCAGG - Intronic
1103058395 12:117839454-117839476 TCAGATATCCCCATGAGACAGGG - Intronic
1113370471 13:109720437-109720459 TCAGAAATGCAGAAGAAAGAAGG + Intergenic
1114772091 14:25439381-25439403 TCACATTTGCAGATAAGACAAGG - Intergenic
1116580781 14:46638236-46638258 ACAGATAAGCAGAAGATATAAGG + Intergenic
1116904425 14:50391282-50391304 TCTGATTTGCATATGACACATGG - Intronic
1118102537 14:62623042-62623064 TCAGACATTCAGATGATAAGTGG - Intergenic
1118514454 14:66509450-66509472 TCAGACATGCAGAACACACACGG - Intronic
1119528157 14:75339311-75339333 TCAGCTTTGCAGATGCTAGAGGG - Intergenic
1120866474 14:89299606-89299628 TCAGAGATGGAGATGATAGAAGG + Intronic
1123212725 14:106776016-106776038 TTACATATGCAGAGGAAACATGG + Intergenic
1125445881 15:39755604-39755626 TCTGATATGCAGAGGGTAGAGGG - Intronic
1129586006 15:76865871-76865893 TCAGGTAAGTAGATGACACATGG - Intronic
1130524027 15:84688157-84688179 TCAGATATGCAAATGAGAACTGG + Intronic
1130575589 15:85090433-85090455 TAAGATAAGCAGAAAATACATGG - Intronic
1131653328 15:94426825-94426847 TCAGAGATGGAGATGATCCAAGG + Intronic
1131848014 15:96508795-96508817 TCAGATTCCCAGGTGATACAGGG - Intergenic
1133465497 16:6023176-6023198 TCAGAAATGAAGCTGAAACATGG + Intronic
1134827912 16:17299275-17299297 TCACATTTGCTGATGAAACATGG - Intronic
1135284421 16:21181123-21181145 TGGGATATGCAGATGGGACAGGG + Intergenic
1135847994 16:25936305-25936327 TCAGATATGCAGATGATACAAGG + Intronic
1136565007 16:31064548-31064570 TGAGAAATGCAGATGAGATAGGG - Intronic
1137524459 16:49222488-49222510 TGATATAGACAGATGATACATGG + Intergenic
1138723274 16:59107379-59107401 TTAGATAGACAGATGATAGATGG - Intergenic
1141406777 16:83801492-83801514 ACAGATATATAGATGATAGAAGG + Intergenic
1145122735 17:20275398-20275420 TACTATATACAGATGATACAGGG - Intronic
1145774275 17:27516550-27516572 TCAGATATGAAAATGATGGAAGG - Intronic
1147952199 17:44113485-44113507 TCTGAGATTCAGGTGATACAAGG + Intronic
1149399656 17:56282620-56282642 TCAAATATGCAGATGAAAACTGG - Intronic
1150591452 17:66566189-66566211 TCAGATCTGCTGATGATACCTGG + Intronic
1153385629 18:4492049-4492071 TCAGATATGCAGATGTAATTGGG + Intergenic
1153969466 18:10212333-10212355 TCAGTTTTCCAGATGAGACAGGG + Intergenic
1158610523 18:58935538-58935560 GAAGATATGCAGAAGAGACAAGG - Intronic
1159344616 18:67184012-67184034 TGAAATATCCAGATGCTACATGG - Intergenic
1166225228 19:41390970-41390992 TCAGACATGGAGATCTTACAAGG + Intronic
926800043 2:16652343-16652365 TCAGATGGGCAGAGGATACGAGG + Intronic
928144635 2:28761438-28761460 TCATATATGCAGAAGAAACTGGG - Intronic
928482776 2:31699104-31699126 TCAAATAAGCAGAGGACACAAGG + Intergenic
929147929 2:38722721-38722743 TCATATATGCAGATAAACCAAGG + Intronic
933032812 2:77353790-77353812 TATGAAATGCAGCTGATACAAGG + Intronic
933058959 2:77711151-77711173 TCAGATAAGAAGATCATGCATGG - Intergenic
933174187 2:79158158-79158180 TCAGATCTTCAGATGCTTCATGG + Intronic
935064349 2:99635302-99635324 TCATATATGTATATGACACAGGG + Intronic
935699861 2:105802099-105802121 TCAGATTTGCAGACGATGCATGG + Intronic
936784040 2:116071718-116071740 CCATATATGTAGAAGATACATGG - Intergenic
937272836 2:120664792-120664814 TGAGATATGGAGAAGATACAAGG + Intergenic
938344739 2:130559004-130559026 TCAGATGTGCTGGTGCTACAGGG + Intergenic
938345094 2:130561716-130561738 TCAGATGTGCTGGTGCTACAGGG - Intergenic
940359406 2:152781495-152781517 TCAGGGATGGAGATTATACAGGG - Intergenic
941510707 2:166405662-166405684 TCAGATATTCATATGATAGATGG - Exonic
942575169 2:177355563-177355585 GCAGATATGCAGAAGATCCCTGG - Intronic
943014431 2:182494204-182494226 TTGGATATGTAGATGATAAAAGG - Intronic
945666193 2:212746157-212746179 TGAGATATACAGAGGATATATGG + Intergenic
946117493 2:217476066-217476088 TCTGATAAGCAGATGAAACAGGG - Intronic
1168945624 20:1754290-1754312 TCTGATATTCAGAATATACAAGG + Intergenic
1169182748 20:3584351-3584373 TCAGATATGGAGATATTACATGG - Intronic
1174879665 20:54265260-54265282 TCTGCTGTGTAGATGATACAGGG + Intergenic
1176014699 20:62924707-62924729 TCACATATGCACATGCAACATGG + Intronic
1177495426 21:21884085-21884107 TCAGATGTGCAGATGCTTGAGGG - Intergenic
1178449558 21:32683988-32684010 TTAAAGAGGCAGATGATACAAGG + Intronic
1181894009 22:26090610-26090632 TCAGATATATAGAAGATAGATGG + Intergenic
1182408536 22:30160218-30160240 TCAGACAAGCAGAAGATTCAAGG - Intronic
951873142 3:27388980-27389002 AGAGATATGGAGATGATTCAAGG - Intronic
954870510 3:53764192-53764214 TCAGATATGTAAATGATGCTTGG + Intronic
956308481 3:67852725-67852747 CCAAATATGAAGAAGATACATGG + Intergenic
957476468 3:80731464-80731486 ACATATAAGCAGATAATACAAGG - Intergenic
958099265 3:88988407-88988429 TCAGATATGGAGTTAAAACAAGG - Intergenic
959314649 3:104787454-104787476 TCAGATAACCAGTTCATACAGGG + Intergenic
959527781 3:107397130-107397152 TCAGATATGCAAATAATATGTGG + Intergenic
960045748 3:113196172-113196194 TAAGATATGCACATCTTACAAGG - Intergenic
961642559 3:128373785-128373807 TAAGATATGCATGTGATACCTGG - Intronic
964638397 3:158882411-158882433 TGAGATATGAAGGTGATTCATGG + Intergenic
964793292 3:160472763-160472785 TCAGATAAGCAGAAGAGACACGG + Intronic
966239021 3:177734442-177734464 TCATATATACAGTTGATACACGG + Intergenic
966457938 3:180139455-180139477 ACAGTTCTGCAGATTATACAAGG + Intergenic
966538658 3:181064156-181064178 TAAAATATGCTGAGGATACAAGG + Intergenic
970005529 4:11407369-11407391 TCAGACATGCAGAGGATTCAAGG - Intronic
970133326 4:12894804-12894826 TCATATAAGCAAAAGATACATGG - Intergenic
971843693 4:31891390-31891412 TCATATATTCAGATAAAACATGG - Intergenic
973575014 4:52278127-52278149 TCAGATAAGCAGATAATAGACGG + Intergenic
974644497 4:64673923-64673945 TCAGAGATGCAGGTTACACATGG - Intergenic
976055776 4:81064299-81064321 ACAGATAGACAGATGATAGATGG + Intergenic
976614849 4:87066027-87066049 TCAGAGGTGAAGATGACACAGGG + Intronic
977334331 4:95677145-95677167 TCAGATAAGTAGATTTTACAAGG - Intergenic
980660294 4:135849154-135849176 TCAGATATCCAGAATCTACAAGG + Intergenic
981669564 4:147272733-147272755 TCAGATATGAAGGAGAGACAGGG - Intergenic
982102655 4:151983311-151983333 TCAGAGAGGCAGAAGATAGAGGG - Intergenic
983505306 4:168547085-168547107 TCAAATCTGCAGCTGAGACAAGG - Intronic
983827241 4:172278535-172278557 ACTGATCTACAGATGATACAGGG - Intronic
984565676 4:181327366-181327388 TCAGATATTCAGAGGATCCGAGG - Intergenic
985239832 4:187918322-187918344 TCAGATATGAAAATTATATATGG + Intergenic
985885340 5:2673162-2673184 TCAGATATGCACAGGCTGCAGGG - Intergenic
986552269 5:8970929-8970951 GCATATATGGATATGATACATGG + Intergenic
988515098 5:31897698-31897720 TGAAACATGCAGATGATATAAGG + Intronic
989665467 5:43848611-43848633 TCTTCTGTGCAGATGATACAGGG + Intergenic
990370058 5:55108809-55108831 TCAGACATGCCGATGTTAAATGG - Intronic
990869048 5:60411017-60411039 TCAGTTTTGCAGCTAATACATGG + Intronic
990966925 5:61458575-61458597 TCAGGTATACAGATGAGACCAGG + Intronic
991082081 5:62612423-62612445 TCAGATATGCAGCTGGAAAATGG - Intronic
991235178 5:64385698-64385720 TCAGAAATACAGAAGAAACAGGG + Intergenic
992921136 5:81522307-81522329 TTAGTTATGCAAATGATAAAAGG + Intronic
993104210 5:83580299-83580321 TTTGGTATGCAGATGCTACATGG - Exonic
993864798 5:93179678-93179700 ACAGATATGTAGATGAAAAAGGG - Intergenic
994934585 5:106237833-106237855 TTATATATGTATATGATACATGG - Intergenic
995366733 5:111370006-111370028 TCAGATATGCAGCTGGAAAAGGG + Intronic
997215206 5:132104198-132104220 ACAGAGATGCAGATGCTCCAAGG - Intergenic
997811998 5:136979499-136979521 AGAGACATGCAGATGATACTCGG + Intronic
998070306 5:139192638-139192660 CCAGAGAAGCAGATGATAAATGG + Intronic
999032862 5:148313987-148314009 TCAGATATTCAGATGTTGCTTGG - Intronic
1000165351 5:158642939-158642961 TCAGAAAGGCAGATGGTCCAAGG + Intergenic
1000864309 5:166493627-166493649 TATGATATGCATATGATTCATGG + Intergenic
1000900442 5:166905725-166905747 TCAGTTATGAAGATGATTCTGGG + Intergenic
1003530142 6:6930250-6930272 TCAGATGCCCAGATGATACATGG - Intergenic
1004151461 6:13124016-13124038 TCCCATGTGCAGATGATCCAAGG + Intronic
1004776798 6:18856394-18856416 TCAGGAATGCATATAATACATGG + Intergenic
1005339707 6:24831677-24831699 TCAGATATTCAGCAGAAACAGGG - Intronic
1005753917 6:28908807-28908829 TCAGATATGGAGAAAATCCAAGG - Exonic
1005820291 6:29593006-29593028 TCAGAAAAGCAGAAGCTACAAGG - Intronic
1007524220 6:42477469-42477491 TCAGAAATGGAGATGATACAGGG - Intergenic
1008369628 6:50717469-50717491 TCTGAAATGTAGATGATAAATGG - Intronic
1008528879 6:52435764-52435786 TTAGATCAGCAGAGGATACAAGG - Intronic
1011403078 6:86985553-86985575 TCAGATAAGCAGAAGATATGAGG + Intronic
1012260304 6:97080895-97080917 TAGGATATTCAGATGAAACAAGG + Intronic
1017934868 6:158996642-158996664 TCAGTTTTTCAGATGACACATGG - Intronic
1018275482 6:162125758-162125780 TCACATTTAAAGATGATACATGG + Intronic
1018523999 6:164686933-164686955 TCAAATATTCAGATGTTAAAAGG - Intergenic
1019872864 7:3781483-3781505 TCAAATGTGCAGATAACACAAGG + Intronic
1019967968 7:4515705-4515727 ACATATATGCAGATGATTCTGGG + Intergenic
1021079874 7:16351522-16351544 TCAAATATCCAGAATATACAAGG + Intronic
1022277789 7:28872968-28872990 CCACAGATGCAGATGACACATGG - Intergenic
1022403546 7:30064799-30064821 TTGGAAATGCAGAAGATACAGGG + Intronic
1022561355 7:31353106-31353128 TGAAATATACAGATGATTCAGGG + Intergenic
1024329284 7:48140236-48140258 TCAGGCATGCAGATGATCAAAGG - Intergenic
1034507414 7:151504428-151504450 TCATATATGCAGATTCTGCAGGG - Intronic
1036676114 8:10834799-10834821 TCAGCAATGGAGATGATACCCGG + Intronic
1037099123 8:15021337-15021359 TCACACATTCAGAAGATACAAGG - Intronic
1037551816 8:19981779-19981801 ACAGATTTGAAGATGCTACATGG - Intergenic
1038095349 8:24303021-24303043 TCAAATATGCAGAATCTACAAGG - Intronic
1038315844 8:26483749-26483771 TCAGAGAAGGAAATGATACAAGG - Intronic
1039878757 8:41610127-41610149 TCTGATATGCAGAGAATCCAAGG - Intronic
1040854906 8:51938608-51938630 TCTAATCTGCAGAGGATACAAGG + Intergenic
1041338932 8:56821669-56821691 TCACATATTCAAATGACACATGG - Intergenic
1042430899 8:68705403-68705425 TCAGATATGCAGGAGAGAGAAGG + Intronic
1042702391 8:71629989-71630011 ACAGATATACAGATAATATATGG - Intergenic
1043234601 8:77847036-77847058 TCAGATGAGAAGATGATACAAGG - Intergenic
1043317626 8:78941049-78941071 TCAGGAATGGAGATGATGCATGG - Intergenic
1043653646 8:82633156-82633178 TCAGATATGAAAATCAAACATGG - Intergenic
1043946208 8:86255690-86255712 TTAGATTTGCCAATGATACATGG - Intronic
1043982754 8:86659857-86659879 TCAGGTTAGCAGATGATGCAGGG + Intronic
1044433796 8:92138569-92138591 TCTGGTTTGCAGATGACACATGG - Intergenic
1044843818 8:96360847-96360869 TCAGAAAGGCAGCTGAGACATGG + Intergenic
1045477656 8:102567011-102567033 TCAGAAATTCAGATGGGACATGG + Intergenic
1050452995 9:5803702-5803724 TCAAAAATACAGATGATATAAGG + Intronic
1051461125 9:17317556-17317578 TCTGATAAGCACATGACACACGG + Intronic
1055332249 9:75196731-75196753 TCAGATTTGCATTTGAGACAGGG - Intergenic
1055758199 9:79577800-79577822 TTAGAAATGTAGATGGTACAAGG - Intronic
1056493440 9:87131290-87131312 TCATATATGATGATGATATATGG - Intergenic
1056898705 9:90578136-90578158 GCAGGTTTGCAGATTATACACGG - Intergenic
1058165441 9:101613691-101613713 TCAGAGATGCAGCTGATTTAAGG - Intronic
1059032097 9:110709676-110709698 TCAGAGATAAAGATGACACATGG - Intronic
1059650715 9:116313449-116313471 TCAGAGATGCAGATGCCACCTGG + Intronic
1062046337 9:134426186-134426208 TCAGTGATGCAGAGGATACCAGG - Intronic
1185498440 X:577578-577600 ATAGATATACAGATGATAGATGG + Intergenic
1185809409 X:3092013-3092035 ACAGATATATAGATGATAGATGG + Intronic
1189900674 X:45703057-45703079 ACAGATATGGGGCTGATACATGG - Intergenic
1193940150 X:87672749-87672771 TTAGATATTTAGATGAAACATGG - Intergenic
1195562623 X:106300772-106300794 TCAGTCATGCAGGTGCTACATGG - Intergenic
1197061677 X:122189334-122189356 TCAGATCTGTAAAGGATACACGG + Intergenic
1197165059 X:123368142-123368164 TCTGATAGGCAGATGCTTCATGG + Intronic
1199056909 X:143307431-143307453 TCAGGTGTGCAGATGATCAAAGG + Intergenic
1199556170 X:149111566-149111588 TCAGATATCCAGAATTTACAAGG + Intergenic