ID: 1135849832

View in Genome Browser
Species Human (GRCh38)
Location 16:25953242-25953264
Sequence CATTTCACAAAGATCTTCCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 261
Summary {0: 1, 1: 0, 2: 4, 3: 27, 4: 229}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1135849832_1135849833 -4 Left 1135849832 16:25953242-25953264 CCAGGGAAGATCTTTGTGAAATG 0: 1
1: 0
2: 4
3: 27
4: 229
Right 1135849833 16:25953261-25953283 AATGCTATTTATGCTTCATCAGG 0: 1
1: 0
2: 1
3: 11
4: 158

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1135849832 Original CRISPR CATTTCACAAAGATCTTCCC TGG (reversed) Intronic
902086259 1:13865136-13865158 CATTTTACACACAGCTTCCCAGG - Intergenic
902329089 1:15722021-15722043 AAATTCACAAAGCTATTCCCAGG + Intronic
903458592 1:23505321-23505343 CATTTTAGAAAGATCTTTCTGGG + Intergenic
904817589 1:33217091-33217113 CGTGGCACAAAGATGTTCCCAGG + Intergenic
905917279 1:41694489-41694511 CATTTCACAATTAGCTTTCCAGG - Intronic
907280812 1:53346093-53346115 CAGCCCACCAAGATCTTCCCTGG - Intergenic
908153300 1:61326736-61326758 CCTCTCACAAAAGTCTTCCCTGG - Intronic
908855565 1:68423171-68423193 CTTGTCAGAAAGACCTTCCCTGG + Intergenic
909131292 1:71740533-71740555 CATCCCACAAAGATGTTTCCTGG + Intronic
909948204 1:81688158-81688180 CTTTTCACAATGAATTTCCCAGG + Intronic
913611086 1:120510404-120510426 CATTTAAAAAAAGTCTTCCCTGG + Intergenic
914580104 1:149011835-149011857 CATTTAAAAAAAGTCTTCCCTGG - Intronic
914856531 1:151355774-151355796 CCTGTCACAAAGGCCTTCCCAGG - Intergenic
917056757 1:170990980-170991002 CATCTTACAAAGATCTTTCTAGG - Intronic
918067778 1:181113144-181113166 CATTTCCCAAGGATCTTCCCAGG - Intergenic
918464447 1:184807184-184807206 CATTTCACACAGATATTCTGAGG - Intronic
920459255 1:206126694-206126716 CATTGCACAGAGACCTTCCTGGG + Intergenic
921478763 1:215639761-215639783 CCTTTCCCAAAGAGCTGCCCAGG + Intronic
1063197894 10:3760066-3760088 CATTTCAAAAAGAACTAACCTGG - Intergenic
1063888248 10:10601506-10601528 CATTTCAGAAGGAGCTTTCCTGG - Intergenic
1064252928 10:13720698-13720720 CACTTCACCAACACCTTCCCTGG - Intronic
1066811101 10:39336518-39336540 CACATCACAAAGATGTTTCCAGG + Intergenic
1067186827 10:44036293-44036315 CTTCTCAGAGAGATCTTCCCTGG + Intergenic
1067489304 10:46683287-46683309 CCTTTCACAATGACCTTCCCAGG - Intergenic
1067605366 10:47657098-47657120 CCTTTCACAATGACCTTCCCAGG + Intergenic
1069213692 10:65793265-65793287 CATGTCAGAAAGAAATTCCCAGG + Intergenic
1070080225 10:73178649-73178671 TATATCACAAATATTTTCCCAGG - Intronic
1071620926 10:87118493-87118515 CCTTTCACAATGACCTTCCCAGG + Intronic
1073328945 10:102658493-102658515 CATTTGACAAATATTTGCCCAGG + Intergenic
1074581629 10:114724717-114724739 CCTTTCACAAAGACTTTCCAAGG + Intergenic
1076255735 10:129023056-129023078 TTTTTCACAAAGATCTTGCAGGG + Intergenic
1080298807 11:30760669-30760691 CATTTCAGAAAGATATTCTTAGG + Intergenic
1080570571 11:33552974-33552996 CATTTCCCAGGGATTTTCCCTGG - Intronic
1081248754 11:40802898-40802920 AAATTCACAAAGATGTTCCTTGG - Intronic
1081775868 11:45675573-45675595 CATTCCAGAAAAGTCTTCCCTGG + Intergenic
1082609102 11:55277871-55277893 AATTTCACAAAGAACATCACAGG - Intergenic
1087082752 11:94187568-94187590 AACTTCATAAACATCTTCCCTGG - Intergenic
1088672909 11:112161102-112161124 CACCTCAGAAAGATCCTCCCAGG + Intronic
1089416007 11:118291221-118291243 CATTTCCAAAACATCTTCCGGGG - Intergenic
1090305108 11:125684490-125684512 GATGTCACAAAGAAATTCCCAGG + Intergenic
1090559388 11:127914331-127914353 CATTTTGCAATGATTTTCCCAGG + Intergenic
1091459482 12:633103-633125 CAGTTCTCAGAGAACTTCCCTGG - Intronic
1093035541 12:14329097-14329119 CCTTTGACCAACATCTTCCCTGG - Intergenic
1093322279 12:17726956-17726978 CATTGCACAATGATCTTTCCAGG - Intergenic
1093999767 12:25682573-25682595 CAATTCACAAAGTTCTGGCCTGG + Intergenic
1097936075 12:65252875-65252897 CTCTTCACAGAGATCTTCTCTGG + Intergenic
1098633073 12:72748377-72748399 CATTTCAAAGAGATGGTCCCAGG + Intergenic
1098738525 12:74139896-74139918 CTTTTCACAAAGAAAATCCCAGG + Intergenic
1099645219 12:85344475-85344497 CATTTCAATAAGGACTTCCCTGG - Intergenic
1100903506 12:99270742-99270764 CATTACACAAAGCTCTTCATTGG + Intronic
1102304349 12:111793002-111793024 CAATTTACAAAGTGCTTCCCAGG - Intronic
1103689924 12:122763953-122763975 CTTTTCAGCAAAATCTTCCCTGG - Intronic
1108006858 13:45956799-45956821 CATTTCACAAAAATATTCATAGG + Intronic
1109138840 13:58687932-58687954 CATTTTACAAACATCTTGCTAGG - Intergenic
1109620432 13:64897664-64897686 CATTTTAAAAAGATATTCCAGGG + Intergenic
1109743928 13:66595153-66595175 CATTTCAAAGAGATGTTCCCAGG - Intronic
1110355136 13:74558797-74558819 AATATTACAAAGATCTCCCCAGG - Intergenic
1110725980 13:78824264-78824286 CATTTCAGAAAGATCTTACAAGG + Intergenic
1111376986 13:87393173-87393195 CATTTCCAAAAGATCATCCCCGG - Intergenic
1111555279 13:89872936-89872958 CATTTCACCAAAAACATCCCAGG - Intergenic
1111761609 13:92473090-92473112 CATTTCACAACTAGATTCCCAGG + Intronic
1112046587 13:95603858-95603880 CATTTTACCTAGATCCTCCCAGG + Intronic
1112677649 13:101722065-101722087 CATATCATAGAGAGCTTCCCTGG + Exonic
1112810454 13:103212561-103212583 CATTTTACAAAGATACTCCTGGG - Intergenic
1116751103 14:48885052-48885074 CATTTTACAAAGATAATTCCAGG - Intergenic
1118731429 14:68669733-68669755 AATTTCACAAAGCTCTTACTGGG - Intronic
1121488783 14:94343117-94343139 CATGTCACAAACATGTTCCCAGG + Intergenic
1122204128 14:100139917-100139939 CATTTTGCCAAGATCTTCCAGGG + Intronic
1122254931 14:100469580-100469602 CTTCTCACAAAGCACTTCCCTGG + Intronic
1123964852 15:25444686-25444708 CTTTTCAATAAGATCTTCCCTGG - Intergenic
1124410735 15:29434308-29434330 CCTTTCAAAAAGATGTTCCCTGG + Intronic
1125125252 15:36212171-36212193 GATTTCAGAAAGATCTTCTCAGG + Intergenic
1126268089 15:46778654-46778676 CATTTCAACAAGTTCTTTCCAGG + Intergenic
1126445437 15:48738415-48738437 CAATTCACACTGATCTTTCCTGG + Exonic
1126930379 15:53642314-53642336 CAGTACATAAAGATCTACCCTGG - Intronic
1126977449 15:54199344-54199366 CATTTTACAATGAATTTCCCAGG - Intronic
1133415927 16:5607014-5607036 CATTTTAGAAAGATCTCCCTGGG + Intergenic
1134050887 16:11136628-11136650 TCTTTCACAAAGACTTTCCCTGG + Intronic
1135849832 16:25953242-25953264 CATTTCACAAAGATCTTCCCTGG - Intronic
1141701133 16:85642645-85642667 CATCTCACAAAGACGTTCCAGGG + Intronic
1141745696 16:85924677-85924699 CCTTTCAGGAAGATTTTCCCAGG - Intergenic
1141774722 16:86115532-86115554 CATGTCACAAAGAGCTGCTCAGG + Intergenic
1146686522 17:34844911-34844933 CATTTAACAAAGTTCTTTACTGG - Intergenic
1150940569 17:69688790-69688812 CATTCCACAAAGATCTTCCAAGG + Intergenic
1151141701 17:71999259-71999281 AAGTTCTCAAAGTTCTTCCCTGG - Intergenic
1151968366 17:77444240-77444262 CTTTTCCCAAACAGCTTCCCAGG - Intronic
1152853280 17:82649485-82649507 CAGGTCACAGAGACCTTCCCAGG + Intergenic
1153848712 18:9072855-9072877 CATTTCAAATAGATCTGGCCGGG + Intergenic
1155160105 18:23188847-23188869 CATCTCCCAGAGATCTTCCTTGG + Exonic
1155732396 18:29177700-29177722 GAGGTCACAAAGATTTTCCCTGG + Intergenic
1155915486 18:31553164-31553186 CATTTCAAAAAGATAGCCCCAGG + Intergenic
1156681554 18:39595260-39595282 TATTTCACAAAGATCCTCAGAGG + Intergenic
1156778134 18:40818782-40818804 AATTTCATAACAATCTTCCCAGG - Intergenic
1157752765 18:50194109-50194131 AAATTCACAATGCTCTTCCCTGG + Intronic
1159648491 18:70948751-70948773 TATCTCACAAAGATATTCCTTGG - Intergenic
1163257773 19:16168044-16168066 CACATCACAAATATCTCCCCAGG - Intronic
1163918023 19:20259913-20259935 CATTTCACTAAGATGTTCACAGG - Intergenic
1168450592 19:56463311-56463333 CATGCCACCAACATCTTCCCCGG - Intronic
1168505681 19:56932842-56932864 CATCCTAGAAAGATCTTCCCTGG + Intergenic
925015940 2:524115-524137 CATTTCTCAAAGTACTTTCCAGG + Intergenic
925737645 2:6978358-6978380 CATTTCAACAAGATCCTTCCTGG + Intronic
926104073 2:10139404-10139426 CATTTCAGAAGGATCTTTCCTGG + Intergenic
926686262 2:15700270-15700292 TCTTTCAGAAAAATCTTCCCTGG - Intronic
929730588 2:44487681-44487703 CATTTCACATATCTCATCCCAGG - Intronic
931096313 2:58944524-58944546 CATTTGAAAAATATGTTCCCTGG + Intergenic
932968297 2:76505014-76505036 TATTTCTCCAAGATCTTCCAGGG + Intergenic
933044485 2:77518585-77518607 CATTTCACAAAATTATTGCCGGG - Exonic
933972354 2:87480458-87480480 CATTCCACCAAGATATTCCAAGG + Intergenic
934338476 2:92225869-92225891 AATTTCACAAAGAACTTTCTGGG - Intergenic
934357231 2:92522759-92522781 AATTTCACAAAGAACTTTCTGGG - Intergenic
934358190 2:92538050-92538072 AATTTCACAAAGAACTTTCTGGG - Intergenic
934359759 2:92563030-92563052 AATTTCACAAAGAACTTTCTGGG - Intergenic
934374376 2:92797326-92797348 AATTTCACAAAGAACTTTCTGGG - Intergenic
934377112 2:92840838-92840860 AATTTCACAAAGAACTTTCTGGG - Intergenic
934377722 2:92850674-92850696 AATTTCACAAAGAACTTTCTGGG - Intergenic
934378942 2:92870223-92870245 AATTTCACAAAGAGCTTTCTGGG - Intergenic
934386320 2:92989008-92989030 AATTTCACAAAGAACTTTCTGGG - Intergenic
934390645 2:93058975-93058997 AATTTCACAAAGAACTTTCTGGG - Intergenic
934397716 2:93173239-93173261 AATTTCACAAAGAACTTTCTGGG - Intergenic
934407214 2:93326771-93326793 AATTTCACAAAGAGCTTTCTGGG - Intergenic
934407520 2:93331695-93331717 AATTTCACAAAGAGCTTTACTGG - Intergenic
934414117 2:93437347-93437369 AATTTCACAAAGAACTTTCTGGG - Intergenic
934426866 2:93642039-93642061 AATTTCACAAAGAGCTTTCTGGG - Intergenic
934431474 2:93716343-93716365 AATTTCACAAAGAACTTTCTGGG - Intergenic
934432540 2:93733669-93733691 AATTTCACAAAGAACTTTCTGGG - Intergenic
934433144 2:93743515-93743537 AATTTCACAAAGAACTTTCTGGG - Intergenic
934434682 2:93768472-93768494 AATTTCACAAAGAACTTTCTGGG - Intergenic
934435107 2:93775097-93775119 AATTTCACAAAGAACTTTCTGGG - Intergenic
934437274 2:93810081-93810103 AATTTCACAAAGAACTTTCTAGG - Intergenic
934446668 2:93962069-93962091 AATTTCACAAAGAACTTTCTGGG - Intergenic
934447675 2:93978192-93978214 AATTTCACAAAGAACTTTCTGGG - Intergenic
934451428 2:94038959-94038981 AATTTCACAAAGATCTTTCTGGG - Intergenic
934454762 2:94142381-94142403 AATTTCACAAAGAACTTTCTGGG - Intergenic
934455015 2:94146458-94146480 AATTTCACAAAGAACTTTCTGGG - Intergenic
934455145 2:94148498-94148520 AATTTCACAAAGAACTTTCTGGG - Intergenic
934666555 2:96175434-96175456 CAAGTCACACAGCTCTTCCCTGG - Intergenic
935152087 2:100446962-100446984 CATTTAGCAATGATCTTCCTTGG - Intergenic
935355919 2:102199827-102199849 CATTTCATAAACCTCTTCCCTGG - Intronic
936241454 2:110791750-110791772 CATTTCACAAAGTTAATACCAGG + Intronic
936309824 2:111375032-111375054 CCTTTCCCAAAGATCTTGCCGGG + Intergenic
936321376 2:111469730-111469752 CATTCCACCAAGATATTCCAAGG - Intergenic
937489782 2:122353753-122353775 CATTTCACAAAGAAAATTCCAGG + Intergenic
938703555 2:133900264-133900286 CACTTCAGAGAGACCTTCCCAGG + Intergenic
938781137 2:134585953-134585975 CCATGCACAAAAATCTTCCCTGG - Intronic
940490337 2:154351211-154351233 CATTTCCAAAAGATATTCCATGG - Intronic
940625435 2:156169593-156169615 CCTTTGACAAAAATCTTCCCAGG - Intergenic
941082400 2:161077310-161077332 CATTTCTCACAGTTCTTCCAAGG - Intergenic
942428168 2:175881067-175881089 CATTCCAAAAAGATCCCCCCAGG - Intergenic
943473908 2:188331088-188331110 AATTTCACAACCATCTTCCCAGG + Intronic
943886249 2:193220104-193220126 CATTTCAAATTGAACTTCCCTGG - Intergenic
945432403 2:209779426-209779448 CACTTCAGAAAGTACTTCCCTGG + Intronic
947531351 2:230910538-230910560 CAGATCCCAAAGATCTTCCTGGG + Exonic
1168746923 20:251451-251473 TATTTGACAAAGATATTCCTGGG - Intergenic
1170222535 20:13955330-13955352 CTTTTCAGAAGGTTCTTCCCTGG - Intronic
1170533500 20:17317313-17317335 GAATTCACAAAGATGTTCCAAGG - Intronic
1172795291 20:37532724-37532746 CATTTTACAAAGATCATCCTGGG - Intergenic
1176963292 21:15184261-15184283 CACATAACAAAGATCCTCCCTGG + Intergenic
1177483479 21:21724168-21724190 CATTTCACAAAAATATTACGGGG + Intergenic
1181710997 22:24688594-24688616 CATTTCCCTAAGATGTTCACAGG - Intergenic
1182720942 22:32399501-32399523 CATTTAGCAAACATATTCCCAGG - Intronic
1182911372 22:33987363-33987385 CATTTCACTCGGCTCTTCCCTGG - Intergenic
1183076277 22:35429279-35429301 CATTTCAAAAAGATTTGGCCGGG - Intergenic
950273807 3:11641348-11641370 CATTTTCCAAACAACTTCCCTGG + Intronic
957272021 3:78042823-78042845 CATTTCATCAAGATCTTCACAGG + Intergenic
959202768 3:103270362-103270384 CATTGCTCAAAAATGTTCCCTGG + Intergenic
961420250 3:126797363-126797385 TATTTGACATAGAGCTTCCCAGG + Intronic
965495847 3:169398055-169398077 CATTTATCAAAGCTCATCCCAGG - Intronic
967096356 3:186180516-186180538 CATTTAACAGAGATCCTCTCTGG - Intronic
971721769 4:30254695-30254717 CATTTCCAAAAGATCATACCAGG - Intergenic
971990111 4:33881571-33881593 CATTTCCCAAGGTTCTTGCCAGG + Intergenic
973854403 4:54996397-54996419 CTTTTTAGAAAGATATTCCCAGG + Intergenic
976076823 4:81308544-81308566 AATCTCACAAATAACTTCCCAGG - Intergenic
978903599 4:113980844-113980866 CATTTCACAAAGTTTTGCCTGGG - Intergenic
985303060 4:188509758-188509780 CAATTCACAAAGATCATCATAGG + Intergenic
986401897 5:7390272-7390294 CATTTGACAAAAATATTTCCAGG - Intergenic
987458520 5:18177171-18177193 CATTTCTCAAAGTCCTTGCCAGG + Intergenic
988657802 5:33231423-33231445 CTTTTCACAAACATCTTCACTGG - Intergenic
990589596 5:57248971-57248993 CATCTCACAAACATTTTACCAGG + Intronic
992412159 5:76516173-76516195 CCTTTTAAAAAGATCATCCCTGG - Intronic
993713398 5:91250346-91250368 CATTTCACAACGATGTACCTTGG - Intergenic
994698214 5:103099615-103099637 CATTTCACAAATGGATTCCCTGG - Intronic
995349877 5:111162882-111162904 CATCTCACATGGATCCTCCCAGG - Intergenic
995863081 5:116661859-116661881 CATATCACAAACAACTTCCATGG - Intergenic
996878441 5:128265931-128265953 CATTTCAGACAGATTTCCCCCGG - Intronic
999035130 5:148340204-148340226 CATTTTACAAACATATTCTCTGG - Intergenic
999683830 5:154084735-154084757 CAGTTTAGAAAGGTCTTCCCTGG - Intronic
1000298281 5:159931839-159931861 CATTTATCAAAGTTCTGCCCTGG + Intronic
1001377768 5:171279056-171279078 CATATCACTGAGATCTTTCCTGG + Intronic
1001574093 5:172750581-172750603 AATTTAACAAAAATCTTCCTGGG - Intergenic
1001816779 5:174675895-174675917 CATTTCATAAAGTTCTTCCACGG - Intergenic
1004209983 6:13630324-13630346 CAATTCTCAAAGATATTCCTTGG - Intronic
1007883876 6:45203545-45203567 CATTTCAAACAGATCATCCTGGG - Intronic
1010169046 6:72953222-72953244 CATTTTAAAAACATCTTCACTGG - Intronic
1010407282 6:75519666-75519688 CAATTCCCACAGATTTTCCCTGG + Intergenic
1011498709 6:87964885-87964907 GATCTCACAAAGATCTCACCAGG + Intergenic
1013158597 6:107519691-107519713 CATTTCATAACTATCTACCCAGG - Intronic
1013770046 6:113618290-113618312 CTTTTCAGAAAGATCTTCCCTGG + Intergenic
1015286374 6:131490344-131490366 CATTCCACAAACATTTTTCCAGG + Intergenic
1015589232 6:134806396-134806418 CTTTTCACAAAGAAATTCCCAGG - Intergenic
1015751210 6:136561158-136561180 CACTGCACAAGGTTCTTCCCTGG + Intronic
1016355507 6:143213815-143213837 CTTCTCAGAAAGAACTTCCCAGG - Intronic
1016580741 6:145627351-145627373 CATTTGACCAACATCATCCCAGG + Exonic
1018645223 6:165941928-165941950 CCCATCACCAAGATCTTCCCTGG + Intronic
1020888632 7:13851086-13851108 TATTCCACAGAGATCTTACCAGG + Intergenic
1021326782 7:19280474-19280496 CATTTCAAAAAGATTTTTCTTGG + Intergenic
1023365688 7:39460924-39460946 CAACTCACAAAGAACTTCCAAGG + Intronic
1024720681 7:52134654-52134676 CAATTCACAAAGGTCTTCTAGGG + Intergenic
1025310300 7:57928378-57928400 CACATCACAAAGATGTTCCTTGG - Intergenic
1026178111 7:68015348-68015370 CATTTCCCAGAGGACTTCCCAGG - Intergenic
1026511840 7:71033881-71033903 CAGGTCACAACGATCTTTCCAGG - Intergenic
1029444965 7:100606676-100606698 CATTTCAAAAAGTTCTGACCTGG + Intronic
1030218409 7:107071198-107071220 CATTTCACACAGATCATCTTTGG + Intronic
1030523549 7:110627627-110627649 CATTTAACATTGTTCTTCCCAGG - Intergenic
1031846675 7:126813424-126813446 CATTTCACACAGATCATCTCTGG + Intronic
1033026975 7:137783629-137783651 CTTTTCACAATGAATTTCCCAGG - Intronic
1033280075 7:139999923-139999945 GCTTTCACAAAGATTTTTCCTGG - Intronic
1033525401 7:142208640-142208662 CATTTTACAAATCTTTTCCCAGG + Intronic
1034247202 7:149655852-149655874 CATTTTACAAAAAACTTACCTGG + Intergenic
1034522376 7:151630954-151630976 CATTTCACAAACATGTTAGCTGG - Intronic
1036075361 8:5493515-5493537 CACTTCTAAAAGATCATCCCAGG - Intergenic
1036146561 8:6259665-6259687 GATTTCACAAAACTATTCCCCGG + Intergenic
1036963783 8:13274079-13274101 CATATAACAAAGATTTTCTCTGG + Intronic
1037686653 8:21145522-21145544 CATTTCACATTTCTCTTCCCTGG + Intergenic
1037693901 8:21207365-21207387 CATTACACAGAGATCATCCGAGG - Intergenic
1038350651 8:26773466-26773488 CATTTCACAAAGACCTGCCTGGG + Intronic
1038383789 8:27121669-27121691 CAGATCACATATATCTTCCCAGG + Intergenic
1041935763 8:63330175-63330197 AACTCCACAAAGTTCTTCCCAGG + Intergenic
1043506107 8:80904649-80904671 CATTTCAGCAAGATCTTCCCAGG - Intergenic
1044622649 8:94205199-94205221 AATATCACAAGCATCTTCCCTGG + Intronic
1044710184 8:95049705-95049727 CTTATCACAAAAGTCTTCCCTGG + Intronic
1045393439 8:101737431-101737453 CCTTTCTCAAAAATCTTCCACGG + Intronic
1045650375 8:104336703-104336725 CATTTCAGAGTGATGTTCCCAGG - Intronic
1046855924 8:119031947-119031969 CATTGCACTAAGCTCTTCACAGG + Intronic
1048247106 8:132817723-132817745 CATTTTACAATCATATTCCCTGG + Intronic
1048260038 8:132937425-132937447 CACTTCACAAAGAGTTTGCCTGG + Intronic
1048746795 8:137623470-137623492 CATTGCTCAGAGGTCTTCCCTGG + Intergenic
1048861171 8:138725304-138725326 CCATTCACAAAGATGTCCCCAGG + Intronic
1050089239 9:2000256-2000278 CATTTTACAAAGATTATTCCAGG - Intergenic
1050426155 9:5514957-5514979 AACTTCACTAAGATCTTGCCTGG - Intronic
1050851935 9:10299352-10299374 AATATGACAAAGAACTTCCCTGG + Intronic
1051221323 9:14851338-14851360 CATGTCACTGAGATCTTTCCAGG + Exonic
1051563857 9:18473817-18473839 CATCTCACAAAGAACTAACCAGG + Intergenic
1053170875 9:35882095-35882117 CATTTCACAAAAATTCTCCTGGG + Intergenic
1053716244 9:40893265-40893287 CATATCACAAAGAAGTTCTCAGG - Intergenic
1054931461 9:70639775-70639797 CATTTCACAAAAATGTTGCAGGG + Intronic
1056606724 9:88091867-88091889 TATTTCACAAATACCTTCTCTGG + Intergenic
1057169593 9:92953539-92953561 CATTTTACACACATTTTCCCAGG + Intronic
1057446254 9:95117254-95117276 AATTTGACAATGCTCTTCCCAGG + Intronic
1058976689 9:110131389-110131411 CATTTCAAAAAGGACTTTCCTGG + Intronic
1059403731 9:114087001-114087023 AATTTCAGAAAGATCTTCTAGGG + Intronic
1060241096 9:121904125-121904147 CATTTCATAATGATCATCCAAGG + Intronic
1186712670 X:12216456-12216478 GCAGTCACAAAGATCTTCCCAGG + Intronic
1186742236 X:12530652-12530674 CATTTCTCACAACTCTTCCCTGG - Intronic
1188951602 X:36382218-36382240 CATTTCCCAGAGATCTTCCACGG - Intronic
1193881682 X:86930535-86930557 CTTTTCACAATGGTTTTCCCTGG - Intergenic
1197033488 X:121847420-121847442 CATTTTCCACAGATCTTTCCTGG - Intergenic
1197120993 X:122892112-122892134 AATTTCACAAAGATGTTGCCTGG - Intergenic
1197149157 X:123201454-123201476 TATTTTAAAAATATCTTCCCAGG - Intronic
1197297773 X:124739972-124739994 CATTCCACTAAGATCTTCAAGGG - Intronic
1198092186 X:133342377-133342399 CATCTCAGAGAGATCTTTCCGGG + Intronic
1199718407 X:150524143-150524165 CATTGCAAAAATAACTTCCCAGG + Intergenic