ID: 1135854994

View in Genome Browser
Species Human (GRCh38)
Location 16:26001332-26001354
Sequence GTCTATGTGAATATACATAA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 358
Summary {0: 1, 1: 0, 2: 0, 3: 25, 4: 332}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1135854994 Original CRISPR GTCTATGTGAATATACATAA AGG Intronic
906246785 1:44281763-44281785 GAATATGTGCATATACATGAAGG + Intronic
906373975 1:45279292-45279314 TTCTGTGTCAATATTCATAAGGG - Intronic
906819337 1:48912859-48912881 GTCTATTAGAATAAACGTAAGGG + Intronic
908341286 1:63182318-63182340 ATATATGTGTATATACATACTGG - Intergenic
908457682 1:64320292-64320314 GTCTATGTCAATAACCATTAAGG - Intergenic
909170643 1:72289571-72289593 GTGTATGTGTATATATATAATGG - Intergenic
909328231 1:74379978-74380000 GTCTAAGGGAATTTACTTAATGG - Intronic
909737742 1:78985974-78985996 GTATATGTGGATATAAAGAAGGG + Intronic
910612610 1:89161221-89161243 GTGTACGTGAATATTCATTATGG - Intronic
912099824 1:106191490-106191512 GGCTATTTGAAAATACAGAAAGG + Intergenic
916468530 1:165097148-165097170 GTAAATATGAATATACTTAAAGG + Intergenic
918111882 1:181461933-181461955 ATGTGTGTGAATATACATACAGG - Intronic
918559980 1:185853860-185853882 ATCTATGGGAATATCCTTAAGGG + Intronic
918782852 1:188725134-188725156 GTCTAAGGGAATACAAATAATGG - Intergenic
918898129 1:190374634-190374656 GTCTTTGTGTCTATACATGAAGG - Intronic
919256322 1:195129126-195129148 TTCTCTGTGAATATATAAAACGG + Intergenic
919496001 1:198268748-198268770 GGATATGTGAATACACAAAACGG - Intronic
920857094 1:209671908-209671930 TTCTATGTGGATGTACTTAATGG - Intergenic
921002456 1:211057307-211057329 GGCTATTTGAAAATACACAAAGG + Intronic
922131608 1:222786077-222786099 GTCTATGTGTGTATATATATGGG + Intergenic
922137675 1:222847470-222847492 GTGTATGTGCATATACACACAGG + Intergenic
922642545 1:227248031-227248053 GTCTATTTGAAAATACACAGAGG + Intronic
1064069351 10:12212840-12212862 GAATATTTGCATATACATAATGG - Intronic
1064118688 10:12600815-12600837 GTACATGTGAACATACAGAATGG - Intronic
1064696638 10:17973922-17973944 GTCTATTTGAAAATACACAGAGG - Intronic
1064840696 10:19588031-19588053 TTTTATGTGATTTTACATAAAGG - Intronic
1065282747 10:24156418-24156440 CTCTATGTGAATGTTCATATTGG - Intronic
1065675597 10:28170162-28170184 ATATATATGTATATACATAAAGG - Intronic
1066143648 10:32534112-32534134 GGCTATTTGAAAATACAAAAAGG - Intronic
1066725055 10:38383314-38383336 AACTATGACAATATACATAAAGG + Intergenic
1068168823 10:53366715-53366737 GTTTGTGTGTATATACAGAAGGG - Intergenic
1070531214 10:77339042-77339064 GTATCTGTGTTTATACATAAAGG - Intronic
1071070981 10:81693660-81693682 GTGTGTGTGTATATACATATGGG + Intergenic
1071798708 10:89033779-89033801 GTGTATGTGTATATATATACTGG + Intergenic
1071812011 10:89192636-89192658 GTTTGTGTATATATACATAAAGG + Intergenic
1073878221 10:107950205-107950227 GTCTATGTGAATTGCTATAAAGG - Intergenic
1073967910 10:109012798-109012820 GTCTATTTTAATTTACACAAAGG + Intergenic
1074233100 10:111557258-111557280 GTCCATCTGAATAAACATGAAGG - Intergenic
1075994800 10:126868649-126868671 GGAGATGTGAATATACTTAATGG + Intergenic
1078872262 11:15358949-15358971 ATATGTGTGAATATACATCACGG + Intergenic
1078945998 11:16069659-16069681 GTTTATGCAAATACACATAAAGG + Intronic
1079854077 11:25578345-25578367 GTTTATGTGTATAAACATTAGGG + Intergenic
1080796571 11:35569059-35569081 GGCTATTTGAAAATACATAGAGG + Intergenic
1081346326 11:41991535-41991557 GGATATGGGAATAGACATAAAGG - Intergenic
1085147493 11:74214262-74214284 GGTTATTTGAATATACACAAAGG + Intronic
1085686738 11:78630282-78630304 GCCTATTTGAAAATACAGAAAGG - Intergenic
1086109350 11:83182059-83182081 GTTTATGAGTATTTACATAAAGG - Intronic
1087370843 11:97281222-97281244 GTCTATTTGAAAATACATAGAGG + Intergenic
1087749124 11:101986756-101986778 GTATATGTAAGTATATATAAGGG + Intronic
1088556601 11:111067673-111067695 GTATATGTATATATACACAATGG + Intergenic
1088968393 11:114749280-114749302 GTGTATGTATATATGCATAATGG - Intergenic
1090315987 11:125788948-125788970 TTCAATCTGAATCTACATAAAGG - Intronic
1090784228 11:130034697-130034719 GTCTATATGTATATAATTAAAGG + Intergenic
1091578855 12:1767396-1767418 GTCTATATGAATATTCATTTTGG - Intronic
1095548183 12:43397403-43397425 CACTATGTGAATGTAAATAATGG + Intronic
1095645147 12:44535140-44535162 GTTTATATGAAAATACATTATGG - Intronic
1096445076 12:51682251-51682273 GTCTGTGTCTATATTCATAAGGG + Intronic
1097296525 12:57970729-57970751 GTATATATGTATATATATAATGG - Intergenic
1099777657 12:87153664-87153686 GGCAATGGGAATATAAATAAGGG + Intergenic
1101251806 12:102944464-102944486 GGCTATTTGAAAATACACAAAGG - Intronic
1102379891 12:112455846-112455868 GTCTATGTTGATATTCATAAAGG - Intronic
1102384428 12:112496119-112496141 GTCTCTATCAATATAAATAATGG - Intronic
1106003649 13:25748908-25748930 GCCTATGTGTATATACATGGTGG - Intronic
1107524039 13:41212790-41212812 GTCTATTTGAAAATACACAGAGG - Intergenic
1109259960 13:60133287-60133309 TTCTAAGTTAATATACTTAATGG - Intronic
1109282486 13:60372822-60372844 CTCCATGTGACTATACATCAAGG - Intergenic
1109349600 13:61161306-61161328 AACTATGTGAATATATGTAAAGG - Intergenic
1109488730 13:63065233-63065255 GTGTACCTGAAGATACATAAGGG + Intergenic
1110306875 13:73998359-73998381 CTCTATTTAAAGATACATAAAGG - Intronic
1111000171 13:82167985-82168007 GTGTGTGTAAATATATATAATGG - Intergenic
1111275835 13:85945830-85945852 TTCTATGTGAATATTCAATAGGG - Intergenic
1112479965 13:99766230-99766252 GGCTACTTGAAAATACATAAAGG - Intronic
1112565881 13:100551301-100551323 GTCTGTGTATATATACATTATGG - Intronic
1112675349 13:101695095-101695117 TTCAATGGGAATATACATAACGG + Intronic
1113152508 13:107280482-107280504 GTCAATGAGGAAATACATAATGG - Intronic
1114681248 14:24485385-24485407 GCCTATATGTATATACTTAAAGG + Intergenic
1115301329 14:31888658-31888680 GTCTATGAGAAAATAAAAAAGGG - Intergenic
1116175567 14:41465854-41465876 GTCTGTGCTAATTTACATAAGGG + Intergenic
1117249717 14:53924392-53924414 GTGTGTGTGTATATATATAATGG - Intergenic
1117290088 14:54324020-54324042 GTGTGTGTGTATATATATAATGG + Intergenic
1118197107 14:63637586-63637608 ATATATGTGTATATATATAATGG + Intronic
1118214461 14:63795506-63795528 GTATATATGTATATATATAAAGG - Intergenic
1118881827 14:69834518-69834540 ATCTATGTGAATCAAAATAAGGG - Intergenic
1120275941 14:82372113-82372135 GGCTATTTGAAAATACATAGAGG + Intergenic
1120541764 14:85759765-85759787 GTGTGTGTGTATATATATAATGG - Intergenic
1121376120 14:93412217-93412239 GCCTATGTGAAAATACATGGAGG + Intronic
1121847104 14:97181475-97181497 GTATATGTGCATATGCATACAGG - Intergenic
1122766927 14:104078946-104078968 AACAATGTGAATATACTTAACGG - Intergenic
1122818254 14:104325990-104326012 GTCAGTGTGAATATGCATTACGG + Intergenic
1124831053 15:33149853-33149875 GTCTCTGTGGATATACATTATGG - Intronic
1125293362 15:38174465-38174487 GTGTGTGTGTATATACATATAGG - Intergenic
1126292288 15:47095409-47095431 GTATATATGTATATACACAATGG + Intergenic
1127359710 15:58234545-58234567 GTCTATAGGAATAATCATAAAGG + Intronic
1129196436 15:73970023-73970045 GTGTATATGTATATACATATAGG - Intergenic
1130863867 15:87915174-87915196 GTGTATATGCATATGCATAATGG - Intronic
1133196887 16:4177367-4177389 GTCTATCAGAACAAACATAAAGG + Intergenic
1134841774 16:17407325-17407347 ATATATGTGTATATATATAAGGG + Intronic
1135854994 16:26001332-26001354 GTCTATGTGAATATACATAAAGG + Intronic
1137366912 16:47868058-47868080 GAATATTTGCATATACATAATGG - Intergenic
1137945126 16:52726542-52726564 GTTTATGAGATTATACATGAGGG - Intergenic
1138325940 16:56168036-56168058 GTCTATGAGAATTAACAAAAGGG + Intergenic
1140023640 16:71263373-71263395 TTCTATGTCAATATTCATAAGGG + Intergenic
1142894718 17:2966466-2966488 GTCTAATTGAAGATTCATAAAGG + Intronic
1143942844 17:10560561-10560583 TGCTATTTGAATATACATAATGG - Intergenic
1144153825 17:12478337-12478359 GTATATGTGTATATACACGATGG - Intergenic
1144309440 17:13998901-13998923 CACTCTGTGATTATACATAATGG + Intergenic
1145050702 17:19658171-19658193 GTCTCTCTGATTATACCTAAAGG - Intronic
1146390000 17:32413190-32413212 CTCTATGTGTATATACAGATAGG + Intergenic
1147549440 17:41429113-41429135 GTCTATGTCATTATGCAAAATGG - Intergenic
1149020492 17:51957931-51957953 TTCTCTGGGAATATACACAAGGG - Intronic
1149261562 17:54885487-54885509 GTGTGTGTGTATATATATAAAGG - Intergenic
1149569042 17:57659425-57659447 GGCTATGGTAATATACATCACGG - Intronic
1151060522 17:71087588-71087610 GAAAATGTGTATATACATAATGG - Intergenic
1151521931 17:74636433-74636455 GACCATGGGAATATACAGAAGGG - Intergenic
1152818890 17:82425575-82425597 GTCTCTGTGAAAATCAATAACGG + Intronic
1155270201 18:24134100-24134122 GTCAATGTGAATACACATTTTGG - Intronic
1156317070 18:35979818-35979840 GTAAATGTGTATATACACAATGG + Intergenic
1156593695 18:38521241-38521263 CTATATGTGAAAATACTTAAAGG + Intergenic
1156622929 18:38874104-38874126 TTTTATATGTATATACATAATGG + Intergenic
1158049806 18:53203245-53203267 GTGTATGTAATTATACAGAAAGG + Intronic
1158257946 18:55574184-55574206 TTCTATGTGAATATAAAGGAAGG - Intronic
1159082199 18:63747751-63747773 ATATATGTGAATATACACATAGG - Intergenic
1159149482 18:64502946-64502968 ATGTATGTAGATATACATAAAGG - Intergenic
1159473316 18:68884156-68884178 TCCTCTGCGAATATACATAAAGG + Intronic
1159548193 18:69867136-69867158 TTTTATATGAATATAAATAAAGG - Intronic
1164840197 19:31387466-31387488 GTCTATGTGAAAATTCAGCACGG - Intergenic
926364735 2:12122729-12122751 ATATATGGGAATATACATATGGG - Intergenic
926364739 2:12122757-12122779 ATATATGGGAATATACATATGGG - Intergenic
926364759 2:12122893-12122915 ATATATGGGAATATACATATGGG - Intergenic
926364763 2:12122921-12122943 ATATATGGGAATATACATATGGG - Intergenic
926364767 2:12122947-12122969 ATATATGGGAATATACATATGGG - Intergenic
926364771 2:12122973-12122995 ATATATGGGAATATACATATGGG - Intergenic
926364775 2:12123003-12123025 ATATATGGGAATATACATATGGG - Intergenic
926550501 2:14295207-14295229 TTCTATGTGTTGATACATAAAGG - Intergenic
927009205 2:18884595-18884617 GTCTGTGTATATATACACAATGG + Intergenic
927344139 2:22017285-22017307 ATCAATGTGAATATAAACAAAGG + Intergenic
930571379 2:53090759-53090781 GTATATATGTATATGCATAAAGG + Intergenic
931871263 2:66462783-66462805 GTTTTTGAGAATATGCATAATGG + Intronic
932391485 2:71394390-71394412 ATCTGTGTGATTATGCATAAAGG - Intronic
932557380 2:72836794-72836816 TTGTATGTGAATATTCATAGTGG - Intergenic
933338318 2:80988211-80988233 GTCTATTTGAAAATACACAGAGG + Intergenic
933353501 2:81186156-81186178 ATCTAGGTGAATATAGATATAGG + Intergenic
933459135 2:82557391-82557413 TTCTATGAAAATATACTTAAGGG + Intergenic
933997091 2:87677946-87677968 GTCTTTGTGCAAATACAGAAGGG - Intergenic
934571732 2:95376893-95376915 GTCTCTAAGAATATACAGAAAGG - Intronic
934741637 2:96728058-96728080 GTTTACTTCAATATACATAAAGG - Intronic
936292343 2:111235911-111235933 GTTTATGTGAATATAATCAAAGG + Intergenic
936296757 2:111272964-111272986 GTCTTTGTGCAAATACAGAAGGG + Intergenic
936707693 2:115095069-115095091 GTCTATGTAAATTTGCATCATGG - Intronic
936811171 2:116404485-116404507 GTTTGTGTCAATATATATAATGG - Intergenic
937587770 2:123575110-123575132 GTCTATGTGAGTATAAGTATTGG + Intergenic
937785703 2:125895071-125895093 ATATATGTGAATATATATATGGG - Intergenic
937843490 2:126551877-126551899 GTGTATGTATATATATATAAAGG + Intergenic
938406067 2:131033909-131033931 CTCTGTGTGTATATACATATGGG - Intronic
939060638 2:137417945-137417967 GTCTTGGTAAATAAACATAAAGG - Intronic
939135191 2:138285412-138285434 GAATATTTGAATATACATACTGG - Intergenic
939248270 2:139653483-139653505 GTCAATGTGAATAAATTTAAGGG - Intergenic
939915842 2:148042198-148042220 ATCTATGTGGATATAAATAGTGG + Intronic
940608621 2:155961637-155961659 TTCTGTGTGTATATACACAATGG + Intergenic
942100220 2:172573468-172573490 GTATATGTGTATATATATATAGG + Intronic
943575985 2:189631846-189631868 GACTATGTGGATACACTTAAAGG - Intergenic
943684351 2:190802028-190802050 GTCTATATCACTATACATAAAGG - Intergenic
943879650 2:193125085-193125107 GTCACTGTGTATATACAGAATGG + Intergenic
945602050 2:211880481-211880503 GTTTACTTGACTATACATAAGGG + Intronic
945623622 2:212172564-212172586 GTATATGTGTATATACACCATGG + Intronic
945721146 2:213420835-213420857 GTATATGTGAACATGCATGATGG - Intronic
946288788 2:218727252-218727274 GTCTATCTGAAAATACACAAAGG - Exonic
947627098 2:231626518-231626540 GGATATGGGAATATACAAAATGG + Intergenic
1169352847 20:4883577-4883599 GTCTGTGTGAATGTTCCTAAAGG + Intronic
1170344893 20:15374263-15374285 ATATATGTGATTATATATAAGGG - Intronic
1174132174 20:48352903-48352925 GTCCATGTGCATATACATATCGG + Intergenic
1174197042 20:48780611-48780633 GTTTATGATAATATAAATAATGG + Intronic
1174948849 20:55020945-55020967 ACATATGTGTATATACATAAGGG - Intergenic
1177080905 21:16637500-16637522 GTCTCTGTGAACACACATAAAGG + Intergenic
1178062545 21:28868001-28868023 GTATAAGTGATTATACACAAAGG - Intergenic
1179332178 21:40413881-40413903 GAATATGTGAACATACATAGGGG + Intronic
1184627538 22:45748306-45748328 TTCTATGTAAATACATATAATGG - Intronic
1185281186 22:49970720-49970742 GTCTATGTGTATATGCATGTGGG + Intergenic
949294226 3:2502055-2502077 GAATATTTGCATATACATAATGG - Intronic
949648407 3:6126116-6126138 GTGTATATTAATATACACAATGG + Intergenic
951067144 3:18279850-18279872 GTTTATGTGAATAGATACAAGGG - Intronic
951744151 3:25958741-25958763 GAGTATGTGAATATATATATGGG - Intergenic
952568203 3:34682831-34682853 GTTTATGTGCTTATACATAAAGG + Intergenic
952781420 3:37103472-37103494 GTCTTTGGGAATATAAAAAAAGG - Intronic
953234877 3:41097413-41097435 GTGTGTGTGTATATATATAAAGG + Intergenic
953396084 3:42571466-42571488 GTGTATGTGAATGTACAGGATGG + Intronic
953695636 3:45156221-45156243 GTGTATGTGTATCTACACAATGG - Intergenic
954367240 3:50152994-50153016 GTGTGTGTGCATATACATATCGG - Intergenic
954487873 3:50871725-50871747 GGCTATTTGAAAATACACAAAGG - Intronic
955274194 3:57532040-57532062 GGCTATTTGAAAATACATAAAGG - Intronic
956099488 3:65752626-65752648 GTCTTTGTGAACACACATCAAGG - Intronic
956519879 3:70092301-70092323 GTATATGAGAATATACATGATGG + Intergenic
956914433 3:73856270-73856292 GTCTATGATAATTAACATAAAGG - Intergenic
957853188 3:85838193-85838215 ATCTATGTGAATTTAAACAAGGG + Intronic
957929406 3:86859561-86859583 GTATATGGGAATATATATATGGG - Intergenic
957929443 3:86859946-86859968 ATATATGGGAATATACATATGGG - Intergenic
958220832 3:90675429-90675451 GTCTATGTGGATATTCAAAGCGG - Intergenic
958657201 3:97017999-97018021 GGCTATGTGAAAATACATAGAGG - Intronic
959832670 3:110882959-110882981 TACTATGTGCTTATACATAAGGG + Intergenic
959948910 3:112156362-112156384 GTATGTGTGTATATACACAATGG - Intronic
960171747 3:114470324-114470346 GCCTATCTGAATATACTTAGTGG + Intronic
961155149 3:124673429-124673451 TTCTATATGTATATACATACAGG - Intronic
961155150 3:124673465-124673487 TTCTATATGTATATACATACAGG - Intronic
961155151 3:124673501-124673523 TTCTATATGTATATACATACAGG - Intronic
961155152 3:124673537-124673559 TTCTATATGCATATACATACAGG - Intronic
961155153 3:124673573-124673595 TTCTATATGCATATACATACAGG - Intronic
961155154 3:124673609-124673631 TTCTATATGCATATACATACAGG - Intronic
962176130 3:133157414-133157436 GTGTATGTGTACACACATAAAGG - Intronic
962451954 3:135527147-135527169 GTATGACTGAATATACATAATGG + Intergenic
962502071 3:136005272-136005294 GAATATCTGCATATACATAATGG - Intronic
964364748 3:155937977-155937999 GTCTCTGTGAATATGTATGAAGG + Exonic
964804232 3:160588984-160589006 GGCTATGTGAAAATACACAGAGG + Intergenic
965442180 3:168728385-168728407 GTATATATGAATATATAAAAAGG - Intergenic
967585495 3:191209236-191209258 GTCTCTTTGACTTTACATAAAGG - Intronic
967721688 3:192822451-192822473 TTCTATGTGGATATCCAAAAGGG - Intronic
969450973 4:7273161-7273183 GTCTTTGTAAATATTCATAAGGG - Intronic
969627662 4:8315945-8315967 GTGAATGTGAAAATACACAAAGG - Intergenic
969966464 4:11001800-11001822 GTGTGTGTGTATATATATAAAGG - Intergenic
970569226 4:17363351-17363373 GTCTATGTTAAGCTACATTATGG - Intergenic
971328221 4:25661688-25661710 GTGTATGTGAATATATATGCAGG - Intronic
971442615 4:26704716-26704738 TTCTATGCAAATATAGATAAAGG + Intronic
971522566 4:27572432-27572454 GTCTGTGTGTGTATATATAACGG - Intergenic
971903922 4:32700911-32700933 TTCTATGTGATAAAACATAAAGG + Intergenic
972013873 4:34219657-34219679 GTATATATGTATATATATAATGG - Intergenic
972015000 4:34232537-34232559 GGCTATTTGAAAATACATAGAGG - Intergenic
972145461 4:36019562-36019584 ATGTATATGTATATACATAAGGG + Intronic
972666147 4:41167083-41167105 GTTTCTTTGCATATACATAAAGG + Intronic
974139702 4:57869781-57869803 ATATATGTGCATATATATAAAGG + Intergenic
974676443 4:65095539-65095561 ATATATGTGGATATACATATAGG + Intergenic
975902961 4:79174770-79174792 GTGTATGATAATTTACATAAAGG + Intergenic
976598513 4:86916280-86916302 GTCTATGTGAATGCTCATCAAGG + Intronic
976666848 4:87604129-87604151 ATCCAAGTGAATATACAAAAAGG - Intergenic
978047932 4:104155704-104155726 TTCTATGTGGGTATAGATAAAGG + Intergenic
978513813 4:109550373-109550395 GGCTATGTGAACATACAGCAGGG - Intergenic
978616742 4:110604866-110604888 TTATATGTGTATATATATAAAGG + Intergenic
978718030 4:111869346-111869368 GAGTATGTGTATATACAAAAGGG + Intergenic
979783289 4:124682991-124683013 ATCTATCAAAATATACATAAAGG - Intronic
979810209 4:125027318-125027340 ATCTATATGAATATACATGAAGG - Intergenic
980493807 4:133565132-133565154 AACTATGAGATTATACATAATGG - Intergenic
981070836 4:140536373-140536395 TTCTATGTGAATATAGAGGAAGG + Intronic
981409182 4:144407947-144407969 GTTAATGTGAATATACATTTTGG + Intergenic
981975718 4:150725042-150725064 GGCTATTTGAAAATACATAGAGG + Intronic
983025799 4:162736311-162736333 GTATATATAAATATATATAAAGG - Intergenic
984358561 4:178697598-178697620 GTCTATGTGGATAAACAAAAAGG + Intergenic
984369472 4:178843865-178843887 GAAAATGTGAATATATATAATGG + Intergenic
984515845 4:180737965-180737987 GTATATGTGCAAATATATAAAGG - Intergenic
984996606 4:185437313-185437335 GTCTATTTGTAAATAAATAAAGG + Intronic
986864070 5:11963906-11963928 GTGTATTTGTATATACATATTGG + Intergenic
987046167 5:14110967-14110989 GTCTATCTCAAGATACAAAATGG - Intergenic
987189645 5:15462860-15462882 GTCTATCTGAAAATATACAAAGG - Intergenic
987752267 5:22056180-22056202 ATAAATGTGATTATACATAATGG - Intronic
987792920 5:22591769-22591791 ATCTATGTGCACATACATCATGG + Intronic
988561696 5:32287530-32287552 ATGTATGTGTATATATATAAAGG - Intronic
991515045 5:67425915-67425937 GTATACTTGAATATACCTAAGGG + Intergenic
992239389 5:74750767-74750789 ATATATGTGTATATATATAAAGG + Intronic
992247997 5:74847403-74847425 GTTTATGTCACTGTACATAATGG + Intronic
992731827 5:79678660-79678682 CTCTATGAAAATATACTTAATGG - Intronic
993462394 5:88199735-88199757 TTCCAGGTGAAAATACATAACGG + Intronic
993547814 5:89234053-89234075 GTCAATGTGAATAATCATGAAGG - Intergenic
993553104 5:89300279-89300301 ATCTCTGTGTATATACATAAAGG + Intergenic
993921289 5:93807031-93807053 GCCTATGTGAATTTACAAAAAGG - Intronic
994029807 5:95128771-95128793 GACTCTGTGAATATACTAAAAGG + Intronic
994641620 5:102417701-102417723 GTAAATATGAATCTACATAAAGG - Intronic
994771057 5:103982173-103982195 ATCTGTGTGTATATATATAAAGG - Intergenic
995096527 5:108241427-108241449 GGCTATTTGAAAATACATAGGGG + Intronic
995159116 5:108954878-108954900 GTCCATCAGAATATACAGAAAGG - Exonic
995262032 5:110115442-110115464 GTCTATCTAAATATAGAGAAGGG - Intergenic
995912234 5:117201821-117201843 ATATATCTGAATATTCATAAGGG + Intergenic
996876518 5:128246350-128246372 GACTATGTGACTTAACATAATGG - Intergenic
1002974698 6:2062550-2062572 GTTTATGTATATATACATTATGG - Intronic
1004209449 6:13623858-13623880 GTATATGTGTCTATAGATAATGG + Intronic
1005159449 6:22842241-22842263 GTACATGTGAATATACAGAGTGG + Intergenic
1005847657 6:29793680-29793702 GTCCATGGAAATATACATTATGG + Intergenic
1007792014 6:44315190-44315212 CTCTATGTAAATATACTAAAAGG - Intronic
1008171249 6:48209846-48209868 GTGTATGTGCATATACATTGAGG - Intergenic
1008237572 6:49068915-49068937 GTATATGTGCATATACATATGGG + Intergenic
1009329567 6:62400191-62400213 GGCTATTTGAAAATACACAAAGG - Intergenic
1010117005 6:72325328-72325350 GTTTATGTGATTATGCATATAGG + Intronic
1010318402 6:74477507-74477529 GTCTTTGTGATTATAAACAATGG - Intergenic
1010474749 6:76273692-76273714 GGCTATTTGAAAATACATAGAGG - Intergenic
1010699364 6:79023696-79023718 TTATATGTGATTCTACATAAAGG + Intronic
1010832083 6:80543058-80543080 GTCTATATATATATCCATAAGGG - Intergenic
1011324870 6:86139535-86139557 GTGTGTGTGTATATATATAATGG + Intergenic
1011343393 6:86341888-86341910 GGCTATATGAAAATACATAGAGG + Intergenic
1011465468 6:87651371-87651393 GTCTATTTGAATAGGCCTAAAGG + Intronic
1011785117 6:90835169-90835191 GGCTAGGTGAATATAGATTAAGG - Intergenic
1012099974 6:95070953-95070975 ATATATGTGAATATATATATGGG - Intergenic
1012984200 6:105857561-105857583 GTTTTTGTGAATATAAGTAAAGG + Intergenic
1014456611 6:121642357-121642379 ATATATATGAATATATATAAAGG + Intergenic
1016277390 6:142370887-142370909 ATATGTGTGAATATACATACAGG - Intronic
1016788039 6:148035052-148035074 ATATATATGAATATATATAAAGG - Intergenic
1016828912 6:148414256-148414278 GTCCACATGAATATACATATGGG - Intronic
1016856535 6:148676383-148676405 ATCGATGTGTATATATATAAAGG + Intergenic
1017941330 6:159055751-159055773 GTATATATGAATACACATATAGG + Intergenic
1019131279 6:169878475-169878497 GACTATTTGAAAATACATGAAGG - Intergenic
1020742316 7:12037434-12037456 GTATATGTATATATACATATAGG - Intergenic
1021859676 7:24894014-24894036 GACTATGTGAACATTAATAATGG - Intronic
1023914550 7:44579038-44579060 GGCTTTGTGAATGTAAATAAGGG - Exonic
1024111288 7:46149205-46149227 GTGTGTGTGTATATACACAATGG - Intergenic
1027372436 7:77520304-77520326 ATTTATGTGATTCTACATAAAGG - Intergenic
1031663272 7:124453959-124453981 GTCTGTGTGTATATACAGTACGG - Intergenic
1032287566 7:130552971-130552993 TGCTATGTGAATACACAGAAAGG + Intronic
1032636295 7:133712880-133712902 ATCTATATGAATATCCAGAATGG + Intronic
1033647130 7:143314170-143314192 GTGTATATAAATATATATAATGG - Intergenic
1034953669 7:155318665-155318687 GTCTATGTCAATCCACAGAAAGG + Intergenic
1035977234 8:4325872-4325894 GACCATGTGCATATACAGAACGG - Intronic
1037369855 8:18164143-18164165 GGCTATTTGAAAATACATAGAGG + Intergenic
1038923108 8:32108039-32108061 ATCTATATGAATATATATATAGG + Intronic
1040394979 8:46989647-46989669 GTGTGTGTGTATATATATAAAGG + Intergenic
1040512939 8:48111392-48111414 GTGTGTGTAAATATATATAATGG - Intergenic
1041609798 8:59831784-59831806 GGCTATTTGAAAATACATAGAGG + Intergenic
1042518063 8:69680720-69680742 GTCTAAGTTAATATACATTCTGG + Intronic
1043530532 8:81145145-81145167 TTCTATGTCATTTTACATAAAGG + Intergenic
1043654193 8:82641212-82641234 GTACATGTGGATTTACATAATGG + Intergenic
1043762357 8:84083021-84083043 GTCAATGTGAAAAAACATATAGG - Intergenic
1043820046 8:84852128-84852150 AACTATGTGAATATGCACAATGG + Intronic
1044744612 8:95360174-95360196 GTATATATGTATATACATATGGG - Intergenic
1045124093 8:99070800-99070822 GGCTATTTGAAAATACATACAGG - Intronic
1045652983 8:104359024-104359046 ATCTGTGTGAACATACATACAGG + Intronic
1046053405 8:109050785-109050807 TTATATTTGAATATTCATAACGG + Intergenic
1046422039 8:113999232-113999254 GTGTATGTGAAAATAGAAAATGG - Intergenic
1046540721 8:115578682-115578704 ATATATTTAAATATACATAAAGG + Intronic
1050019176 9:1266281-1266303 CTCTATGGAAATATACATAAAGG + Intergenic
1050356130 9:4784078-4784100 GGCTATTTGAAAATACATAGAGG + Intergenic
1051034659 9:12729269-12729291 GTGTGTGTACATATACATAATGG + Intergenic
1052258594 9:26489240-26489262 GGCTATTTGAAAATACACAAAGG - Intergenic
1053427919 9:38023153-38023175 GGCTATGTAAATATACAGAAAGG + Intronic
1054095367 9:60895758-60895780 GTCTAAGTCAATAGACATATGGG - Intergenic
1054419914 9:64918191-64918213 GGATTTGTGAATATATATAATGG + Intergenic
1055092900 9:72380725-72380747 GTTTATATTAATATATATAATGG - Intergenic
1055161590 9:73135779-73135801 TTCTATGGGATTATACATATAGG + Intergenic
1055884031 9:81037940-81037962 GTCTGTGTGAATTACCATAATGG + Intergenic
1058840280 9:108900576-108900598 GTGTATGTGAATGTGCATGAGGG - Intronic
1059261888 9:112984982-112985004 GTCTTTGTAAATATAATTAAGGG + Intergenic
1059920517 9:119155337-119155359 GTACATATGAATATACAGAAAGG + Intronic
1060239663 9:121892129-121892151 GTATGTGTGTATATATATAAAGG - Intronic
1060566808 9:124599910-124599932 GTCTATTTGAATAAACATATGGG - Intronic
1188208524 X:27390235-27390257 GTTTATATTAATATACATATTGG - Intergenic
1188500728 X:30822926-30822948 ATGCATGTGAGTATACATAAAGG - Intergenic
1188661687 X:32768052-32768074 GTCAAAGTCAATTTACATAATGG + Intronic
1188824854 X:34819110-34819132 GACTATGTATATATACACAATGG - Intergenic
1188860462 X:35249889-35249911 GTCTATATGATTTTTCATAATGG + Intergenic
1188919227 X:35950932-35950954 GTATATCTGAATCTACAAAATGG - Intronic
1190659325 X:52640207-52640229 ATATATATAAATATACATAAAGG + Intergenic
1190996312 X:55613383-55613405 ATATATGTGGATATATATAAAGG + Intergenic
1191666903 X:63712880-63712902 GTCTATTGGAATATGCATATAGG - Intronic
1192826562 X:74703449-74703471 GGCTATTTGAAAATACATAGAGG - Intergenic
1193892251 X:87064191-87064213 ATCTATTTGAATATACACAATGG + Intergenic
1194289403 X:92050937-92050959 GTCAATGTGAGTAGACACAAAGG - Intronic
1195736838 X:108020219-108020241 GGCTATTTGAAAATACACAAAGG - Intergenic
1196120632 X:112046534-112046556 GTTTATGTGCCTATACAAAATGG + Intronic
1197862575 X:130986079-130986101 GTGTGTGTGTATATATATAATGG - Intergenic
1199341179 X:146679158-146679180 GTTTATATAAATATATATAAAGG - Intergenic
1200606917 Y:5275507-5275529 GTCAATGTGAGTAGACACAAAGG - Intronic
1200648623 Y:5814969-5814991 GTCTATTTGAAAGTACACAAAGG - Intergenic
1201295281 Y:12457027-12457049 GTATATGTGTATATACATTTAGG - Intergenic
1201669059 Y:16495407-16495429 GTGTATGTATATATATATAAAGG + Intergenic
1201983608 Y:19935906-19935928 GTACATGTGAATATAAAGAAAGG + Intergenic