ID: 1135853275

View in Genome Browser
Species Human (GRCh38)
Location 16:25983789-25983811
Sequence CTGTGTGAGTCCATGATTCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 198
Summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 181}

Found 12 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1135853275_1135853279 -4 Left 1135853275 16:25983789-25983811 CCCAGAATCATGGACTCACACAG 0: 1
1: 0
2: 0
3: 16
4: 181
Right 1135853279 16:25983808-25983830 ACAGATAGTAATTTCAGGGTTGG 0: 1
1: 0
2: 2
3: 16
4: 183
1135853275_1135853277 -9 Left 1135853275 16:25983789-25983811 CCCAGAATCATGGACTCACACAG 0: 1
1: 0
2: 0
3: 16
4: 181
Right 1135853277 16:25983803-25983825 CTCACACAGATAGTAATTTCAGG 0: 1
1: 0
2: 0
3: 13
4: 198
1135853275_1135853287 29 Left 1135853275 16:25983789-25983811 CCCAGAATCATGGACTCACACAG 0: 1
1: 0
2: 0
3: 16
4: 181
Right 1135853287 16:25983841-25983863 AAGGACAGCGTGGGGCTGTGGGG 0: 1
1: 0
2: 1
3: 39
4: 342
1135853275_1135853281 10 Left 1135853275 16:25983789-25983811 CCCAGAATCATGGACTCACACAG 0: 1
1: 0
2: 0
3: 16
4: 181
Right 1135853281 16:25983822-25983844 CAGGGTTGGTGGTTTATTAAAGG 0: 1
1: 0
2: 2
3: 9
4: 122
1135853275_1135853283 20 Left 1135853275 16:25983789-25983811 CCCAGAATCATGGACTCACACAG 0: 1
1: 0
2: 0
3: 16
4: 181
Right 1135853283 16:25983832-25983854 GGTTTATTAAAGGACAGCGTGGG 0: 1
1: 0
2: 0
3: 4
4: 98
1135853275_1135853282 19 Left 1135853275 16:25983789-25983811 CCCAGAATCATGGACTCACACAG 0: 1
1: 0
2: 0
3: 16
4: 181
Right 1135853282 16:25983831-25983853 TGGTTTATTAAAGGACAGCGTGG 0: 1
1: 0
2: 0
3: 6
4: 82
1135853275_1135853288 30 Left 1135853275 16:25983789-25983811 CCCAGAATCATGGACTCACACAG 0: 1
1: 0
2: 0
3: 16
4: 181
Right 1135853288 16:25983842-25983864 AGGACAGCGTGGGGCTGTGGGGG 0: 1
1: 0
2: 2
3: 45
4: 449
1135853275_1135853285 27 Left 1135853275 16:25983789-25983811 CCCAGAATCATGGACTCACACAG 0: 1
1: 0
2: 0
3: 16
4: 181
Right 1135853285 16:25983839-25983861 TAAAGGACAGCGTGGGGCTGTGG 0: 1
1: 0
2: 1
3: 20
4: 268
1135853275_1135853286 28 Left 1135853275 16:25983789-25983811 CCCAGAATCATGGACTCACACAG 0: 1
1: 0
2: 0
3: 16
4: 181
Right 1135853286 16:25983840-25983862 AAAGGACAGCGTGGGGCTGTGGG 0: 1
1: 0
2: 0
3: 16
4: 220
1135853275_1135853280 -1 Left 1135853275 16:25983789-25983811 CCCAGAATCATGGACTCACACAG 0: 1
1: 0
2: 0
3: 16
4: 181
Right 1135853280 16:25983811-25983833 GATAGTAATTTCAGGGTTGGTGG 0: 1
1: 0
2: 0
3: 14
4: 193
1135853275_1135853278 -8 Left 1135853275 16:25983789-25983811 CCCAGAATCATGGACTCACACAG 0: 1
1: 0
2: 0
3: 16
4: 181
Right 1135853278 16:25983804-25983826 TCACACAGATAGTAATTTCAGGG 0: 1
1: 0
2: 0
3: 23
4: 220
1135853275_1135853284 21 Left 1135853275 16:25983789-25983811 CCCAGAATCATGGACTCACACAG 0: 1
1: 0
2: 0
3: 16
4: 181
Right 1135853284 16:25983833-25983855 GTTTATTAAAGGACAGCGTGGGG 0: 1
1: 0
2: 0
3: 12
4: 104

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1135853275 Original CRISPR CTGTGTGAGTCCATGATTCT GGG (reversed) Intronic
900456812 1:2778967-2778989 CTCTGTGATTCGATGACTCTAGG + Intronic
900580936 1:3408608-3408630 GTGTGTGAGTGCATGAGTGTGGG + Intronic
902701802 1:18177427-18177449 GTGTGTGTGTACATGGTTCTTGG + Intronic
904909593 1:33924006-33924028 CTGTGTGTGTCCAGGATTGGAGG - Intronic
905530131 1:38671550-38671572 TTGTGTGAGTCTCTGATCCTTGG - Intergenic
906292599 1:44629215-44629237 ATGTGTGAGTTCCAGATTCTAGG - Intronic
906625147 1:47318897-47318919 CTGGGTGAGGCTATGATTTTAGG + Intergenic
906790954 1:48658499-48658521 CCTTGTGAGTCCATAATTCGAGG - Intronic
911101589 1:94099976-94099998 CTATGGGAGTCCAGGACTCTAGG - Intronic
913536308 1:119775713-119775735 GTGTGTGAGTTCATGTTCCTTGG - Intergenic
913538875 1:119799938-119799960 CTGCGTGAGTCCCTCCTTCTTGG - Intronic
914735235 1:150410083-150410105 CTGGGTGAGTCCTTGCTTCACGG - Intronic
914750222 1:150529932-150529954 CTGTGTGTGTGCATTTTTCTGGG + Intergenic
914991017 1:152499774-152499796 CTCTGTGAGTCCATCCTGCTCGG - Intergenic
915625648 1:157112599-157112621 GTGTGTGAGCCCATGTTTCTGGG + Intergenic
916856185 1:168752811-168752833 CTGTGTGAGAGCAAGACTCTTGG - Intergenic
917441422 1:175072304-175072326 CTCTGTAAGACAATGATTCTTGG + Intronic
917667616 1:177240551-177240573 CTGTGAGAGTCCCTGAATGTTGG + Intronic
919923913 1:202182363-202182385 CTTGGTGAGTCCAGGAATCTGGG + Intergenic
920459762 1:206130501-206130523 CTCTGTGAGTCTATGATTCCTGG - Intergenic
921735137 1:218618772-218618794 CTTTGTGAGTCTGTGATTCCAGG + Intergenic
923354351 1:233139394-233139416 CAGTGTGAGTCCAGGATTCCTGG - Intronic
1065128513 10:22597274-22597296 CTGTGTGAGTGCCTGACTCTGGG - Intronic
1067963200 10:50879894-50879916 CTAGGTCAGTCCATGAGTCTGGG + Intronic
1068422138 10:56808077-56808099 CTGTTGGGGTCCCTGATTCTAGG - Intergenic
1069246338 10:66211752-66211774 CTGTGGGAGTCCACGATGATGGG + Intronic
1069605850 10:69738120-69738142 CTGTGAAAGTCCAGGTTTCTGGG + Intergenic
1069747480 10:70725048-70725070 TTTTGTGAGTTCAGGATTCTAGG + Intronic
1075147811 10:119897471-119897493 CTGTGATAGTGCATGATTTTAGG + Intronic
1076535835 10:131176285-131176307 CTCTGTGTGTGCATGTTTCTTGG - Intronic
1076535844 10:131176491-131176513 CTCTGTGTGTGCATGTTTCTTGG - Intronic
1076535859 10:131176767-131176789 CTCTGTGTGTCCATGTGTCTTGG - Intronic
1076561207 10:131365777-131365799 CTGTGTGATTCCAGGCTTATGGG - Intergenic
1078195365 11:9132764-9132786 ATGTGGGAGTCCATGCTTTTAGG - Intronic
1078440620 11:11363716-11363738 CTGGGTTGGTCCATGTTTCTAGG - Intronic
1081513152 11:43796424-43796446 CTGTATTAGTACATGATTCTGGG + Intronic
1083280456 11:61623809-61623831 CTGTGTGTGTACATTCTTCTTGG - Intergenic
1084481082 11:69420619-69420641 CTCTGTGAGGCTGTGATTCTGGG + Intergenic
1084507671 11:69579051-69579073 CTTTATGACTCCATGATTCGTGG - Intergenic
1090839384 11:130475230-130475252 CTGGGTCAGTCATTGATTCTTGG - Exonic
1091445599 12:542822-542844 CTGTGGGAGACCAAGATGCTGGG + Intronic
1091977004 12:4833684-4833706 TTGTGTGAGGACATGATGCTTGG - Intronic
1093495761 12:19755350-19755372 TTGTGTGCTTCCTTGATTCTTGG + Intergenic
1096195020 12:49644220-49644242 CTGTGTGAGGCCATGGCTCCTGG + Exonic
1096399022 12:51289879-51289901 CTCTGTGAGTTCCTGCTTCTAGG + Intronic
1101201447 12:102440384-102440406 CTCTGACATTCCATGATTCTTGG - Intronic
1102237879 12:111305988-111306010 CTGTGTGTGTCCATGTTCCTGGG + Intronic
1102706971 12:114890056-114890078 GTGTGTGTGCACATGATTCTTGG - Intergenic
1103982140 12:124743420-124743442 CTGGATGAGGCCATGGTTCTGGG - Intergenic
1104371940 12:128231173-128231195 CTGAGCCAGTTCATGATTCTGGG + Intergenic
1106465504 13:30010643-30010665 CTGAGTGTGTCCATTATTATGGG + Intergenic
1109313957 13:60727698-60727720 CTGTGTGACTTCATTCTTCTTGG - Intergenic
1109795227 13:67303096-67303118 CTGTATCATTCCATAATTCTGGG - Intergenic
1115464250 14:33697294-33697316 CTGTGTGAGTCCAAGCTGCCTGG - Intronic
1116114989 14:40636258-40636280 CTGCTTGAGTCCCTGATTCCAGG + Intergenic
1116463185 14:45201514-45201536 TTATGTGAGTCCTTTATTCTCGG + Intergenic
1117322611 14:54638213-54638235 CTGTGTGTCTGCATGATTCATGG + Intronic
1117879303 14:60294919-60294941 CTGTGTGTGTTCCTGATTCCTGG + Intronic
1121309283 14:92926475-92926497 CTTTGGGAGTCCATGATCCCTGG - Intronic
1121443735 14:93965610-93965632 CTGTGTGGGTCAATGGTTCTTGG + Intronic
1121906487 14:97750805-97750827 CTGTGTGAGTGCATAATTCCAGG + Exonic
1122914754 14:104853609-104853631 CTGGGTGAGGACATGATTCTTGG - Intergenic
1122952634 14:105054069-105054091 CTGGCTGAGTTCATGCTTCTGGG + Intronic
1131296698 15:91155549-91155571 CTGTCTGAGTCCATGGATCAGGG + Intronic
1131683760 15:94750393-94750415 CTGAGTGAGGCCAGGCTTCTGGG + Intergenic
1131749211 15:95488290-95488312 CTGTTTGTGTCCACGATTCCCGG + Intergenic
1131950160 15:97673196-97673218 CTTTTGGAGTCCCTGATTCTAGG - Intergenic
1132052888 15:98625005-98625027 GTGTGTGTGTGCATGATTCTAGG + Intergenic
1132197037 15:99922382-99922404 CTATATGATTCCATTATTCTTGG - Intergenic
1134623567 16:15708030-15708052 CTGTGTGCATCCTTGAGTCTTGG + Intronic
1135853275 16:25983789-25983811 CTGTGTGAGTCCATGATTCTGGG - Intronic
1137728110 16:50670542-50670564 CTGTATTAGTCCTTGTTTCTAGG - Intronic
1137803003 16:51278097-51278119 CTGTGTTGGCCCATGAGTCTGGG - Intergenic
1137924735 16:52529647-52529669 CTGTTTGACTCCAAGCTTCTTGG + Intronic
1137970192 16:52976987-52977009 CTGTATGAGAACATGATGCTGGG + Intergenic
1143188432 17:5024144-5024166 CTGTGTGAGTCCCACATCCTGGG + Exonic
1147664192 17:42135613-42135635 ATGTGTAAGTCCATGAATGTGGG + Intronic
1149157340 17:53647704-53647726 CTCTTGGAGTCCATGATTCTAGG - Intergenic
1151204762 17:72498122-72498144 TTGTATTTGTCCATGATTCTGGG - Intergenic
1152172282 17:78759747-78759769 ATTTGTGCGTCCATGATTGTAGG - Intronic
1154171574 18:12056655-12056677 CTGTGTGAGTCCCACATCCTGGG - Intergenic
1162358259 19:10200873-10200895 CTGAGTGAGTCTATGATCTTGGG - Intronic
1163240570 19:16060717-16060739 CTGTCTGAGCCCCTGATTTTGGG + Intergenic
1167576034 19:50317882-50317904 CTGTCTGAGCCCAGGAGTCTGGG - Intronic
925948599 2:8890070-8890092 CTCTGTTAGAGCATGATTCTTGG - Intronic
928923478 2:36551701-36551723 CTGTGTAAGTACATGTATCTGGG + Intronic
929215142 2:39404272-39404294 CTCTTGGAGTCCCTGATTCTAGG + Intronic
929505731 2:42526371-42526393 CTGGGTGAGGCCAAGATTCCTGG + Intronic
937006615 2:118522175-118522197 ATCTGTGAGTCTATGTTTCTTGG + Intergenic
938071410 2:128310347-128310369 CTGTGTGAGTCAAGGAATCAAGG + Intronic
939102273 2:137908802-137908824 CTATCTGAGTCAATGGTTCTTGG - Intergenic
939544007 2:143529917-143529939 GAGTGTGAGTCCTTGAGTCTAGG + Intronic
940154982 2:150646041-150646063 CTTTGTGAGCCCATGATGCTAGG - Intergenic
941224103 2:162823652-162823674 CTTTTTTAGTCCATGTTTCTTGG + Intronic
942221313 2:173771712-173771734 CTGTATCAGTCCAAGTTTCTTGG + Intergenic
943375834 2:187075484-187075506 CTGTCTCAGTCCCTGCTTCTAGG + Intergenic
943409228 2:187525275-187525297 CTCTGTGAGTCCAGAATTCATGG + Intronic
945490886 2:210453504-210453526 CTGTTTGAATCTATGAATCTTGG + Intronic
947505321 2:230704090-230704112 CTTTTAGAGTCCCTGATTCTAGG - Intergenic
1168784723 20:528412-528434 CTATGTCAGTCACTGATTCTTGG + Intronic
1169963404 20:11187977-11187999 TTGTGTGTGTCCATGGTTCCTGG - Intergenic
1170549033 20:17459867-17459889 CTCTGTGAATCTATGACTCTGGG + Intronic
1171510288 20:25676988-25677010 ATGTGCAAGTCCAAGATTCTTGG + Exonic
1177807820 21:25891593-25891615 CAGTGTGCTTCCATGATGCTTGG - Intronic
1178883609 21:36467488-36467510 CTCTGTCAGTCCAGGCTTCTTGG + Intronic
1180000252 21:44992355-44992377 CTGGGTGACTCCATGGCTCTGGG - Intergenic
1180705109 22:17804683-17804705 CTGTGTGTCTTTATGATTCTGGG - Intronic
1181018235 22:20083677-20083699 GTGAGTCAATCCATGATTCTGGG - Intronic
1181494634 22:23281095-23281117 CTGTGTGTCTCCATGTTTCCAGG - Intronic
1183445557 22:37851610-37851632 CTTTGTGAGTCCTTGAGGCTAGG + Intronic
949448515 3:4161751-4161773 TTGAGGGAGTCCCTGATTCTAGG - Intronic
950030688 3:9851099-9851121 GTGTGTAAGTCCATTATTCAAGG - Intronic
950716908 3:14854173-14854195 CTGTGTGATGCCAACATTCTGGG + Intronic
952928386 3:38339925-38339947 CTGTGTGAGAGAATGTTTCTGGG - Intergenic
955519909 3:59765328-59765350 CTGTGTCAATCCCTGATTCTAGG - Intronic
961513914 3:127421064-127421086 CTGTGTGAGCCCAGGGCTCTTGG - Intergenic
962426651 3:135274663-135274685 CAGTGTGAGACCATTGTTCTTGG - Intergenic
963778040 3:149459756-149459778 CTCTGTCAGTCTCTGATTCTAGG + Intergenic
963925126 3:150943588-150943610 CTGTGTGACCCCATTCTTCTTGG + Intronic
964907092 3:161730284-161730306 CTGTGTGAGTGTCTGTTTCTAGG + Intergenic
965042906 3:163534008-163534030 CTGTGTGAGTACACAATACTTGG + Intergenic
965417735 3:168418061-168418083 GTGTGTGTTTTCATGATTCTGGG + Intergenic
966305396 3:178527767-178527789 GTGTGTGTGTGCATGATTCTAGG - Intronic
966496698 3:180589870-180589892 CTGTGGTAGTCCATGCTTATGGG - Intergenic
972033332 4:34490315-34490337 GTGTGTGAGTGCTTGTTTCTGGG + Intergenic
972431737 4:38989701-38989723 TTGTGTGAGTCACTGATTCCTGG - Intronic
973207215 4:47574444-47574466 CTTTCTGAGACCATGGTTCTTGG + Intronic
973914259 4:55617494-55617516 GTGTGTGTGTCCATGATTTCAGG - Intronic
979680511 4:123454325-123454347 CTGTTTGGGTCCAAAATTCTGGG - Intergenic
979711326 4:123783156-123783178 TTTTATGATTCCATGATTCTTGG - Intergenic
981230577 4:142349770-142349792 ATGTGTGATTCTTTGATTCTTGG - Intronic
981493221 4:145363591-145363613 ATGTTTGTGTCCATGGTTCTTGG + Intergenic
984561339 4:181274384-181274406 CTGTTTTGGTCCATGATTCTTGG + Intergenic
985222224 4:187719584-187719606 CTGTGTGAGTCCACGTCTCCAGG + Intergenic
985707793 5:1411428-1411450 CTGTGGCAGGCCATGCTTCTCGG - Intronic
987281010 5:16413745-16413767 TTTTCTGAGGCCATGATTCTTGG + Intergenic
987582465 5:19811809-19811831 CTGTGTGTGTGAAGGATTCTAGG - Intronic
994751211 5:103739146-103739168 GTATGTGATTCTATGATTCTTGG - Intergenic
995452584 5:112318760-112318782 TTGTGAGAGTCCATATTTCTGGG - Intronic
996478867 5:123950513-123950535 CTGTGAGAATGCATGAGTCTGGG + Intergenic
999082216 5:148855291-148855313 CTGTTTGAATCCAGGCTTCTTGG + Intergenic
999486259 5:151999258-151999280 CTGGCTGAGTATATGATTCTTGG + Intergenic
999657540 5:153825434-153825456 TTGTGAGAGTTCAAGATTCTGGG - Intergenic
1000127075 5:158256120-158256142 CTGTGTGAGAAGGTGATTCTTGG - Intergenic
1000811423 5:165866782-165866804 CTGTGACAGTCTATGCTTCTTGG - Intergenic
1003398363 6:5772056-5772078 CTGTGTGCCTCCAAGACTCTGGG - Intergenic
1004740334 6:18454120-18454142 CTGTGTGAGGTTATGATGCTTGG - Intronic
1004800044 6:19135830-19135852 CTGTGGGAGTCAATTTTTCTGGG - Intergenic
1006572571 6:35017789-35017811 CTGTGTGAGTCAAAGTTTCAGGG - Exonic
1008128496 6:47694544-47694566 CTCTGTGAGTCCATCTCTCTGGG - Intronic
1010364579 6:75034358-75034380 CTGTGTGACACAATGAATCTGGG + Intergenic
1012058450 6:94446080-94446102 CTGTGTCAGTTGATGTTTCTGGG - Intergenic
1014649231 6:124015480-124015502 CTGTGTGACTTCATGATGATGGG - Intronic
1018726498 6:166616770-166616792 CTGTGTGAGCCCAGGTCTCTAGG - Intronic
1019423508 7:962688-962710 CTGTGTGAGGCCCTGAGTTTGGG + Intronic
1022485983 7:30777978-30778000 AACTGTGAGTCCATGACTCTGGG - Intronic
1023369279 7:39496861-39496883 CTGAGTGAGTCCCTGAGTCATGG - Intergenic
1023445671 7:40229168-40229190 CTGGGTTAGTCTTTGATTCTAGG + Intronic
1023586001 7:41730274-41730296 CTGTGTGAGGATATGATACTGGG + Intergenic
1023645878 7:42314193-42314215 ATGTGTGAGGCCATCACTCTAGG + Intergenic
1023652971 7:42390106-42390128 CTGGGTGATGCCATGCTTCTGGG + Intergenic
1026925340 7:74188402-74188424 CTGTGTAAGTGCACGATGCTAGG + Intronic
1027487447 7:78779737-78779759 CCGTATTAGTCCATGATACTGGG + Intronic
1028123530 7:87084879-87084901 CTGAGTGACTACATGATTGTAGG - Intergenic
1028391569 7:90322357-90322379 TTGTGAGAGTCCATGATTAATGG - Intergenic
1031119129 7:117700639-117700661 CTGTATAATTCTATGATTCTGGG + Intronic
1032766144 7:134995728-134995750 CTGTGTGACATCATGACTCTGGG - Intronic
1032947587 7:136870446-136870468 CCGTGTGTGTCAATAATTCTGGG - Intronic
1033180087 7:139168322-139168344 CAGTGTTATTCCATGTTTCTAGG + Exonic
1033663528 7:143420442-143420464 ATGTGAGTGTCCATGGTTCTTGG - Intergenic
1034879104 7:154750120-154750142 CTGTGTGTGTCCGTGATGCTGGG + Intronic
1038095724 8:24307685-24307707 CTGTGAAAGTCCCTGATGCTGGG + Intronic
1040846353 8:51846142-51846164 CTGTGTTAGCCCATGGTTTTAGG - Intronic
1041208434 8:55522594-55522616 CTTTGTGATTCCATGATTGAAGG - Intronic
1042034337 8:64514999-64515021 GTGTGTGTGTCCATGACTATCGG - Intergenic
1043986838 8:86703545-86703567 CAGTGTGAGTGCATGTTTATGGG + Intronic
1044838669 8:96319238-96319260 CTGTGTGAGTACACCATTCATGG + Intronic
1045243405 8:100422223-100422245 CTGTGTGACTGCAGGATACTAGG + Intergenic
1049119849 8:140725688-140725710 CACTGTGTGTGCATGATTCTAGG - Intronic
1049240587 8:141535658-141535680 CTGTGTGGGTCCAGGGTTCCCGG + Intergenic
1052957646 9:34266302-34266324 CTGTGTTAGCCCTTGCTTCTGGG - Intronic
1058588252 9:106533041-106533063 CTGTGTGACCTCATGCTTCTTGG - Intergenic
1058814476 9:108670707-108670729 CCTTGAGAGTCCAAGATTCTTGG + Intergenic
1059228489 9:112695575-112695597 CTGTCTGTGGCCAGGATTCTGGG + Intronic
1060087671 9:120715989-120716011 CTGTGTGAGTTTATGAGTATGGG + Intergenic
1060777463 9:126386044-126386066 CTGTATTAGTGTATGATTCTTGG + Intronic
1061461171 9:130740477-130740499 CTGGCTGAGACCATGATACTGGG - Intronic
1187227291 X:17385885-17385907 CTCTATGATTCCAAGATTCTAGG - Intronic
1187749365 X:22445090-22445112 CTGTGTGGTTCCATCACTCTGGG - Intergenic
1188036355 X:25321734-25321756 GAGTGGGAGTCCATAATTCTAGG - Intergenic
1188340644 X:28997030-28997052 CTGGGTAAGTCCATGATCCCTGG - Intronic
1192181840 X:68921032-68921054 CTCTGAGATTCCATGACTCTGGG - Intergenic
1193344384 X:80388183-80388205 CTCTTTGGGTCCCTGATTCTAGG - Intronic
1195579068 X:106481244-106481266 CTGTGTGAGTTGCAGATTCTGGG - Intergenic
1197599389 X:128509812-128509834 CTGTGTGAGTCAGTGATTGAGGG - Intergenic
1198127170 X:133656948-133656970 CCGTGTGATTCCATGATTTGTGG - Intronic
1198478002 X:137014472-137014494 CTGTTTTACTACATGATTCTGGG + Intergenic
1198517326 X:137422833-137422855 CTGTCTGAGCTCATGACTCTGGG + Intergenic