ID: 1135848455

View in Genome Browser
Species Human (GRCh38)
Location 16:25940479-25940501
Sequence AGGGATTTACAACATGAGCA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 186
Summary {0: 1, 1: 0, 2: 0, 3: 24, 4: 161}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1135848447_1135848455 26 Left 1135848447 16:25940430-25940452 CCAAAATGCCCAAGATGTCAAGG 0: 1
1: 0
2: 0
3: 15
4: 212
Right 1135848455 16:25940479-25940501 AGGGATTTACAACATGAGCAGGG 0: 1
1: 0
2: 0
3: 24
4: 161
1135848450_1135848455 17 Left 1135848450 16:25940439-25940461 CCAAGATGTCAAGGCAAAGCATA 0: 1
1: 1
2: 0
3: 5
4: 209
Right 1135848455 16:25940479-25940501 AGGGATTTACAACATGAGCAGGG 0: 1
1: 0
2: 0
3: 24
4: 161
1135848449_1135848455 18 Left 1135848449 16:25940438-25940460 CCCAAGATGTCAAGGCAAAGCAT 0: 1
1: 0
2: 1
3: 9
4: 147
Right 1135848455 16:25940479-25940501 AGGGATTTACAACATGAGCAGGG 0: 1
1: 0
2: 0
3: 24
4: 161

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1135848455 Original CRISPR AGGGATTTACAACATGAGCA GGG Intronic
901356804 1:8657107-8657129 AGGGTTTTACCACATTAGCAAGG - Intronic
901690339 1:10969116-10969138 AGGAATTTCCAGAATGAGCAGGG + Intronic
904353197 1:29922234-29922256 AGGAATTTAAAACAGGAGCAGGG - Intergenic
906255867 1:44349521-44349543 AGGAATTTACAACTAAAGCAAGG - Intronic
906425040 1:45704562-45704584 AGGTATTTACAACATGGAAAGGG + Intronic
906455136 1:45988893-45988915 AGAAATATACAACATGAGCCTGG - Intronic
910416132 1:87001061-87001083 AGTGATATACAACATTATCAGGG - Intronic
910423426 1:87095242-87095264 AGGTATTTCCAACATAATCATGG - Intronic
910465883 1:87499335-87499357 ATGGATTTAGAACATGATCTAGG - Intergenic
911038978 1:93577656-93577678 AGAGATTTACAACTTGACCTTGG + Intronic
911168758 1:94748045-94748067 AGGAATTTACAATATGATAAAGG - Intergenic
914250154 1:145915384-145915406 AGTGATTTACAACTTTAACATGG - Intronic
914493056 1:148165485-148165507 ATGGATTTAGAACATGATCTAGG + Intergenic
916263098 1:162862029-162862051 AGGGAATTACCTCATGAGAAAGG - Intronic
918987014 1:191644501-191644523 AGGGATGTGCAACTTGAGAAAGG + Intergenic
920755280 1:208724560-208724582 AGGGATTTACATCATGCCCAAGG + Intergenic
921019039 1:211219809-211219831 AGGGATTGAGAAAATGAGGAGGG - Intergenic
924948421 1:248861468-248861490 CGAGATTTACAAGATGAGAAGGG - Intergenic
1063251656 10:4281060-4281082 AGAGATTAACAAGATTAGCAAGG + Intergenic
1063369989 10:5514926-5514948 AGGGATTTTCTGCAGGAGCATGG - Intergenic
1068772183 10:60834252-60834274 ATGTATTTATAACATGGGCAAGG + Intergenic
1072192765 10:93089719-93089741 AGGGATTTACTAGAGGAGCCTGG + Intergenic
1072978676 10:100081120-100081142 AGGGATATGGGACATGAGCAGGG + Intronic
1072993601 10:100222952-100222974 AGGCCTTTACAACATTGGCATGG + Exonic
1073862815 10:107766928-107766950 AGGCATTAACAAAATTAGCATGG + Intergenic
1076947063 10:133658681-133658703 GGTGATTTACAACATCTGCAAGG - Intergenic
1078087758 11:8244271-8244293 AGGAAATTACAACATGGGCCTGG + Intronic
1078402626 11:11041485-11041507 AGGAATGTACAAGATGAGCCTGG - Intergenic
1079314028 11:19392348-19392370 AGGAATATACAATTTGAGCAGGG + Intronic
1079338833 11:19595496-19595518 GGGGTTTTACAACTTGATCAAGG + Intronic
1080603363 11:33842600-33842622 CTGGATTTACAACAGGAGCCTGG + Intergenic
1083519040 11:63290242-63290264 AGGGATTAATAACATGAGAGAGG - Exonic
1085468501 11:76740415-76740437 AGGAACTTACAAGATGAGCCTGG + Intergenic
1085592356 11:77775632-77775654 AGGTATTTAAAACTTGAGCAGGG + Intronic
1086206798 11:84268149-84268171 AGGGGTTTACAAGATGAGGGAGG - Intronic
1088600407 11:111469343-111469365 AGGTATTTATAACATGTACAGGG + Intronic
1095088830 12:38085879-38085901 GGTGATTTACAACATGTGCAAGG + Intergenic
1095621590 12:44262370-44262392 AGAGAGTTAAAACATGACCAAGG + Intronic
1096658187 12:53104767-53104789 AGGGAGTGACAGCAGGAGCAAGG - Intronic
1098361795 12:69661622-69661644 AAGGATTTATAAAATGGGCAAGG + Intronic
1100434115 12:94555872-94555894 AGGAAAGTACAACATGAGCCTGG + Intergenic
1100676889 12:96878238-96878260 AGGGATGTAGAAGCTGAGCAGGG - Intergenic
1101119625 12:101565452-101565474 AGGGAGTTACAAAATGAGGTTGG - Intergenic
1103283947 12:119784762-119784784 AAGGATTTACAGCAACAGCAAGG + Intronic
1105340720 13:19522817-19522839 AGGGTTTCACCACATTAGCAAGG + Intronic
1109202714 13:59448809-59448831 AGGGATTTGCCACATGTACATGG + Intergenic
1110476121 13:75916140-75916162 AGGGTTTTACCACATTAGCCAGG + Intergenic
1110620547 13:77589686-77589708 AGGTATTTGTAACATAAGCAAGG - Intronic
1111467528 13:88634990-88635012 AGGGCTTTACTACATGTTCATGG - Intergenic
1117359450 14:54958843-54958865 AGCAATTTAAACCATGAGCATGG - Intronic
1119257365 14:73209791-73209813 AGAGAGGGACAACATGAGCAAGG + Intronic
1119860862 14:77935073-77935095 TGGGATCTAAAACATCAGCATGG + Intergenic
1202921127 14_KI270723v1_random:31236-31258 GGTGATTTACAACATCTGCAAGG - Intergenic
1202923783 14_KI270724v1_random:6344-6366 GGTGATTTACAACATCTGCAAGG + Intergenic
1123679664 15:22752090-22752112 AGGAATTTAAAAAATAAGCAAGG + Intergenic
1123906716 15:24928958-24928980 AGAGAGATACAACATGAGCTTGG - Intronic
1127186234 15:56483756-56483778 AGGGATTTACATCATGCACCAGG - Intergenic
1128838331 15:70829330-70829352 AGGGTTTTACCACATTAGCCAGG + Exonic
1135525211 16:23208901-23208923 AGGGATTAGAAAGATGAGCAGGG - Intronic
1135848455 16:25940479-25940501 AGGGATTTACAACATGAGCAGGG + Intronic
1137426737 16:48386052-48386074 AGGGACTTTCCAGATGAGCATGG - Intronic
1137627084 16:49916092-49916114 AGGGATAAACAACATTAGCAGGG - Intergenic
1139878379 16:70164424-70164446 AGGGACTTACAGAAGGAGCAGGG - Intergenic
1140359184 16:74330392-74330414 AGGGACTTACAGAACGAGCAGGG + Intergenic
1140404347 16:74698365-74698387 ATGGCTTTAAAACATGAGTAAGG + Intronic
1142625328 17:1188022-1188044 AGGGTTTCACCACATGAGCCAGG - Intronic
1143226053 17:5304386-5304408 AGGGCTTTACCACATTAGCCAGG - Intronic
1146067565 17:29648592-29648614 AGGCATTTACAATATGTGTAAGG + Intronic
1146073141 17:29702461-29702483 AGGGTTTTACCACATTAGCCAGG - Intronic
1146618731 17:34378972-34378994 AGTGATTTAAAACATCTGCATGG - Intergenic
1147034386 17:37669718-37669740 AGGGATTCACACCATGAACGTGG - Intergenic
1148259757 17:46171179-46171201 AGGCATATACAACATCAGCTGGG - Exonic
1148490665 17:48022051-48022073 AGGGAGCAACAACATAAGCAAGG - Intergenic
1148509934 17:48159937-48159959 AGGGATTTGCAACATGGGGAAGG + Intronic
1150788475 17:68181222-68181244 AGGGTTTTACAACATTGGCCAGG + Intergenic
1150913370 17:69411806-69411828 GGGGATTTAAAACAGAAGCATGG + Intergenic
1203170965 17_GL000205v2_random:147639-147661 GGTGATTTACAACATGTGCAAGG - Intergenic
1156192776 18:34738843-34738865 AGTGATTTGCAACATGATCTCGG - Intronic
1157648716 18:49304809-49304831 AGAAATTTACAAAATGAGCACGG - Intronic
1159672646 18:71240894-71240916 AGGCATTTAAAACATAAGCATGG - Intergenic
1164552778 19:29225633-29225655 ATGGAATGACCACATGAGCAAGG + Intergenic
1166766260 19:45253226-45253248 AGGGATCTGCAAGATGAGGAAGG - Intronic
1167296282 19:48652081-48652103 AGGGAAAGACATCATGAGCATGG - Intergenic
927374809 2:22401429-22401451 AGATATTTAGAAAATGAGCAGGG - Intergenic
928969757 2:37015541-37015563 AGGGAGATACAAAAAGAGCAAGG + Intronic
929308109 2:40389260-40389282 AGGGATTCACAACATTATAAAGG - Intronic
931214371 2:60227486-60227508 AGGGTCTTACCAGATGAGCAAGG + Intergenic
931525585 2:63148772-63148794 AGGAATTTACAAGATGAGTCTGG + Intronic
931554714 2:63489559-63489581 AGGAAATTACAACATGAGTCTGG + Intronic
937138635 2:119577922-119577944 ATGGATCTACAACTTGGGCATGG + Intronic
937429734 2:121828126-121828148 AGGGTTTTACAACATGCAAATGG + Intergenic
940176932 2:150888480-150888502 AGAGACTCACACCATGAGCATGG + Intergenic
943108953 2:183582224-183582246 AGAGAGATACAACATGAGAATGG - Intergenic
945170674 2:206991535-206991557 AGGGGATGACAAGATGAGCAGGG + Intergenic
946899197 2:224355921-224355943 AGGGATGTACAGGGTGAGCAGGG + Intergenic
947430105 2:230020647-230020669 AGGCATTTAAATAATGAGCAAGG + Intergenic
947466652 2:230355715-230355737 AGCAATTTACAATATGAACATGG - Intronic
948128463 2:235582631-235582653 AGTGTTTTACAACAAAAGCACGG + Intronic
1170230989 20:14045776-14045798 GGGAATTAAAAACATGAGCAGGG + Intronic
1170912159 20:20583541-20583563 TGGGACTTACAAAATGAGGATGG + Intronic
1174061439 20:47835698-47835720 GGGGGTTTTCAACCTGAGCAAGG - Intergenic
1176326949 21:5509470-5509492 GGTGATTTACAACATGTGCAAGG - Intergenic
1176330758 21:5546741-5546763 GGTGTTTTACAACATGTGCAAGG + Intergenic
1176396999 21:6274210-6274232 GGTGTTTTACAACATGTGCAAGG - Intergenic
1176400808 21:6311481-6311503 GGTGATTTACAACATGTGCAAGG + Intergenic
1176436349 21:6677623-6677645 GGTGATTTACAACATGTGCAAGG - Intergenic
1176440158 21:6714894-6714916 GGTGTTTTACAACATGTGCAAGG + Intergenic
1176460611 21:7004693-7004715 GGTGATTTACAACATGTGCAAGG - Intergenic
1176464420 21:7041963-7041985 GGTGTTTTACAACATGTGCAAGG + Intergenic
1176484172 21:7386471-7386493 GGTGATTTACAACATGTGCAAGG - Intergenic
1176487981 21:7423742-7423764 GGTGTTTTACAACATGTGCAAGG + Intergenic
1178369315 21:32014118-32014140 AGGGAAATACAACATGAGCTTGG - Intronic
1178418315 21:32422090-32422112 AGGAATCTAAAACATGAGAAAGG + Intronic
1183839660 22:40488206-40488228 AGAGATGAACAACATGAGCTAGG + Intronic
1184237215 22:43189322-43189344 CAGGATTTACAAAGTGAGCATGG - Intergenic
950429164 3:12941025-12941047 GGGGATTTCCCACAGGAGCAGGG + Intronic
955027639 3:55185518-55185540 AGGTGCTTGCAACATGAGCACGG - Intergenic
957549690 3:81687732-81687754 ACAGATTTACAAGGTGAGCACGG + Intronic
958706325 3:97661089-97661111 CTGGATTTACAAAAAGAGCAGGG - Intronic
960385109 3:117013135-117013157 AGAGAATTACAACATCAGAAGGG - Intronic
960624845 3:119672527-119672549 AGGGAGTTAGATCATGAACAAGG + Intronic
966391338 3:179455749-179455771 ATGAATTTCCAACATGGGCAGGG + Intergenic
967305381 3:188053898-188053920 AGGGATTTGCAAGCTCAGCACGG + Intergenic
967876095 3:194269586-194269608 GGAGATTTCCAACATGAGAAAGG - Intergenic
969125921 4:4947925-4947947 AGGAAGTTTCAACATGTGCAAGG - Intergenic
969222706 4:5771784-5771806 AGGGTTATACACCATGACCAAGG + Intronic
971453466 4:26821747-26821769 AGGGACTTCCAGCATGACCACGG - Intergenic
972880431 4:43416542-43416564 AGGGAGTTTCAGCAAGAGCAGGG + Intergenic
973614076 4:52661810-52661832 AGGTGTTTGCAACATGAGGAAGG + Intergenic
973981776 4:56314037-56314059 TAGGATCCACAACATGAGCAAGG + Exonic
975998481 4:80343079-80343101 AGGGATGTACATAATGAGAAAGG + Intronic
976888552 4:90015759-90015781 AGGAATTTACCAAATGAGGAAGG - Intergenic
983859270 4:172685009-172685031 AGGTATTTACAATATGTACAAGG - Intronic
984505390 4:180611006-180611028 AGGGATTTTAAGCAAGAGCATGG + Intergenic
984677905 4:182571203-182571225 AAAGTTTTACAACATGAACAGGG - Intronic
985450524 4:190059480-190059502 GGTGATTTACAACATCTGCAAGG - Intergenic
988231612 5:28487057-28487079 GGGCATTTAGATCATGAGCATGG + Intergenic
989507646 5:42246026-42246048 AGGGGTTTGCAAGATGAGAAAGG - Intergenic
990844326 5:60120664-60120686 AGGTATATAATACATGAGCAGGG - Intronic
991551415 5:67840911-67840933 AGGGATATACAAGATGACCCTGG - Intergenic
991937733 5:71818403-71818425 AGGGACCCAAAACATGAGCAGGG - Intergenic
992529626 5:77641741-77641763 AGGCATTTCCCACATGATCATGG + Intergenic
993139703 5:84016177-84016199 ACAGATTTACAACATGACAAAGG - Intronic
993736545 5:91483433-91483455 AGGATTTTACAACATAAGGAAGG - Intergenic
995041890 5:107597756-107597778 AGAGATTTTCAACATGATAAAGG + Intronic
997417498 5:133740362-133740384 AGGGATTAACAAAATGGGCCTGG - Intergenic
997786797 5:136720966-136720988 GGGGATTTACAAAATGATTAAGG + Intergenic
998329643 5:141313251-141313273 AGGTATTTTCAATATCAGCATGG - Intergenic
1003254058 6:4459148-4459170 GTGGATTTACACCATGAGCCAGG + Intergenic
1005074482 6:21893149-21893171 AGGGATTTTCAAATTGTGCAGGG - Intergenic
1007325923 6:41059494-41059516 AGGGATTGAGAAGAGGAGCAGGG + Intronic
1012945256 6:105459133-105459155 AAGGATTTGCAACAAGAACATGG - Intergenic
1020560105 7:9720258-9720280 AGGAAATGAGAACATGAGCAAGG + Intergenic
1020704673 7:11529498-11529520 AGGTATTTACATCATGGGGATGG + Intronic
1024585883 7:50841984-50842006 AGGGATTTACCACAGGATCCTGG + Intergenic
1029181905 7:98708259-98708281 AGGGTTTCACCACATTAGCAAGG - Intergenic
1030350924 7:108485524-108485546 AGGGATTTTCAAAATGAGACTGG + Intronic
1031695423 7:124845964-124845986 AGGGAATTACAAGATTAGTATGG - Intronic
1033390817 7:140925199-140925221 TGGGATTTACTAGAAGAGCAGGG + Intergenic
1033429450 7:141275645-141275667 AGCTATTTACATTATGAGCAAGG - Intronic
1034081499 7:148282014-148282036 AGGGTTTTACCACATGAGCCAGG + Intronic
1038377132 8:27051987-27052009 AGGGATATAAAACATAATCAAGG + Intergenic
1039449610 8:37661466-37661488 ATGGCTTTACAACATAAGCTAGG + Intergenic
1039942797 8:42105592-42105614 AGGGAGATACAAAATGAGAAGGG + Intergenic
1042092113 8:65169773-65169795 AGAGAGATACATCATGAGCAAGG + Intergenic
1044428535 8:92082299-92082321 AGGAATTTTCTACATGAACAGGG - Intronic
1045582185 8:103494008-103494030 AGGGATTTAAACCATGACCTTGG + Intergenic
1046169252 8:110483895-110483917 AGGGATTTAAAACTTGAAAATGG - Intergenic
1047588523 8:126301336-126301358 AGGGCTTTAAAAAATGAGCATGG + Intergenic
1050203501 9:3174011-3174033 AGGGATTTTCATCAGCAGCATGG + Intergenic
1050747543 9:8894160-8894182 AGGGTTTTACCACATTAGCCAGG - Intronic
1055691313 9:78834385-78834407 AGAGATTTAAAAAATGAGAAAGG + Intergenic
1057117052 9:92534698-92534720 AGGGAATAACAACAACAGCAGGG + Intronic
1059518342 9:114916460-114916482 AGGGATTTTTAACATGAACACGG - Intronic
1203431337 Un_GL000195v1:93585-93607 GGTGTTTTACAACATGTGCAAGG - Intergenic
1203435167 Un_GL000195v1:131038-131060 GGTGATTTACAACATGTGCAAGG + Intergenic
1185813458 X:3131886-3131908 AGAGTTTTGCAAAATGAGCATGG - Intergenic
1188612491 X:32117553-32117575 AGGGGTTAAAAACATGAGCATGG - Intronic
1188749714 X:33889976-33889998 AGAGATTTTCAACATCAGGAAGG - Intergenic
1192772883 X:74211807-74211829 AGAGATTTACAAAATTAGAAAGG + Intergenic
1197864310 X:131001358-131001380 AGGGAATTATAACATAAGCAGGG - Intergenic
1198567598 X:137920777-137920799 AGAGATTTTGAACATGAGAATGG - Intergenic
1198783768 X:140265265-140265287 AGACAATTACAATATGAGCAAGG - Intergenic
1201268143 Y:12228652-12228674 AGAGTTTTGCAAAATGAGCATGG + Intergenic
1201771645 Y:17622077-17622099 GGTGATTTACAACATGTGCAAGG - Intergenic
1201829910 Y:18283909-18283931 GGTGATTTACAACATGTGCAAGG + Intergenic