ID: 1135856388

View in Genome Browser
Species Human (GRCh38)
Location 16:26014965-26014987
Sequence GAATACAGACCTTTTGCATA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 157
Summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 144}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1135856388 Original CRISPR GAATACAGACCTTTTGCATA AGG Intronic
903910969 1:26724781-26724803 GCAGACAGACCCCTTGCATAGGG - Intronic
904803177 1:33111315-33111337 GAAGACAGACCATTTCAATAAGG - Intronic
904891158 1:33780592-33780614 AAATACATAGCTTTTGCAAACGG - Intronic
908995480 1:70147590-70147612 GAATACTGACCTATTGCTTCTGG - Intronic
910726324 1:90343584-90343606 AAATTCATACCTTTTGCAAATGG - Intergenic
912596485 1:110882397-110882419 GAATAGAGTCCATATGCATATGG - Intronic
913117400 1:115710164-115710186 GATTATAGACTTTCTGCATATGG - Intronic
920587998 1:207187231-207187253 GAGTATAGACCTATAGCATATGG - Intergenic
921548898 1:216508851-216508873 CAATATGGACCTTGTGCATAAGG + Intronic
924323220 1:242870133-242870155 CAATACAGACCTTGTTCATCTGG - Intergenic
1068460227 10:57320771-57320793 GAATATAGATATTTTTCATAAGG + Intergenic
1068483138 10:57621364-57621386 ATATACTGACCTATTGCATATGG - Intergenic
1068780120 10:60910890-60910912 AAAGACAGACGCTTTGCATATGG - Exonic
1073481400 10:103788241-103788263 GAGTACAGCCATTTTGCAGATGG + Intronic
1074988987 10:118685377-118685399 AAATAGAAACCTTTTGCACATGG - Exonic
1077832891 11:5894694-5894716 GAATAAAGACTTTTTTCATAAGG + Intronic
1085913874 11:80861681-80861703 CAATAAATACCTGTTGCATATGG - Intergenic
1087026376 11:93653793-93653815 GAAGTCAGATCTGTTGCATATGG - Intergenic
1087311993 11:96555877-96555899 GAATACTGCCCTTTTCCAAAGGG + Intergenic
1087492766 11:98849016-98849038 GAATTCACACCTTATGCAGAGGG + Intergenic
1090540937 11:127703596-127703618 GAATACAGTGCTTTTGGATTGGG - Intergenic
1095127269 12:38494966-38494988 GATCACAGACCTTTGGAATATGG - Intergenic
1095195264 12:39307528-39307550 GAAAACATACCTCTTGCCTATGG - Intronic
1097673521 12:62570640-62570662 CAATATTGACCCTTTGCATATGG + Intronic
1100739064 12:97571151-97571173 AAATACATACCTTTTGGTTATGG + Intergenic
1103028152 12:117590955-117590977 GACTACAGACCATTTGTGTAAGG - Intronic
1106203867 13:27570276-27570298 GATCACAGACCTTATGCCTAGGG + Intronic
1109262636 13:60162503-60162525 GAATAGTGACATTTTGCAGAAGG - Intronic
1109272947 13:60274332-60274354 GAATACAAACCTTCTCCATGAGG - Intergenic
1109348236 13:61143645-61143667 GAAGACAGAGATTTTGCATGAGG + Intergenic
1112867502 13:103923879-103923901 GAATAGAAAGGTTTTGCATATGG - Intergenic
1113174024 13:107540530-107540552 AAATACAGACCTTTTAGAAAAGG + Intronic
1113454008 13:110434555-110434577 GCAGACAGACCATTTGCATAGGG + Intronic
1114652549 14:24295351-24295373 GAATAAATTTCTTTTGCATAGGG + Intronic
1115646010 14:35368934-35368956 GAATACAGCTATTTTTCATACGG + Intergenic
1117496158 14:56307338-56307360 GAATACTTACCCTTTGCAAATGG + Intergenic
1118047585 14:61988152-61988174 CACTACAGACCTTTTCCAAAAGG - Intergenic
1119202803 14:72770806-72770828 GAATAAAGACCTTTTTATTAGGG - Intronic
1119646416 14:76351701-76351723 GAAAACAAGCTTTTTGCATATGG - Intronic
1120265378 14:82242287-82242309 GAATACATATCTTTTGCATATGG + Intergenic
1121889492 14:97575463-97575485 GACCAAAGACCTTGTGCATAAGG + Intergenic
1121965645 14:98301916-98301938 GAAGGCATAGCTTTTGCATATGG - Intergenic
1122100162 14:99402137-99402159 GACTGAAGACCTTTAGCATAGGG - Intronic
1123830250 15:24128491-24128513 GAATTCAGTTCTTTTGAATAAGG + Intergenic
1123845158 15:24292427-24292449 GAATTCAGTTCTTTTGAATAAGG + Intergenic
1123860311 15:24459105-24459127 GAATTCAGTTCTTTTGAATAAGG + Intergenic
1123863942 15:24497732-24497754 GAATTCAGTTCTTTTGAATAAGG + Intergenic
1127936774 15:63648148-63648170 GAAGACAGACCATTTGCAGTGGG - Exonic
1131547104 15:93324808-93324830 GAATAGAGACTTTTTAGATAAGG - Intergenic
1133878099 16:9753879-9753901 GAATAGAAACCCTCTGCATATGG + Intronic
1135856388 16:26014965-26014987 GAATACAGACCTTTTGCATAAGG + Intronic
1138722086 16:59094038-59094060 GAGTACAGAACTTTTGTTTAAGG - Intergenic
1138964808 16:62071369-62071391 TAAAACACACCTTTTGCTTAAGG + Intergenic
1139926273 16:70488999-70489021 GGTTACAGAACTTTTGCCTAAGG + Intronic
1140296086 16:73711094-73711116 GAACACAGACCTTGTCCATTTGG + Intergenic
1140963409 16:79940239-79940261 GAACACAGACATTTTGTTTATGG + Intergenic
1140973628 16:80038061-80038083 AAATACAGTCCTTTTGCATGAGG - Intergenic
1146154869 17:30514438-30514460 GAATAAAGACTTTTTGGATGTGG - Intronic
1146888015 17:36485397-36485419 GATTACAAAACTTTTGCACATGG + Intergenic
1153073070 18:1128876-1128898 GAAAACTTACCATTTGCATAAGG - Intergenic
1153728474 18:7981648-7981670 GAATACAGCCCCATTGCTTAAGG - Intronic
1154396459 18:13994859-13994881 GATTTCTGACCTTGTGCATAAGG - Intergenic
1156617154 18:38800449-38800471 GAATAAATACCATTTGTATAAGG - Intergenic
1157981455 18:52386281-52386303 TAATACAGGTCTTTTGAATATGG - Intronic
1164953251 19:32357083-32357105 GAGAACAGAGCTTTTGCAGATGG + Intronic
927410436 2:22819041-22819063 GAGTACAGACCATGTGCTTAAGG + Intergenic
928145854 2:28775012-28775034 GAATATATAGCTTTTGCATGTGG + Intronic
928528421 2:32165546-32165568 GAATACTGTCCATTTTCATAAGG + Intergenic
929200445 2:39229665-39229687 GAATATAAACCTTTGGCATGTGG - Intergenic
935041667 2:99435824-99435846 GAATACAGACCTTTGAGATCTGG + Exonic
938966801 2:136395846-136395868 GAATACAGTCATTATTCATATGG - Intergenic
942019533 2:171852719-171852741 GACTACAGAATTTATGCATAAGG - Intronic
942696654 2:178654198-178654220 GAATAAATACCTTTTGCACGTGG + Exonic
942697093 2:178658458-178658480 GAATAAATACCTTTTGCACGTGG + Exonic
942697533 2:178662719-178662741 GAATAAATACCTTTTGCACGTGG + Exonic
943390982 2:187267546-187267568 GAATACAGAGCTTTGTCATCAGG + Intergenic
1180521117 22:16205846-16205868 GAAACCAGACATATTGCATAGGG + Intergenic
1182061329 22:27400247-27400269 GATAACAGACCTTTTGCTCAGGG - Intergenic
949169181 3:978184-978206 GAAGACAAACCTTTTGACTAAGG + Intergenic
950110947 3:10418389-10418411 GAATGCAGACATTTAACATATGG + Intronic
950660259 3:14462800-14462822 GAACACACACATTTTCCATAGGG + Intronic
950893445 3:16426044-16426066 GAATTCAGAGCTCTTGCTTAAGG - Intronic
959175659 3:102906261-102906283 AAATACAAGCATTTTGCATATGG + Intergenic
959200942 3:103246162-103246184 GAAAATAGAACTTTTACATAAGG - Intergenic
959773783 3:110132444-110132466 GAATACATACCTTCTGGATGAGG - Intergenic
960131650 3:114062401-114062423 GAATACAGGCCTTTTGCAGGAGG + Intronic
960925359 3:122790618-122790640 GTAAACAGACCTTTTTCATGTGG - Intronic
961495172 3:127286209-127286231 GAATCCTGACCCTTTCCATATGG - Intergenic
963210323 3:142682307-142682329 AAAATCAGACCTTTTGCCTAGGG + Intronic
964510770 3:157448641-157448663 CATTACAGACCATTTTCATATGG + Intronic
965093045 3:164185659-164185681 GTATATAGATCTTCTGCATACGG - Intergenic
965926102 3:173982490-173982512 AAATACAGACCTTATAGATAAGG + Intronic
969884877 4:10206495-10206517 GAATCCAGACGTTTTTCTTACGG + Intergenic
970694271 4:18658115-18658137 CATTACAAACCTTTTGGATAAGG + Intergenic
971612989 4:28749846-28749868 GAATATAGACATTTTGCCTGGGG - Intergenic
972115277 4:35624458-35624480 GAAAAAAGACCTTTGGCATCAGG + Intergenic
972318809 4:37953090-37953112 GCATGCAGACATTTTGCATTCGG + Intronic
974712698 4:65621365-65621387 GACTACAATCCTTTTGAATATGG + Intronic
978295327 4:107198330-107198352 GAATACAGACCATATGTATATGG - Intronic
981843747 4:149142784-149142806 AAATTCTTACCTTTTGCATATGG - Intergenic
982841908 4:160199060-160199082 GCATAAAGACCATTTGCTTATGG - Intergenic
983614863 4:169691827-169691849 GAATACAGACCTTAATTATAAGG - Intronic
986522581 5:8636842-8636864 GAATAAAGAACTTGTGCTTAGGG - Intergenic
988198042 5:28032091-28032113 GAATACAGAAGTGTTGCATTAGG - Intergenic
995116071 5:108481209-108481231 GAAGATAGACCATTTGCAGAGGG + Intergenic
995188236 5:109293299-109293321 GATTTCAGTCCTTTTGCATTTGG - Intergenic
996897250 5:128499896-128499918 GCATGCAAACTTTTTGCATATGG - Intronic
997057151 5:130458520-130458542 GAAAACAGAGCTTATTCATAGGG + Intergenic
997866804 5:137470974-137470996 GAAAACAGTTCTTTTTCATAGGG + Intronic
1000584544 5:163080631-163080653 GAATACAGAAGGTTTGTATATGG - Intergenic
1001185094 5:169563226-169563248 GAATACACACCTGGTGGATAGGG + Intergenic
1004621919 6:17338126-17338148 GAATACAGACTATTGGGATAAGG - Intergenic
1011698171 6:89931912-89931934 GCATGCAGGACTTTTGCATATGG + Exonic
1014574645 6:123055403-123055425 GAAAACAGACCCTTCTCATAAGG - Intronic
1015311214 6:131769065-131769087 GAATACAGTTATTTTGCATGAGG + Intergenic
1015567578 6:134589748-134589770 GAATTCAGAGCTTTTGCAACAGG + Intergenic
1016876228 6:148868112-148868134 GAAGACAGAGCTTTTGTCTAAGG - Intronic
1017244133 6:152203710-152203732 GAATAAAGACATTTTGAGTAAGG - Intronic
1024202418 7:47120620-47120642 GCATTCAAACCTTTTGCTTAGGG - Intergenic
1028244178 7:88456102-88456124 TCATACAGGCCATTTGCATAAGG + Intergenic
1030750847 7:113230319-113230341 GAAAACAGAACTCTTGCACACGG + Intergenic
1031687919 7:124755006-124755028 AAATTAAGACCTTTTGCAAAAGG - Intronic
1032175723 7:129624078-129624100 GAATACAGAACCTGTGGATATGG + Intronic
1033049028 7:137987553-137987575 TATTACAGACTTTTGGCATATGG - Intronic
1035756749 8:2039441-2039463 GAATACACACCATTGGCAAATGG + Intergenic
1035927049 8:3739823-3739845 GAATGCAGACATTTTACATTTGG + Intronic
1036017553 8:4802016-4802038 GTAGACAGACCATTTGCAAAGGG + Intronic
1038423216 8:27447196-27447218 GAAAAAAGACCTTTTGTATCAGG + Intronic
1044644806 8:94428432-94428454 GAATACAAACATTTTATATAAGG - Intronic
1046255768 8:111694520-111694542 GAAAACAAAGCTTTTCCATAGGG + Intergenic
1046422836 8:114007379-114007401 GAATCAAGACCATTTGCACAAGG + Intergenic
1046539898 8:115566351-115566373 GAATACACACCTGTTGCTCAAGG + Intronic
1051858428 9:21596729-21596751 GAATAAAGTCCTTTTTAATAAGG - Intergenic
1054706689 9:68469979-68470001 AAATACAGACCATTTGGAAAGGG + Intronic
1055144282 9:72913950-72913972 AAATACAGACCTTCTTCAGAAGG + Intronic
1055184275 9:73431854-73431876 GAATATACCCCTTTTGGATAAGG - Intergenic
1059132072 9:111763590-111763612 GAATTAAGACTTTTTGGATATGG + Intronic
1062617362 9:137403850-137403872 GAAGACAGACCTGTGGGATAGGG + Intronic
1185496910 X:561489-561511 GCATAGAGACCTTCTGCAGAAGG - Intergenic
1186606579 X:11099019-11099041 GAATCCAGAGCTTTTTCATTAGG + Intergenic
1188436788 X:30169529-30169551 GAATAAAGTCATTTTGTATAGGG + Intergenic
1190629501 X:52371085-52371107 GAATAAAGCCCATTTGCATAGGG + Intronic
1190630739 X:52383130-52383152 GAATAAAGCCCATTTGCATAGGG + Intergenic
1190637447 X:52450139-52450161 GAATAAAGCCCATTTGCAAAGGG - Intergenic
1190648583 X:52546129-52546151 GAATAAAGCCCATTTGCAAAGGG + Intergenic
1190653019 X:52585053-52585075 GAATAAAGACCATTTGCAAAGGG + Intergenic
1190680678 X:52825501-52825523 GAATAAAGCCCATTTGCGTAAGG - Intergenic
1190685066 X:52866007-52866029 GAATAAAGCCCATTTGCATAAGG - Intronic
1190998302 X:55634251-55634273 GAATAAAGCCCATTTGCATAGGG - Intergenic
1191000511 X:55655910-55655932 GAATAAAGCCCATTTGCATAGGG - Intergenic
1193944669 X:87720669-87720691 CAATAAAGACATTTTCCATATGG + Intergenic
1194819048 X:98483391-98483413 GAATACATAATGTTTGCATATGG + Intergenic
1198390781 X:136171658-136171680 GAACACAGCCCTTTTACACATGG - Intronic
1199760524 X:150900698-150900720 GAAGACAGTCTTATTGCATATGG - Intergenic
1200450155 Y:3316875-3316897 GATTACTGTCCTTTTTCATATGG + Intergenic
1201646170 Y:16234927-16234949 AAATGCAGAGCTTTTTCATATGG - Intergenic
1201656643 Y:16350390-16350412 AAATGCAGAGCTTTTTCATATGG + Intergenic