ID: 1135851659

View in Genome Browser
Species Human (GRCh38)
Location 16:25969291-25969313
Sequence CAAAACATGGGGCAGTTCCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 150
Summary {0: 1, 1: 0, 2: 2, 3: 9, 4: 138}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1135851654_1135851659 -7 Left 1135851654 16:25969275-25969297 CCCAGTGTTTTTGGAGCAAAACA 0: 1
1: 0
2: 0
3: 28
4: 251
Right 1135851659 16:25969291-25969313 CAAAACATGGGGCAGTTCCCTGG 0: 1
1: 0
2: 2
3: 9
4: 138
1135851655_1135851659 -8 Left 1135851655 16:25969276-25969298 CCAGTGTTTTTGGAGCAAAACAT 0: 1
1: 0
2: 0
3: 17
4: 194
Right 1135851659 16:25969291-25969313 CAAAACATGGGGCAGTTCCCTGG 0: 1
1: 0
2: 2
3: 9
4: 138
1135851650_1135851659 28 Left 1135851650 16:25969240-25969262 CCTTTAGTGTTTCTCTTTTGCTC 0: 1
1: 0
2: 3
3: 44
4: 460
Right 1135851659 16:25969291-25969313 CAAAACATGGGGCAGTTCCCTGG 0: 1
1: 0
2: 2
3: 9
4: 138

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1135851659 Original CRISPR CAAAACATGGGGCAGTTCCC TGG Intronic
901517134 1:9755466-9755488 TTAAACATGGGGAAGTTCTCGGG + Intronic
902232808 1:15038314-15038336 CAAAAGATGGCGCTGTTACCAGG + Intronic
903552729 1:24169288-24169310 CAAAGCAGAGGGCAGCTCCCTGG - Intronic
905485115 1:38290510-38290532 CAAACCAAAGGGCAGTTCACAGG - Intergenic
911906761 1:103579109-103579131 CAGAAAATGTAGCAGTTCCCTGG - Intronic
915147868 1:153806200-153806222 CGAGGAATGGGGCAGTTCCCGGG - Exonic
915849157 1:159302525-159302547 CAAACTATTGGGCATTTCCCAGG + Intronic
918471914 1:184884075-184884097 CAGAACATGGGGCAGTTATCTGG - Intronic
918892571 1:190294907-190294929 AAAGACATGGGACAGTTCCCTGG + Intronic
921802378 1:219416356-219416378 AAAAACATTGGGCAAATCCCAGG - Intergenic
922695089 1:227727273-227727295 CATAACATGGGGGAGTTTCAGGG - Intergenic
924808155 1:247378238-247378260 CAAAGCATGGTGCTGATCCCTGG + Intergenic
1064269612 10:13853140-13853162 CACATCATGCGGCAGCTCCCTGG + Intronic
1064878015 10:20017305-20017327 CAAAACATGGGACCCTTCCAGGG + Intronic
1065844883 10:29736091-29736113 CAAAACAGGGGCCAGTGCGCGGG + Intronic
1066213786 10:33266283-33266305 CAAAACATGGGGACATTCCATGG + Intronic
1066659641 10:37727606-37727628 CACAGCATGGGGCAGTTTCGGGG + Intergenic
1068409096 10:56631896-56631918 CAAAACATGGCTCAGTTCTCAGG - Intergenic
1068858078 10:61817772-61817794 CTAGACATGGGTCCGTTCCCTGG - Intergenic
1071053188 10:81475712-81475734 CAAAAGATGGGGCAGTTGCAAGG + Intergenic
1072817330 10:98522394-98522416 CAAAGTGTGAGGCAGTTCCCGGG + Intronic
1073316401 10:102583945-102583967 AAACAGATGGGCCAGTTCCCTGG - Intronic
1076929501 10:133520704-133520726 CAAAACAAGAGGAAGTTTCCAGG + Intronic
1077910569 11:6568707-6568729 CAAAACATGGCCCAGCTCCAGGG - Exonic
1078399978 11:11017640-11017662 CAAGGGATGGGGCAGTACCCAGG + Intergenic
1078969082 11:16385785-16385807 CAAATGATGTGGCAGTTGCCTGG - Intronic
1079085161 11:17439963-17439985 CAAAAGATGTGTGAGTTCCCAGG - Intronic
1088114231 11:106297783-106297805 CATAATTTGGGTCAGTTCCCTGG + Intergenic
1089001182 11:115053713-115053735 CAAAACAGGGTGCAGATGCCAGG + Intergenic
1090029855 11:123196704-123196726 CAAAAGCTGGGGCTGTTCCTAGG + Intergenic
1098377180 12:69829357-69829379 CTGAACATGGGGCACTTCCGTGG - Intronic
1099133988 12:78870715-78870737 TAAAACAAGAGGCTGTTCCCTGG - Intronic
1099257057 12:80327403-80327425 CCAAATCTGGGGCAGTGCCCTGG - Intronic
1110864738 13:80381389-80381411 CCAAACATGTGGAAGTTCTCTGG - Intergenic
1113924573 13:113934242-113934264 CAGACAATGGGGCTGTTCCCAGG + Intergenic
1114256941 14:21011203-21011225 CAAATCATGGGGCAACACCCTGG + Intergenic
1114300818 14:21375733-21375755 CCAGGCATGGGGCAGTTGCCTGG - Intronic
1114429173 14:22645704-22645726 CCAAACATGGGGCACTCCTCAGG + Intergenic
1116918224 14:50545782-50545804 AAAAACATGGGGAAGTTCAAAGG + Intronic
1117720807 14:58627161-58627183 CAAAACCTTGGGCAATTACCTGG + Intergenic
1121143903 14:91566977-91566999 CAAAACTTGGGTCACTTTCCTGG - Intergenic
1121716250 14:96078172-96078194 CAGACCATGGGGCCCTTCCCTGG + Intronic
1127352160 15:58163933-58163955 CAAACCAGGAGGCAGTTACCTGG + Intronic
1127810416 15:62560619-62560641 CAAAACATGGGGTATTGGCCAGG - Intronic
1129079116 15:73023908-73023930 CCAAAGAAGGGGCAGCTCCCTGG + Intergenic
1130445905 15:84001732-84001754 CATACCATGGGGCAGTCCTCAGG - Intronic
1131177619 15:90219923-90219945 CAGAAAGAGGGGCAGTTCCCAGG - Intronic
1132248326 15:100315055-100315077 CATGACCTGGGGCAGGTCCCAGG + Intronic
1132704628 16:1237770-1237792 CCTAGCATGGGGCAGGTCCCAGG + Intergenic
1132706885 16:1248655-1248677 CCTAGCATGGGGCAGGTCCCAGG - Intergenic
1135851659 16:25969291-25969313 CAAAACATGGGGCAGTTCCCTGG + Intronic
1138530908 16:57633948-57633970 CAAAACCTGGGTCAGGTCTCAGG - Intronic
1140073353 16:71672762-71672784 GGAAACATGGGGCAGTTCCCAGG - Intronic
1142029676 16:87832274-87832296 CCAACCCTGGGGCTGTTCCCTGG + Exonic
1146664135 17:34685544-34685566 CAAAACCTTGGGCAGGTCCAGGG + Intergenic
1148463257 17:47850151-47850173 CAGCCCCTGGGGCAGTTCCCAGG - Intronic
1150161091 17:62898745-62898767 CAAAATGTGGACCAGTTCCCTGG + Intergenic
1153676926 18:7464085-7464107 GAAAAGGTGGGGCTGTTCCCAGG - Intergenic
1158670033 18:59466316-59466338 CAATACAAGGGGCAGTTCTCCGG + Intronic
1159153350 18:64549722-64549744 CAAAACATGGAACATTTTCCAGG - Intergenic
1164488921 19:28689156-28689178 CAACACAGTGGGAAGTTCCCAGG + Intergenic
1168257103 19:55173191-55173213 CAAAGCAGGGGGCAGGACCCGGG + Exonic
927197843 2:20560295-20560317 CAGAACCTGGGGCAGCACCCAGG + Intergenic
927840220 2:26436861-26436883 CCCCACATGGGTCAGTTCCCGGG + Intronic
928675814 2:33649923-33649945 CACAAAATGGGGCAATTCCGTGG - Intergenic
929993154 2:46806429-46806451 CAGAACATTAGGCACTTCCCTGG + Intergenic
931213161 2:60216412-60216434 CAAAACAAGTGGCAGATTCCTGG + Intergenic
933349560 2:81136623-81136645 GAAGTCAAGGGGCAGTTCCCTGG - Intergenic
934048458 2:88190766-88190788 CAAGCCATGGGGCAGCTCCTGGG - Intergenic
937011369 2:118565572-118565594 CAAAACATGCGGCCTTCCCCTGG - Intergenic
937059414 2:118970539-118970561 CAGAGCCTGGGGCGGTTCCCTGG + Intronic
943976377 2:194483943-194483965 CTAAACTAGGGGCAGTTGCCTGG - Intergenic
947441823 2:230129604-230129626 CAAAACCTGTGACAGTTTCCTGG - Intergenic
948122305 2:235540002-235540024 CAGGACATGGGACAGTTCCCTGG - Intronic
948634139 2:239323515-239323537 CAATAAATGGGGCAGATCCTCGG + Intronic
1173845129 20:46183332-46183354 CAAAACCTGGAGCAGGACCCTGG - Intronic
1174085340 20:48004105-48004127 AAATCCATGTGGCAGTTCCCAGG - Intergenic
1175138984 20:56845701-56845723 CTAAAACTGGGGAAGTTCCCGGG - Intergenic
1176632339 21:9151554-9151576 CACAAAATGGGGCATGTCCCTGG - Intergenic
1180933422 22:19608553-19608575 CAAGACATGGAGCAGATTCCAGG + Intergenic
1182261818 22:29078350-29078372 CAAACCATAGGCCAGTTCCAAGG - Intronic
1184364675 22:44042532-44042554 GAAGACACGGGCCAGTTCCCAGG - Intronic
1184970883 22:48019101-48019123 CATAAAAGGGGGCAGCTCCCTGG + Intergenic
1185127447 22:49019002-49019024 CAAACCATGGAGCAGATTCCAGG - Intergenic
951270431 3:20617712-20617734 CATAAAATGGGGCATGTCCCTGG - Intergenic
952217817 3:31295234-31295256 GAAAATAAAGGGCAGTTCCCTGG + Intergenic
953395210 3:42563715-42563737 GAATACATGGGGCTGTTTCCTGG - Intronic
956091733 3:65674746-65674768 CAGAACCTGGTGCACTTCCCAGG + Intronic
956382654 3:68682126-68682148 CAAAGCATGGGCCATTTCACGGG + Intergenic
957099179 3:75807299-75807321 CACAAAATGGGGCATGTCCCTGG - Intergenic
957330419 3:78756261-78756283 CAAAACGTGGGTCATTTCCAAGG + Intronic
958824923 3:99018527-99018549 CAAGACATGGTGCACTTCTCAGG + Intergenic
962866849 3:139454298-139454320 CAATACCTGTGGCAGTTCCCAGG + Intronic
963388008 3:144620764-144620786 CAAAATTTGTGGCAGTTCCAAGG - Intergenic
963742226 3:149092258-149092280 CAAAGGAGGGGGCAGATCCCTGG - Intergenic
965206173 3:165720897-165720919 CAAGAAAAGGGGCAGGTCCCCGG - Intergenic
969917068 4:10501352-10501374 CAAAACATAGGGCTCTTCCTTGG + Exonic
973978186 4:56283900-56283922 CAAAGCCTGGAGCAGCTCCCTGG + Intronic
985648059 5:1094421-1094443 CAAAGAAAGGGGCATTTCCCAGG + Intronic
988122856 5:26990648-26990670 CAAAACATGGGGCATGTTCTGGG - Intronic
994479957 5:100322127-100322149 CAAAAACTAGGACAGTTCCCAGG + Intergenic
996969066 5:129341852-129341874 CTAAACATGTGGGAATTCCCAGG - Intergenic
997424553 5:133794352-133794374 CAAGTCATGGGGCTGTCCCCAGG + Intergenic
997830970 5:137149633-137149655 AAAAACATGGAGCTTTTCCCAGG + Intronic
1000961607 5:167607422-167607444 CAAAACAGGGAGCATTTCACAGG + Intronic
1003419635 6:5945442-5945464 CAAAACTTGGGACAGTTGTCAGG + Intergenic
1003999150 6:11578558-11578580 CGAACCATGGGACAGTTCCAAGG + Exonic
1007934942 6:45724679-45724701 CAAAACCTGGAGCAGAGCCCAGG - Intergenic
1010862206 6:80926762-80926784 GAAGACCTGGGGCAGATCCCTGG - Intergenic
1012428930 6:99143776-99143798 GGAAGCATGGGCCAGTTCCCAGG + Intergenic
1014673474 6:124336237-124336259 CAAATCATCGTGCAGTTCCAAGG + Intronic
1018989177 6:168660185-168660207 CAATCCATGGGCCAGTTCCTTGG - Intronic
1021591535 7:22268938-22268960 CAAAAAATGGAGCATTTCCGGGG + Intronic
1022332441 7:29392700-29392722 CATGATATGGGGCAGTTTCCTGG - Intronic
1024686726 7:51753970-51753992 CAAAAGTTGGGGCAGTCCCTGGG + Intergenic
1026484075 7:70802541-70802563 CAAGACATGAAGCAGGTCCCTGG - Intergenic
1027821672 7:83053636-83053658 TAAAACATGGCTCAATTCCCTGG - Intronic
1030230336 7:107201964-107201986 CAGAACATGGGGCAGGTGGCTGG + Exonic
1034243391 7:149626138-149626160 AAAAACCTGGGGCAGGTCCAGGG - Intergenic
1034481028 7:151320662-151320684 CCCAACATGGGGTAGATCCCAGG - Intergenic
1037152298 8:15652152-15652174 CAAAACTTAGTGCAGTTCCGGGG + Intronic
1037157348 8:15719773-15719795 CAACATATGGCGCAGTTTCCTGG - Intronic
1038611640 8:29064539-29064561 CCAACCATGTGGCAGGTCCCAGG + Intronic
1041500345 8:58533210-58533232 CAAACCATGGGGCACTTTCATGG + Intergenic
1041507261 8:58612888-58612910 CAAATCATGGGGCTCTTCACCGG + Intronic
1043422443 8:80112438-80112460 CAAGATTTGGGGCAGGTCCCAGG + Intronic
1044518480 8:93168491-93168513 CAACAAATGGGACAGTTGCCTGG - Intergenic
1049324381 8:142014487-142014509 CAAAAGATGGGGAAGGGCCCTGG - Intergenic
1051761825 9:20475642-20475664 CAAAACCTGGTTCAGGTCCCCGG + Intronic
1054826008 9:69574173-69574195 CAAAACATGGTGCATCCCCCTGG + Intronic
1056019651 9:82428392-82428414 CAAAACATTTTGAAGTTCCCAGG + Intergenic
1056102273 9:83311359-83311381 GCAAACGTGGAGCAGTTCCCTGG - Intronic
1056155322 9:83829339-83829361 CAAGACATGGGCCAGTACCGTGG - Intronic
1057072184 9:92108618-92108640 CAAAACATTTTGAAGTTCCCAGG - Intronic
1058261652 9:102840630-102840652 CAAATAATGGGGCACTTCTCTGG + Intergenic
1060863961 9:126980123-126980145 AAAAAGCTGGGGCAGCTCCCAGG - Intronic
1060919833 9:127412644-127412666 CAGAACAAGGGGCAGTACCAGGG - Intergenic
1061087815 9:128409447-128409469 CCCACCATGGGTCAGTTCCCTGG - Intergenic
1061294972 9:129672069-129672091 CAGAACTTGGGGCACTTCCGTGG + Intronic
1061729069 9:132599364-132599386 CAAAACAAGGGGCAAGTTCCTGG + Intronic
1203755166 Un_GL000218v1:119180-119202 CACAAAATGGGGCATTTCCCTGG - Intergenic
1186457402 X:9720753-9720775 CAAAGCATGCGGCAGTTCCCAGG + Intergenic
1186869576 X:13757172-13757194 CAAAGGATGGTGGAGTTCCCTGG - Intronic
1189028223 X:37421574-37421596 AAAAACATGGGGCAATTTCCAGG - Intronic
1197421070 X:126237678-126237700 CACGACATGGGGCAGACCCCGGG - Intergenic
1199852548 X:151736076-151736098 AGAAACATGAGGGAGTTCCCAGG - Intergenic
1201789706 Y:17825943-17825965 CAAAAGATAGTGGAGTTCCCTGG - Intergenic
1201811848 Y:18080046-18080068 CAAAAGATAGTGGAGTTCCCTGG + Intergenic
1202351358 Y:23995692-23995714 AAAAAGATGGTGGAGTTCCCTGG - Intergenic
1202519421 Y:25674427-25674449 AAAAAGATGGTGGAGTTCCCTGG + Intergenic