ID: 1135856425

View in Genome Browser
Species Human (GRCh38)
Location 16:26015333-26015355
Sequence ATGCAGAAGCAGAATCTGGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 274
Summary {0: 1, 1: 0, 2: 1, 3: 18, 4: 254}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1135856421_1135856425 -8 Left 1135856421 16:26015318-26015340 CCAACCAAGGAAGAAATGCAGAA 0: 1
1: 0
2: 3
3: 38
4: 422
Right 1135856425 16:26015333-26015355 ATGCAGAAGCAGAATCTGGTGGG 0: 1
1: 0
2: 1
3: 18
4: 254

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1135856425 Original CRISPR ATGCAGAAGCAGAATCTGGT GGG Intronic
901182729 1:7352661-7352683 ATGCAGGAGCAGAGCCTGCTGGG - Intronic
901197914 1:7450518-7450540 ATGCAGAAGTAGAGACAGGTGGG + Intronic
903437245 1:23359841-23359863 AAGCAGCAGCAGGAACTGGTTGG + Exonic
906174038 1:43753899-43753921 AGGCAGGAGCAGGATCTGGGCGG - Intronic
906705166 1:47889281-47889303 ATGCAGAAGCCGAATGTCCTTGG + Intronic
908392521 1:63696565-63696587 AGGCAGATTCAGTATCTGGTAGG - Intergenic
909525886 1:76622241-76622263 ATGCAGAAAAAGTATCAGGTGGG - Intronic
912937420 1:114015735-114015757 ATGAGGAAGCAGATTCTGGGAGG + Intergenic
913237033 1:116794247-116794269 ATGCAAAAGGAGTATATGGTGGG - Intergenic
913457246 1:119045901-119045923 ATGTTGAAGCAGAATCTGGTGGG - Intronic
914492840 1:148162833-148162855 CTCCAGAAGCAGAATCAAGTGGG + Intergenic
916883607 1:169046152-169046174 ATGCAGAAGGACCATGTGGTGGG - Intergenic
919259061 1:195166167-195166189 ATGCATAAGCAGAATTAGGCAGG - Intergenic
920636020 1:207704440-207704462 AAGCAGCAGCAGTATCTGGGAGG + Intronic
921418584 1:214919808-214919830 ATGGAGAAGGAGAATCAGGAAGG - Intergenic
921945796 1:220885134-220885156 ATGCAGCAGCTGAAGGTGGTGGG + Intergenic
922819454 1:228474041-228474063 ATGCAGAAACATGAACTGGTTGG - Intergenic
922970440 1:229731900-229731922 ATGGAGAAGCAGAATTTGGGAGG - Intergenic
924597624 1:245461246-245461268 AAGCAGAAGCAGAATCAGTCTGG - Intronic
1063002941 10:1941643-1941665 ATGGAGAATCAGCATCTGATAGG + Intergenic
1063791999 10:9461074-9461096 ATGCAGAAAAATAATCTCGTAGG - Intergenic
1065261589 10:23929082-23929104 ATGCAGAGGCCAAATCAGGTAGG + Intronic
1065408727 10:25397740-25397762 ATGTGGAAGCAGAACCTGGGAGG - Intronic
1067225760 10:44374745-44374767 ATGCAGAAAGAGAAAGTGGTTGG - Intronic
1068604283 10:58988587-58988609 AGCCAGAATCAGAATCTGTTTGG - Intergenic
1070990581 10:80728696-80728718 ATGCACAAGCAGGATCTGCATGG - Intergenic
1071757538 10:88560603-88560625 ATTCAGAAGCAAACTCTGGGAGG + Intronic
1073645129 10:105293838-105293860 ATGAAGAAGCTGGATATGGTAGG - Intergenic
1073736993 10:106359999-106360021 ATGCAAAAGCAGACTGTGGGGGG - Intergenic
1075976249 10:126698109-126698131 ATGCAGAGGAAGAGTCTGGATGG - Intergenic
1078281109 11:9901973-9901995 ATGCTGTATCAGAATCAGGTTGG - Intronic
1080092083 11:28360362-28360384 ATTCGGAAGAAGAATCTGCTTGG - Intergenic
1080372261 11:31665024-31665046 ATACAGAGGCAAAATTTGGTTGG - Intronic
1080379778 11:31756324-31756346 AGGCAGAGGCAGAATCTGTAGGG - Intronic
1081054827 11:38396666-38396688 TTGTAGATTCAGAATCTGGTTGG + Intergenic
1081123405 11:39293112-39293134 ATTCAGAAGAAGAATCAGATAGG - Intergenic
1081225450 11:40516708-40516730 ATGCAGAAGAAAAATTGGGTTGG - Intronic
1082104889 11:48211081-48211103 ATGCAGATGCAGAAGCTGAGTGG + Intergenic
1084473117 11:69374699-69374721 ATGCAGAGGAAGTGTCTGGTGGG - Intergenic
1087331098 11:96781719-96781741 ATGCAGAAGAGGAATCTTATTGG + Intergenic
1087756586 11:102060659-102060681 ATTTAGAAGGAGAATCTGATTGG + Intronic
1087906666 11:103705297-103705319 ATGCAGAAGTGGAATCCAGTGGG - Intergenic
1088408691 11:109509456-109509478 ATGCAGAAGCAGTTTCTGTAAGG - Intergenic
1088584416 11:111348720-111348742 ATGTAGAAGCAGAATTTTTTAGG + Intergenic
1091394314 12:144191-144213 ATGGAGAAGCAGAAAGTGGCAGG + Intronic
1091560600 12:1609935-1609957 ATGCAAGAGTAGAATCTAGTTGG - Intronic
1092696296 12:11175446-11175468 ATGCAGAAGCATAAAGGGGTAGG + Intergenic
1093117753 12:15232993-15233015 AAGTAGAAGCAAAAACTGGTAGG + Intronic
1093210145 12:16298184-16298206 AGGCAGAGGCAGATTATGGTGGG - Intergenic
1093945991 12:25110180-25110202 ATGCAAAAGCAGAACTTAGTAGG + Exonic
1096474663 12:51900974-51900996 ATGCGGAAGCAGAGGCTGCTGGG + Intergenic
1097338875 12:58415193-58415215 GTGCAGTTTCAGAATCTGGTAGG + Intergenic
1098849240 12:75575377-75575399 ATGCAGCAGGAGGATCTGGCAGG - Intergenic
1100779049 12:98004378-98004400 ATGCAAAGGCAAATTCTGGTGGG + Intergenic
1102417544 12:112777354-112777376 ATGCAGAAGCAGAAGCTACTAGG - Intronic
1105041125 12:132962270-132962292 AGGCTGAGGCAGAATCTGGGAGG - Intergenic
1105256483 13:18746741-18746763 CTGCAGAAGCAGAACCTCTTAGG + Intergenic
1105574629 13:21638737-21638759 ATGCAGAAGCATATTTTGGAGGG - Intergenic
1108606491 13:52044786-52044808 ATACAGAAGCATAACCAGGTTGG + Intronic
1110184507 13:72657162-72657184 ATGCAGAAGGGGAACCTGGGGGG + Intergenic
1110495642 13:76164392-76164414 ATGCAGTAGCAGAGTTTGGCTGG + Intergenic
1113545567 13:111146516-111146538 ATGCAGAATCAGAATCTCCCTGG + Intronic
1113757977 13:112827308-112827330 ATGCAGCAGCAGGATCTGAATGG - Intronic
1114341634 14:21751433-21751455 AAGCAGAAGAAGCCTCTGGTGGG + Intergenic
1118037152 14:61880093-61880115 AAGCAGAAGCAGCTTTTGGTGGG - Intergenic
1118752594 14:68817609-68817631 CTGTAGAAGCAGAGACTGGTAGG + Intergenic
1119583319 14:75807602-75807624 ATGAAGAAATAGAAGCTGGTAGG + Intronic
1120655856 14:87189132-87189154 AAGCAGAAGGAGAATTTGGATGG - Intergenic
1121939263 14:98054129-98054151 ATGTAGAAGAATCATCTGGTTGG - Intergenic
1202931539 14_KI270725v1_random:40384-40406 ATTCAGAAGCAGTTTTTGGTGGG - Intergenic
1124190177 15:27567845-27567867 ATGAAGAAGAAGAATCTTGGAGG + Intergenic
1124472205 15:29997910-29997932 AGGCAGAAACAGAAACTGCTAGG + Intergenic
1125450096 15:39799132-39799154 TTGATGAGGCAGAATCTGGTTGG - Intronic
1128293771 15:66499498-66499520 AAGCAGAAGAAGCCTCTGGTGGG - Exonic
1128805245 15:70526137-70526159 AGGCAGAAGCAGAATGAGTTGGG - Intergenic
1130108191 15:80944661-80944683 ATGCCGAAGAAGCATCTGATGGG - Intronic
1131074003 15:89483624-89483646 AGGCAGAAACTGCATCTGGTTGG - Intronic
1132150080 15:99452929-99452951 ATGCAGAAGCGGAGTCCGGCTGG + Intergenic
1133463005 16:6003417-6003439 ATGCAGGAGGAGAAACTGTTTGG - Intergenic
1135856425 16:26015333-26015355 ATGCAGAAGCAGAATCTGGTGGG + Intronic
1136096467 16:27960621-27960643 ATGGAGAAGCTGAGTGTGGTGGG + Intronic
1137002070 16:35237837-35237859 ATGCAGAATCAGAATGAAGTAGG - Intergenic
1137004374 16:35259281-35259303 ATGCAGAAGCATCATCTTTTTGG - Intergenic
1137480909 16:48851266-48851288 AGGCAGAAGAAGAAATTGGTGGG + Intergenic
1139334099 16:66218856-66218878 AAGAAAAACCAGAATCTGGTGGG + Intergenic
1139937239 16:70580115-70580137 AAGCAGCAGCAGAATCGGGGTGG - Intronic
1143150157 17:4802555-4802577 ATGGAGAAGCAGGAGGTGGTTGG + Intergenic
1143764050 17:9126046-9126068 TTGCAGAAGCAGAGTCAGGATGG + Intronic
1144402819 17:14922794-14922816 AGGCAGATGCAGAATTTGATGGG + Intergenic
1144498052 17:15762647-15762669 ATGCAAGTCCAGAATCTGGTAGG - Intergenic
1145161424 17:20577682-20577704 ATGCAAGTCCAGAATCTGGTAGG - Intergenic
1146581414 17:34041277-34041299 AGGCAGAAGAAGAGACTGGTTGG + Intronic
1146933602 17:36795649-36795671 ATGGATAAGCAAAATGTGGTAGG - Intergenic
1149426255 17:56557609-56557631 AGGCAGAAGGAGAAACTGATCGG - Intergenic
1150430879 17:65116081-65116103 ATGCAGAAAGAGAAGCTGATGGG - Intergenic
1150587072 17:66528507-66528529 ATGCAGAAGCAGAGTTGGGAGGG + Intronic
1152664790 17:81561287-81561309 AAGCAGAAGAAGAAGCTGGGCGG - Intronic
1153187493 18:2501419-2501441 ATGAAGAAACAGATTCAGGTAGG - Intergenic
1154434560 18:14333937-14333959 CTGCAGAAGCAGAACCTCTTAGG - Intergenic
1157295029 18:46436075-46436097 AGCTAGAACCAGAATCTGGTGGG - Intronic
1157908094 18:51587466-51587488 ATGCAAAAGCAGGATCTATTTGG - Intergenic
1158578585 18:58661523-58661545 AAGCAGCAGCAGCAGCTGGTAGG + Intergenic
1158813740 18:61069315-61069337 ATGCAGAAGCAGAGTATGGAAGG - Intergenic
1158926576 18:62270200-62270222 ATGAAAAGGCAGAATCTGCTAGG + Intronic
1159375921 18:67592856-67592878 ATGCAGAAGAAGAATATAGAAGG - Intergenic
1164930434 19:32171154-32171176 ATGCAGAGGTAAAATCTGGTTGG + Intergenic
1165393309 19:35550483-35550505 CTACAGAAGCAGATACTGGTGGG + Exonic
1165724107 19:38100692-38100714 CTGCAAAAGCAAAATCTGGAGGG - Intronic
1165878405 19:39025714-39025736 ATTAAAAAGTAGAATCTGGTCGG + Intronic
1166108860 19:40610869-40610891 ATGGAGAAGCAGAATGAGGAGGG + Intronic
1167308685 19:48723608-48723630 ATGAGGAAACAGAATCAGGTAGG - Intronic
1168092375 19:54094718-54094740 ACGTGGAAGCAGACTCTGGTGGG + Exonic
925595312 2:5550025-5550047 CTGCAGAAGCAGAATCTCCGTGG - Intergenic
926305555 2:11635352-11635374 ATGAAGAAGCAGATCGTGGTGGG + Exonic
926877471 2:17497814-17497836 AAGCAGAAGCAGAGTGTTGTAGG - Intergenic
927919912 2:26964264-26964286 ATGGAGATGCAGAAGCTGGGAGG + Intergenic
928186148 2:29113135-29113157 ATGAAGAAGCAGACTCTGGGAGG - Intronic
929123097 2:38499517-38499539 CTACAGAAGCAGAATCTGTAGGG + Intergenic
929251548 2:39762111-39762133 ATGAACAAGCAGAATCTCCTTGG + Intronic
929697430 2:44131056-44131078 ACACAGCAGCAGAATCAGGTAGG - Intergenic
931328148 2:61249712-61249734 ATGCAGAAGAAGAGTCTGCAGGG + Intronic
934103728 2:88677502-88677524 ATGCAGAAGGAGAAGCATGTTGG + Intergenic
935581681 2:104761206-104761228 GTGCAAAAGCAGCATCTGGCTGG + Intergenic
936681019 2:114771407-114771429 AAGCAGATGATGAATCTGGTTGG - Intronic
937114319 2:119393648-119393670 AGGCAGAGGCAGAACCTGGAAGG - Intergenic
937396962 2:121545657-121545679 ATGCTGAATCTGAATCTAGTTGG - Intronic
937431315 2:121841012-121841034 ATGAAAAAGCAAAATTTGGTTGG - Intergenic
938715844 2:134021102-134021124 GTGCAGAAGCATACTCCGGTGGG + Intergenic
939218152 2:139266868-139266890 ATGCAGAAGCCAAATCTCATTGG - Intergenic
939495653 2:142924941-142924963 ATGAAGAAGCAGACTCTGTGTGG + Intronic
940311636 2:152285276-152285298 TTCCACAAGCAGAATCTTGTGGG - Intergenic
941582136 2:167311903-167311925 AGGCAGAAGCAGTATCTGATGGG + Intergenic
943667554 2:190626034-190626056 ATGCAGATTCAGTGTCTGGTAGG + Intergenic
947231194 2:227888389-227888411 AAGCAGAAGCAGGATCAGGCGGG + Intronic
947379476 2:229531313-229531335 ATGCACAAACAGCATATGGTTGG + Intronic
948198826 2:236114873-236114895 TTGCAGGAGCAACATCTGGTTGG - Intronic
948664135 2:239523954-239523976 TTCCAGAAGCAGAATGAGGTTGG + Intergenic
1169543884 20:6630922-6630944 ATGCAGATGCAGAATGTCATGGG + Intergenic
1169551459 20:6705691-6705713 ATGAGGAAGCAGATACTGGTTGG - Intergenic
1170622536 20:18007829-18007851 ATTCAGAAGCAGAAGCTGCCAGG + Intronic
1172214347 20:33224470-33224492 ATACAGAAGCAGAATCTGAGAGG + Intronic
1172578726 20:36030222-36030244 GTGCAGAAGGAGAGTCTGGGAGG + Intronic
1173026176 20:39309588-39309610 GTGCAGAAGCAGAAGCTGTTTGG + Intergenic
1175637488 20:60598069-60598091 AAGCAGAAGCAGAATCTTACAGG + Intergenic
1176593568 21:8668535-8668557 ATTCAGAAGCAGTTTTTGGTGGG - Intergenic
1176842478 21:13851769-13851791 CTGCAGAAGCAGAACCTCTTAGG + Intergenic
1180276412 22:10645663-10645685 ATTCAGAAGCAGTTTTTGGTGGG - Intergenic
1181341176 22:22181454-22181476 AGGCTGAAGGAGAAGCTGGTGGG - Intergenic
1182609749 22:31537294-31537316 AGGCAGAAGCAGAATGCAGTGGG - Intronic
1183197740 22:36364998-36365020 ATGCAGAAGTAGGGGCTGGTGGG - Intronic
1184484185 22:44766085-44766107 ATGCAGACCCAGGATCAGGTTGG - Intronic
950848084 3:16034530-16034552 CTGCTGAAGGAGAATCTGGGTGG - Intergenic
952740237 3:36727640-36727662 TTGCATAAGCAGAACTTGGTGGG + Intronic
953321511 3:41976579-41976601 ATTTAAAAGCAGAATCTGGCCGG + Intergenic
953598598 3:44340747-44340769 CTGCAGAATCAGAATCTGGGTGG - Intronic
953926757 3:46986458-46986480 CTGGAGAAGCAGGTTCTGGTTGG + Intronic
954064047 3:48091587-48091609 AGGCAGGAGGAAAATCTGGTAGG - Intergenic
954849428 3:53587809-53587831 ATGTAAAAGGAGAATCTGGTAGG + Intronic
957778133 3:84782406-84782428 ATGCAGTGGCACAATCTTGTTGG - Intergenic
957867017 3:86038952-86038974 ATTTAGAAGGAGAATCTGGAAGG + Intronic
959639577 3:108617698-108617720 ATTCAGAAGGAGATTCTAGTTGG + Intronic
962326005 3:134432905-134432927 ATGCAGGAGCAGAACATGCTAGG + Intergenic
963834736 3:150046718-150046740 AGGCAGAGGCAGAATCTTGGGGG - Intronic
964084557 3:152800218-152800240 ATCCAAAAGAACAATCTGGTAGG + Intergenic
964685173 3:159387244-159387266 ATGCAAAAGCAGACTCTTGCTGG - Intronic
965055742 3:163712647-163712669 AAGCTGAAGCGGTATCTGGTTGG + Intergenic
967009351 3:185417586-185417608 AAGCAGAAGAAGCCTCTGGTGGG - Intronic
967968078 3:194978020-194978042 ATGCAAAAACAGAATATTGTAGG + Intergenic
969892671 4:10274276-10274298 ATGCAAAAGAAGAATATGGTGGG + Intergenic
970630376 4:17936599-17936621 TTGCAGAATCTGAATCTGTTTGG + Intronic
971478664 4:27095264-27095286 ATGGAGAAGGAGAGGCTGGTGGG - Intergenic
971618401 4:28823716-28823738 AGGCACAAGCAGAATCTGTCTGG - Intergenic
974385644 4:61200473-61200495 ATGCAGATGCTGCAGCTGGTCGG + Intergenic
974467277 4:62273405-62273427 ATGGAGAACCTGAATCTGGAAGG - Intergenic
975967171 4:79987155-79987177 ACACAGAATCAGAATCTGGATGG + Intronic
978529474 4:109699606-109699628 AGGCAGAATCAGAATCTTGGAGG + Intronic
978723615 4:111944534-111944556 ATGCAGATGCTGATTGTGGTTGG - Intergenic
978833771 4:113121867-113121889 ATGAACAAGAAGAATGTGGTGGG - Intronic
978968080 4:114767655-114767677 ACCCAGTAGCAGAATCTAGTAGG - Intergenic
980066247 4:128191876-128191898 ATGAAGAAGCTGAGTCTGGGAGG + Intronic
981002527 4:139841503-139841525 ATAGTGAAGCAGCATCTGGTGGG - Intronic
983951104 4:173642593-173642615 CTGCAAAAGCAGCATGTGGTAGG - Intergenic
983999748 4:174225605-174225627 AGGCAGAAGCCGTATCTGGCAGG - Intergenic
984396948 4:179213998-179214020 CTTCAGAAGCAAAATCTTGTTGG + Intergenic
986229696 5:5852077-5852099 ATGCAGCAGGAGAATAAGGTAGG - Intergenic
987397188 5:17435781-17435803 ATGCAAAAGCAGAGCCAGGTGGG + Intergenic
988825148 5:34929056-34929078 ATACAGTAGCAGAATTCGGTTGG - Intergenic
990462277 5:56040384-56040406 AAGCTGAAACAGAATCTGGTGGG - Intergenic
991077653 5:62559455-62559477 AAGCAGCAGCAGAATCTGAGAGG - Intronic
991985264 5:72278559-72278581 ATGAAGAAGCAGGATGGGGTTGG - Intronic
992815951 5:80438424-80438446 ATGCAGAAGCAGGAGCTATTGGG + Exonic
992896897 5:81253438-81253460 ATGCAGAAGCACAGGGTGGTCGG + Intronic
994145624 5:96391877-96391899 AATCAGAAGCAGAAACTGGCAGG - Exonic
996367686 5:122720418-122720440 ATATAGAAGCAGTATCTGGAAGG + Intergenic
997163100 5:131629993-131630015 AAGCAGCAGCAGAATTTGGGAGG + Intronic
997281209 5:132647277-132647299 ATGAAGAAGCAGATTTTGGATGG - Intergenic
998335753 5:141370935-141370957 ATTCAGAAGGAGAACCTGGATGG + Exonic
999592959 5:153169085-153169107 TTGCAGAATTAGAAACTGGTAGG + Intergenic
1001249111 5:170132518-170132540 ATGAAGGAGAAGAAGCTGGTAGG + Intergenic
1002644636 5:180647136-180647158 ATGCAGGAGCAGGGTCTGCTGGG - Intronic
1003822762 6:9918284-9918306 ATGGAGGAGCAGCATGTGGTGGG - Intronic
1005148980 6:22725918-22725940 ATGCAAAAGCAGAAGCTGCCAGG + Intergenic
1006958455 6:37900747-37900769 ATGGAGTTGCAGAATCGGGTGGG + Intronic
1007367714 6:41406635-41406657 AAGCAGAAGCAGAAGGAGGTTGG + Intergenic
1007611309 6:43151115-43151137 ATGAAAAAGCAGAGTCTGGCTGG - Intronic
1007615185 6:43175651-43175673 CTGCAAAGGCAGGATCTGGTAGG + Intronic
1008073771 6:47124655-47124677 TTGAAGAAGCAGAACCAGGTTGG - Intergenic
1008404224 6:51100770-51100792 ATGCAGTATCAGGATCTGGGAGG + Intergenic
1009706406 6:67257891-67257913 ATGCAAAAGCAGAAGCTGCCAGG - Intergenic
1011217692 6:85022421-85022443 TGGGAGAAGCTGAATCTGGTGGG + Intergenic
1013152351 6:107459020-107459042 ATGCAGGTGCGGAAGCTGGTGGG - Exonic
1017380073 6:153817924-153817946 ATGAAGAAGCAGAATCTTCAGGG + Intergenic
1018096966 6:160396697-160396719 ATGCAGAAGTAAAATTTTGTTGG - Intronic
1018553411 6:165024868-165024890 AAGCAGCTGCAGATTCTGGTTGG + Intergenic
1019750968 7:2729565-2729587 ATGCAGAAGCAGAAGAGGGAGGG - Exonic
1021358139 7:19679450-19679472 TTGCACCAGAAGAATCTGGTTGG + Intergenic
1025825836 7:65009720-65009742 ACACAGAAGCAGACTCAGGTGGG + Intergenic
1026195164 7:68166730-68166752 ATGCATAAGCAGAGTCTGGGAGG - Intergenic
1028090887 7:86699334-86699356 ATCCAGATGCAGAATCTGGATGG + Intronic
1028270657 7:88784687-88784709 AGGCAGAAGCAGGATTTGGTGGG - Intronic
1030160360 7:106502159-106502181 CTGCAGAAGCAGAGTCAGGAGGG - Intergenic
1031101737 7:117489309-117489331 ATGCTGAAGAAGAAAGTGGTAGG + Intronic
1031699370 7:124904287-124904309 ATCCAGCAGCAGAATCAAGTTGG + Intronic
1032458988 7:132095401-132095423 ATTCAGAAGCAGAGGCTGGAAGG - Intergenic
1032832305 7:135640569-135640591 AAACAGAAGCAGACACTGGTAGG - Intronic
1032878455 7:136063321-136063343 ACGCAGAAGCAGAGGCTTGTAGG + Intergenic
1033216248 7:139495687-139495709 AGGTGGAACCAGAATCTGGTGGG - Intergenic
1033250686 7:139755881-139755903 ATACAGAAGCAGTATCTGAAGGG - Intronic
1034353438 7:150432299-150432321 ATGGAGAAACACAGTCTGGTGGG + Intergenic
1034578571 7:152023396-152023418 ATCCAGCAGCCGTATCTGGTAGG - Intergenic
1035756640 8:2037724-2037746 CTGCAGAAGCATGATCAGGTGGG + Intergenic
1035992117 8:4503890-4503912 ATTTTGAAGCAGAATCAGGTAGG - Intronic
1036569988 8:9971750-9971772 ATGGATAAACAGAATGTGGTAGG - Intergenic
1036809269 8:11856228-11856250 ATGCAGATTTAGAAACTGGTGGG - Intronic
1038398993 8:27268836-27268858 ATGCAGATGCAGAATAAGGTGGG - Intergenic
1039614758 8:38946500-38946522 ATGCTGATTCAGAATGTGGTAGG + Intronic
1042695874 8:71554886-71554908 ATGTACAAGCAGTATGTGGTGGG + Intronic
1045250229 8:100476706-100476728 TTGGAGAAGGAGCATCTGGTTGG + Intergenic
1046207925 8:111027419-111027441 ATGCAGAAAAAGAAACTGTTGGG + Intergenic
1047682600 8:127269703-127269725 GTGCAGAAGCAGGATTTGGATGG - Intergenic
1050331997 9:4555086-4555108 ATGGAGAAGCTGAGTCTGGGAGG + Intronic
1050623284 9:7477131-7477153 AAGCAGAAGAAGCCTCTGGTGGG - Intergenic
1051017774 9:12501627-12501649 ATGAAGAAACAGTATGTGGTGGG + Intergenic
1051493941 9:17697769-17697791 TTGCAGAAGCAGAAAATGCTAGG + Intronic
1052592100 9:30511697-30511719 AGGCAGAATCAGAATCAAGTTGG + Intergenic
1052734978 9:32332703-32332725 TGGCAGAAGCAGAATATGGTTGG + Intergenic
1053043121 9:34891480-34891502 ATGCAGCACCAGAAGCTAGTGGG - Intergenic
1053911038 9:42904296-42904318 ATGCTGCACCAGAATCAGGTTGG + Intergenic
1054853986 9:69878440-69878462 ATGCTGAAACAGAATCAGGCAGG - Intronic
1055391550 9:75827255-75827277 AAGCAAAAGCAGAATGTGGATGG + Intergenic
1058292207 9:103256797-103256819 GTGCAGAAGAAAAATGTGGTTGG - Intergenic
1059368716 9:113807740-113807762 AGGCAGGATCAGACTCTGGTTGG + Intergenic
1059694371 9:116716783-116716805 ATTCAGAAGCAGATTATGCTGGG + Intronic
1059759067 9:117321216-117321238 ATGCAGTAGAAGAATCAGGCAGG + Intronic
1061035208 9:128109739-128109761 ATGAAGAAGCAGATTTTGGGAGG - Intergenic
1061207110 9:129171184-129171206 AGACAGAAGCAGAACCTGGCTGG - Intergenic
1062606522 9:137351066-137351088 GTGGAGAAGCAGATTCTGGGCGG - Exonic
1203623702 Un_KI270749v1:148759-148781 ATTCAGAAGCAGTTTTTGGTGGG - Intergenic
1186072904 X:5842106-5842128 AAGCAGAAGCAGAAACAGGAGGG + Intronic
1186246790 X:7623363-7623385 ACACATAAGCAGATTCTGGTAGG - Intergenic
1188405866 X:29809062-29809084 AAGCAGGAGCAGAATATGGTAGG - Intronic
1189146313 X:38658662-38658684 AAACAGAAGCAGAAGATGGTGGG - Intronic
1189150245 X:38699365-38699387 ATGCAGATTCAGATTCTGGGTGG - Intergenic
1192772182 X:74204428-74204450 AGGCAAAAGCAGAATCTGAGGGG - Intergenic
1194754417 X:97720808-97720830 ATGCAGAGGCAAAGTCTTGTAGG + Intergenic
1194828936 X:98596931-98596953 GTGCAGAAGCAAAATGTGTTGGG - Intergenic
1195085235 X:101407581-101407603 AAGCAGCAGCAGAGTCGGGTGGG + Intronic
1196002790 X:110804709-110804731 AAGCAGCATCAGAATCTGGAAGG + Intergenic
1196064997 X:111454446-111454468 AAGCAAAAGCAGAAGCTGCTAGG + Intergenic
1196256396 X:113524244-113524266 AAGAATAAGCAGAATATGGTTGG - Intergenic
1199284530 X:146041589-146041611 ATGCAGAAGCAGAGGCTGTCAGG + Intergenic
1200343944 X:155429363-155429385 ATGAGGAAACAGAATCAGGTGGG - Intergenic
1202142389 Y:21741571-21741593 ATGCAGATGCAGAGCCTGTTGGG - Intergenic
1202144469 Y:21764047-21764069 ATGCAGATGCAGAGCCTGTTGGG + Intergenic