ID: 1135857246

View in Genome Browser
Species Human (GRCh38)
Location 16:26023066-26023088
Sequence TACACTGAAGTGAATACAGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 197
Summary {0: 1, 1: 0, 2: 2, 3: 16, 4: 178}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1135857246_1135857248 17 Left 1135857246 16:26023066-26023088 CCAACTGTATTCACTTCAGTGTA 0: 1
1: 0
2: 2
3: 16
4: 178
Right 1135857248 16:26023106-26023128 CTTTTTTTTCCTTACCTCACTGG 0: 1
1: 0
2: 3
3: 86
4: 680

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1135857246 Original CRISPR TACACTGAAGTGAATACAGT TGG (reversed) Intronic
906450062 1:45937842-45937864 TACACTGAAGAGATTACAATAGG - Intronic
908564182 1:65337556-65337578 TCCACTGCAGTTATTACAGTTGG + Intronic
911392450 1:97263597-97263619 TACACTTAAGAAAATATAGTGGG + Intronic
911986507 1:104632255-104632277 TTCACTGAACTGTATCCAGTTGG - Intergenic
913491507 1:119384083-119384105 TTCATTGAAATGAATAAAGTAGG + Intronic
918769671 1:188539802-188539824 TATGCTGAAGTGAATATATTTGG + Intergenic
919066668 1:192699916-192699938 TACATAGAACTGAACACAGTAGG - Intergenic
919463614 1:197907532-197907554 AACACTGATGAGAAAACAGTAGG - Intergenic
921770494 1:219032905-219032927 GTTACTGAAGTGAATACTGTAGG - Intergenic
922326253 1:224531153-224531175 GACACTGATGTGACTACAGCTGG - Intronic
1065071097 10:22024464-22024486 TATACTGAACTGAGCACAGTAGG - Intergenic
1065471090 10:26081773-26081795 TACACGGAACTGAATCCATTTGG - Intronic
1067382816 10:45790634-45790656 TACACTGAAGTGAACCCGCTGGG - Intronic
1067890518 10:50131179-50131201 TACACTGAAGTGAACCCGCTGGG - Intronic
1068301569 10:55148985-55149007 TACATTGATGTGAATATAGCAGG - Intronic
1069477678 10:68749447-68749469 TTCAATGAAGTAAATAGAGTAGG - Intronic
1070128622 10:73641353-73641375 GACACAGAAGTCAACACAGTGGG + Intronic
1070272836 10:74974527-74974549 TAGCCTGAGGTGAAGACAGTCGG + Intronic
1070442045 10:76455952-76455974 TTCACTGTGGTGCATACAGTTGG - Intronic
1072266012 10:93728659-93728681 AACACTGAAGTGGTGACAGTGGG - Intergenic
1074054731 10:109912421-109912443 ACCACTGAAGTGAATACAGTGGG + Intronic
1074219203 10:111419865-111419887 AACACTGAAGTGAATTCCTTAGG - Intergenic
1081109337 11:39114561-39114583 TACACTTAAGTGATTACAGATGG + Intergenic
1083257951 11:61508326-61508348 TACACTGAAGTGATCCCAGCAGG + Intergenic
1084870137 11:72093104-72093126 TCCACTGAAGTGAATTCTATAGG + Intronic
1085144247 11:74178609-74178631 TACACTGCAATGAAAACAGTAGG - Intronic
1085935067 11:81131656-81131678 TATACAGACGTGAATAAAGTTGG + Intergenic
1085959087 11:81438085-81438107 TACCCTGAAGTGAAGTCAGAAGG - Intergenic
1086110787 11:83195690-83195712 TAAACTGGAATGGATACAGTGGG - Intronic
1086740997 11:90368790-90368812 TACACTTGAGTAAATCCAGTTGG + Intergenic
1087836804 11:102883271-102883293 TCCACTGAACTGAATTTAGTGGG + Intergenic
1088111865 11:106271104-106271126 CTCTCTGAAGTGAATACTGTGGG - Intergenic
1088625363 11:111726560-111726582 TACATTGCAGTCAATACAGAGGG - Exonic
1093838577 12:23867668-23867690 GACACTGAAATGAATTAAGTGGG + Intronic
1096298455 12:50404546-50404568 TCTACTGAAGTCAATATAGTTGG - Intronic
1097144533 12:56930823-56930845 TATACTTAAGTGAATAGAGAGGG - Intronic
1098472485 12:70861637-70861659 TAGGCTGCAGTGAACACAGTTGG + Intronic
1099994451 12:89763399-89763421 ACCTCTTAAGTGAATACAGTGGG + Intergenic
1101384611 12:104245749-104245771 TACACTGAAGTGAGTCCACAGGG - Intronic
1102329562 12:112017333-112017355 TGCACTGAAGAAAATACAGCAGG + Intronic
1105229607 13:18478966-18478988 TACACTGAAAAAAATAAAGTTGG + Intergenic
1105676283 13:22675617-22675639 TATACAGAAGTTAATACAGAGGG + Intergenic
1106575117 13:30967368-30967390 TACCCTGAAGTGGATACACAGGG - Intronic
1108037574 13:46307519-46307541 AACACTGAAAAGAATAGAGTAGG - Intergenic
1108704154 13:52969941-52969963 TACTCTGAAGTGAGTTAAGTTGG + Intergenic
1109325431 13:60861643-60861665 TTCACTTTAGTGAACACAGTGGG + Intergenic
1109338382 13:61022259-61022281 TACACTGAAGTAAAAACATTTGG + Intergenic
1110176433 13:72561600-72561622 TACACTAAAGGAAATACAGTAGG - Intergenic
1111866827 13:93779250-93779272 TACACTGGACTGAATTCACTGGG + Intronic
1112847576 13:103663151-103663173 GACACTGAACTGGATTCAGTGGG - Intergenic
1113007601 13:105724814-105724836 CAGACTGAAGTGGATACAGCAGG - Intergenic
1113207503 13:107933955-107933977 GAGACTGAATTGAATACATTGGG + Intergenic
1113386078 13:109849572-109849594 TACACTGAAGGAAATACAAGTGG + Intergenic
1114013853 14:18405848-18405870 TACACTGAAAAAAATAAAGTTGG + Intergenic
1114730073 14:24983505-24983527 TACACTGAAGAAAAGACAGAAGG + Intronic
1115154159 14:30319388-30319410 TCCAATGAAGTGAATCCAGGAGG - Intergenic
1117377917 14:55132223-55132245 TACACTGAACTGCTTACTGTAGG + Intronic
1117655114 14:57947565-57947587 TACACTGAAGTGGCAAAAGTGGG + Intronic
1118111557 14:62726878-62726900 TACATTGAAGTGTATTCAGTTGG + Intronic
1118372514 14:65149535-65149557 TACACTGAAGTGCATGCACATGG + Intergenic
1119326972 14:73765833-73765855 GACACTGGAGTGTATACTGTTGG + Intronic
1121064441 14:90948852-90948874 TAAACTCAAGTGAATATACTTGG - Intronic
1122361325 14:101167814-101167836 TATACTGTAGTGAATACTGTAGG + Intergenic
1126251859 15:46576713-46576735 TGCACTGAGTTGGATACAGTGGG - Intergenic
1127197040 15:56598811-56598833 TACTATGAAGTAAAGACAGTGGG + Intergenic
1128910542 15:71509968-71509990 AAAAATGAAATGAATACAGTAGG + Intronic
1135857246 16:26023066-26023088 TACACTGAAGTGAATACAGTTGG - Intronic
1138899850 16:61255763-61255785 TACTCTGAATTGAATATAGCTGG + Intergenic
1141213578 16:82003564-82003586 CACACTGAAGTGAGAACAGGAGG - Intronic
1141395809 16:83703490-83703512 TAAACTGAAGTGACAAAAGTGGG + Intronic
1145416571 17:22718222-22718244 TTTACTGCAGTGAATACTGTTGG - Intergenic
1147112457 17:38273252-38273274 TCCACTAAAGTGAATACCCTAGG - Intergenic
1148417172 17:47515998-47516020 TCCACTAAAGTGAATACCCTAGG + Intergenic
1149545854 17:57503390-57503412 AACACTGAAGTGTTAACAGTGGG + Intronic
1154523792 18:15260868-15260890 TACACTGAAAAAAATAAAGTTGG - Intergenic
1155603120 18:27572273-27572295 GACACTAAAGAGAATACGGTGGG + Intergenic
1156546806 18:37971813-37971835 TACACTGAAGTGAGTGAAGATGG - Intergenic
1158112288 18:53953788-53953810 TACGCTGAAGTGATGAAAGTAGG - Intergenic
1159140985 18:64394342-64394364 TACACTAAAGAGAAGAAAGTTGG + Intergenic
1159849608 18:73511982-73512004 TACACTGAAGTAAACAGAGGAGG - Intergenic
1160552106 18:79700508-79700530 TTCACAGAATTGAAGACAGTTGG - Intronic
1164559703 19:29282050-29282072 TAAACTAAATTAAATACAGTAGG + Intergenic
1165147516 19:33740839-33740861 TTAACTGAAATGACTACAGTGGG - Intronic
925120486 2:1414971-1414993 TTCACTGGAGTGAATACTGCAGG + Intronic
926880563 2:17539959-17539981 AACACTTAAGTGCATACAGAAGG + Intronic
927410259 2:22816924-22816946 TAAACTAAAGTGAATACTGAAGG + Intergenic
929114526 2:38433045-38433067 TAGGCTGCAGTGAGTACAGTAGG + Intergenic
929800310 2:45094165-45094187 AACACTGAAAAGAATACAATTGG - Intergenic
932789460 2:74641228-74641250 TGCACTAAAGTGAATATATTTGG - Intronic
933857985 2:86436454-86436476 TACACTGAGGTGAAGACAGATGG - Intergenic
935620137 2:105122320-105122342 TTCACTGAAGAGGATACAGATGG - Intergenic
935801737 2:106704004-106704026 CTCACTGAAGAGAAGACAGTTGG + Intergenic
938523098 2:132093681-132093703 TACACTGAAAAAAATAAAGTTGG - Intergenic
940558163 2:155258943-155258965 TAAAGTGAAGTGAATAATGTAGG - Intergenic
943655530 2:190504190-190504212 AAAACGGAAGTGATTACAGTAGG + Intronic
944370527 2:198977469-198977491 TGAACTGAAGTGAAAAAAGTGGG - Intergenic
946979464 2:225192512-225192534 TACATTGAAGTAAGTACTGTAGG + Intergenic
1168786710 20:545488-545510 TAAACAAATGTGAATACAGTTGG - Intergenic
1171019158 20:21569511-21569533 TACAGTGAATTGCATATAGTAGG - Intergenic
1175023177 20:55873295-55873317 TACAGTGAAACGAATACAGATGG + Intergenic
1176773596 21:13107325-13107347 TACACTGAAAAAAATAAAGTTGG + Intergenic
1178876592 21:36419003-36419025 GACACTGAAGTGACTTCACTTGG - Exonic
1179561119 21:42216837-42216859 AACACAGCAGTGACTACAGTGGG + Intronic
1180438350 22:15336662-15336684 TACACTGAAAAAAATAAAGTTGG + Intergenic
1180521210 22:16207022-16207044 TACACTGAAAAAAATAAAGTTGG + Intergenic
1181926171 22:26360601-26360623 TGCACTGCAGGTAATACAGTAGG + Intronic
1182066358 22:27434290-27434312 TACGCTGAAGTGGAGGCAGTGGG - Intergenic
949655851 3:6218241-6218263 TACACTGAACTGTCTTCAGTAGG + Intergenic
951123220 3:18952815-18952837 AACACGGAAGGGAATATAGTTGG - Intergenic
951492080 3:23282169-23282191 CACATTGCAGTGAATACAGTTGG + Intronic
954200272 3:49019969-49019991 TACAGTGAAATGAAGACATTTGG - Intronic
955814635 3:62828931-62828953 TACACTGAATGTAACACAGTTGG - Intronic
957137373 3:76306840-76306862 GAAACTGAACTGAAAACAGTGGG - Intronic
957875089 3:86134103-86134125 ATCACTGCAGTGAATACTGTAGG + Intergenic
957881407 3:86218534-86218556 GAGAATGAAGTGAATACAGGAGG - Intergenic
959201156 3:103249556-103249578 AACATTGAACTGAATACATTAGG + Intergenic
959341682 3:105139322-105139344 TATAATGAAGTCATTACAGTTGG + Intergenic
966063592 3:175788482-175788504 TGCACTGTACTGAATACTGTAGG - Intronic
966064827 3:175806816-175806838 AACAAAGAACTGAATACAGTGGG - Intergenic
966506786 3:180712418-180712440 TAAACTGTTATGAATACAGTGGG - Intronic
968704776 4:2072773-2072795 TTCACTGAAGTGAGCAGAGTCGG + Intronic
969904850 4:10384315-10384337 AACACTGCAGTGAATGCAGCAGG - Intergenic
970094858 4:12451756-12451778 TACTCTGAAGTGAACAGATTTGG + Intergenic
970914161 4:21312866-21312888 TTCACTTAAGTGATTACATTTGG - Intronic
972698446 4:41470547-41470569 TACACTGGAGTGGATAAAGGAGG - Intronic
973991827 4:56416817-56416839 TACACTGAATTTAATTCATTGGG - Intronic
975086529 4:70347700-70347722 AACACTGAAATGAACACAATTGG + Intergenic
975854869 4:78613627-78613649 ATCACTGAGGTGAACACAGTTGG - Intergenic
976106898 4:81628815-81628837 TAGGATCAAGTGAATACAGTAGG - Intronic
976454275 4:85228289-85228311 TTCACTGTAGTGAAGTCAGTTGG + Intergenic
978649017 4:110977965-110977987 GACACTGAGGTGACTATAGTTGG + Intergenic
981353417 4:143758388-143758410 TCCATTAAAGTGAATGCAGTGGG - Intergenic
982492295 4:156044472-156044494 TCCACTGAAGAGAAAACAGAGGG - Intergenic
983347074 4:166540745-166540767 TACAGAGAAGGGAATATAGTTGG + Intergenic
984620653 4:181948782-181948804 TGCACTGGGGTGAAGACAGTGGG - Intergenic
987460439 5:18202775-18202797 AACAGTGCAGTGAATACAGGAGG - Intergenic
988198260 5:28036082-28036104 TAGACTTAAGTGAAAACATTTGG - Intergenic
988478829 5:31612288-31612310 TACAGTGAGGTGAATACAGCAGG - Intergenic
988625172 5:32867320-32867342 TACAATGGACTGAATTCAGTAGG - Intergenic
990067031 5:51729103-51729125 TAGAATGAAGAGAGTACAGTTGG - Intergenic
992400481 5:76406765-76406787 AACACTTAAGTGACTACAGTGGG + Intronic
994500524 5:100571821-100571843 TACCCTGCAATGGATACAGTAGG + Intronic
994683337 5:102917606-102917628 AACACTGAAGTGTAAACAGGAGG - Intronic
996267506 5:121559377-121559399 TTCAGTGTGGTGAATACAGTTGG - Intergenic
996506462 5:124273308-124273330 TAAACTGATATGAAAACAGTGGG + Intergenic
996868976 5:128164348-128164370 TCCACTGCAGTGAATATATTAGG - Intronic
1000164207 5:158631563-158631585 AACACTGAAATGAAAACAGCAGG + Intergenic
1001554786 5:172629492-172629514 TGTACTGAAGTGAACACTGTCGG + Intergenic
1004114679 6:12754660-12754682 TACAAGGAAGTAAGTACAGTCGG + Intronic
1006588404 6:35134777-35134799 CACAAAGATGTGAATACAGTTGG - Intronic
1008885203 6:56424850-56424872 TACACTGAGGAGAATTAAGTTGG + Intergenic
1009452740 6:63820257-63820279 CTCACTGAAGGGTATACAGTTGG - Intronic
1011577849 6:88824305-88824327 TACTCTGTACTGAATACCGTAGG + Intronic
1014574600 6:123054563-123054585 TCCACTGAAGTAAATACATTGGG - Intronic
1016323402 6:142872850-142872872 TACACTGAAAAGCATCCAGTGGG - Intronic
1018512899 6:164545120-164545142 TAGATGGAGGTGAATACAGTGGG + Intergenic
1018569477 6:165194123-165194145 TACACTGTAGTGATGACACTAGG + Intergenic
1019091182 6:169535864-169535886 TACTCTGAAGTGAATACACTGGG - Intronic
1021384082 7:20006915-20006937 TATACTGTACTGAATACTGTTGG - Intergenic
1024577813 7:50779174-50779196 GACACTAAAGTGAACACAGGGGG + Intronic
1027909656 7:84233719-84233741 CAAACTGAATTGAAAACAGTAGG - Intronic
1027913762 7:84287702-84287724 TACACTGAACAGAATACTGGTGG - Intronic
1028466198 7:91154976-91154998 CATACTGAAGTGGACACAGTGGG + Intronic
1029854696 7:103503735-103503757 GACACTGCTGTTAATACAGTGGG + Intronic
1032565696 7:132940695-132940717 TAGACTGAAGTGAATAATGGAGG - Intronic
1033209256 7:139448447-139448469 TATACTGCACTGAATACTGTTGG + Intergenic
1036703145 8:11027139-11027161 AATACTGTACTGAATACAGTAGG + Intronic
1037223752 8:16557451-16557473 TAAAGTGAAGCAAATACAGTTGG - Intronic
1038109871 8:24484001-24484023 TACATCTAAGTGAATACAGAAGG - Intronic
1038271319 8:26078319-26078341 CACACAGCAGTGAAGACAGTGGG - Intergenic
1038271335 8:26078382-26078404 CACACAGCAGTGAAGACAGTGGG - Intergenic
1041469650 8:58194329-58194351 TCCACTAAAGTAAATAAAGTTGG - Intronic
1042884158 8:73529656-73529678 CACAGTGAATTGTATACAGTTGG - Intronic
1043294298 8:78645000-78645022 TGCACTGAAGGGAATAAAGTGGG - Intergenic
1045280453 8:100745322-100745344 TTTACTGAAGTCAATGCAGTTGG + Intergenic
1045985423 8:108244769-108244791 GACACTGAATTGTATATAGTTGG - Intronic
1046734946 8:117766928-117766950 TAAAATGAGTTGAATACAGTGGG - Intergenic
1046890089 8:119413425-119413447 TATACTGCACTGAATACTGTAGG - Intergenic
1046895812 8:119471661-119471683 TTCACTGAAGAGAATATAGATGG + Intergenic
1048580192 8:135724166-135724188 TAGATCGAAGTGGATACAGTGGG + Intergenic
1053701788 9:40700910-40700932 TACACTGAAGAAAATAAAGTTGG - Intergenic
1054411851 9:64824365-64824387 TACGCTGAAGAAAATAAAGTTGG - Intergenic
1055198845 9:73631451-73631473 TACACTGAACTTATTACAATGGG - Intergenic
1055284835 9:74717301-74717323 TACAAATAAGTGAAGACAGTTGG + Intergenic
1055612836 9:78040947-78040969 TACACTGAAATAAATACCTTTGG - Intergenic
1058243251 9:102594082-102594104 TACTCTGCAGTGAATTCAATTGG + Intergenic
1058929748 9:109707425-109707447 TACAAAGAAGTGAGGACAGTGGG + Intronic
1186572038 X:10725192-10725214 TGCTCTGAAGTGAACACAGTTGG - Intronic
1188439890 X:30205854-30205876 TACACTGCTTTGATTACAGTAGG - Intergenic
1189645579 X:43126082-43126104 AACACTGAAGTGTATATAATAGG - Intergenic
1192013156 X:67297366-67297388 TACACTAAAATGAAAACTGTTGG + Intergenic
1192102794 X:68282819-68282841 TTCACTGAAATGAACACAGATGG + Intronic
1196629228 X:117916375-117916397 GACAATGAAATGAATACAGAAGG - Intronic
1197540758 X:127757000-127757022 GACACTGTAGTGAATACTCTAGG + Intergenic
1197547565 X:127844011-127844033 CACACTGACCTGAATACTGTAGG + Intergenic
1198723150 X:139646659-139646681 TACTCTGAAGTTAAGTCAGTTGG + Intronic
1201424436 Y:13832967-13832989 TAAAATGAAGTGAATAAAGTGGG + Intergenic