ID: 1135857735

View in Genome Browser
Species Human (GRCh38)
Location 16:26027523-26027545
Sequence TTGGAGAAGCAAAATGAGAT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 470
Summary {0: 1, 1: 0, 2: 1, 3: 47, 4: 421}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1135857735_1135857738 -5 Left 1135857735 16:26027523-26027545 CCTATCTCATTTTGCTTCTCCAA 0: 1
1: 0
2: 1
3: 47
4: 421
Right 1135857738 16:26027541-26027563 TCCAAATTATGGTATGGATCTGG 0: 1
1: 0
2: 0
3: 6
4: 108

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1135857735 Original CRISPR TTGGAGAAGCAAAATGAGAT AGG (reversed) Intronic
900728347 1:4233763-4233785 CTGGAAAAGCAAAATGAAATTGG - Intergenic
901386725 1:8914394-8914416 TTCGAAAAGCAAAAAGAGCTGGG - Intergenic
902296470 1:15470533-15470555 TTGGAGATGTAAAATGAGGGGGG - Intronic
902299266 1:15489825-15489847 TTGGAGATGTAAAATGAGGGGGG - Intronic
902491386 1:16784176-16784198 TTGAAAAAGAAAAATGAAATGGG - Intronic
902533697 1:17106760-17106782 TAGGAGAAGAAAGATGAGAGAGG + Intronic
904935540 1:34127363-34127385 GTGGAGAAGAAAAATAAAATGGG + Intronic
907822133 1:57980546-57980568 GTGGAGAAGCAACATGGGATAGG - Intronic
907972575 1:59398014-59398036 CTGGAGAAACAAAATTAGAAGGG - Intronic
908390591 1:63679951-63679973 GAGGAGAAGCAAAAAGAGAAGGG - Intergenic
908744537 1:67362805-67362827 AGAGAGAAGGAAAATGAGATAGG + Intronic
909626559 1:77723426-77723448 TTGGAGATGCAGACTGAGCTAGG + Exonic
910361127 1:86414416-86414438 TTGGAGAAGCAGAAGGCCATTGG - Intergenic
910549175 1:88456513-88456535 TGGGAGAAGGAAAAGGAGAGAGG - Intergenic
910909281 1:92216626-92216648 TTGGGTAAGCAAGAAGAGATGGG + Intergenic
911493744 1:98603519-98603541 TTAGAGAAACACAATGATATTGG + Intergenic
911508697 1:98785266-98785288 TTGGAGTACCAGAAGGAGATGGG + Intergenic
911803329 1:102173653-102173675 TTGGAAAAGAAAAATTAGAATGG + Intergenic
911808939 1:102249011-102249033 TTGGAAAACCAAAAGTAGATAGG - Intergenic
912465988 1:109874266-109874288 TTGGAGAAAATAAATGAGTTTGG - Intergenic
913195135 1:116449988-116450010 GTGCAGAAGCCAAATCAGATGGG + Intergenic
913439048 1:118878044-118878066 TAGGAAAAGCAGATTGAGATTGG + Intergenic
915006727 1:152645215-152645237 TTGGAGAAGGACAGAGAGATTGG - Intergenic
915610468 1:156987979-156988001 TTTAAGCAGCAAAATGACATGGG - Intronic
915790669 1:158666852-158666874 TAGGAGAAGCATAATGAGGTTGG + Intronic
916355104 1:163897190-163897212 ATGGAGAAGCAAACTGATCTAGG + Intergenic
916565294 1:165970639-165970661 TTGAAGAAGAAAAATAAGAAAGG - Intergenic
916741958 1:167653995-167654017 TCAGAGAAGCAAAATGACAAAGG - Intronic
916919444 1:169448310-169448332 AGGGAGAAGGAAAATGACATAGG - Intronic
917473667 1:175349357-175349379 ATGGAGAGGTAAAATAAGATGGG + Intronic
917923531 1:179770536-179770558 CTGGAGATGAAAAATGAGACTGG - Intronic
918157374 1:181862169-181862191 CTGGATCAGGAAAATGAGATAGG + Intergenic
918658055 1:187053771-187053793 TTGGAGAATAAACATGAGAGGGG + Intergenic
919676778 1:200391740-200391762 TTGGGGAAACAAAATGAGGAAGG + Intergenic
920205102 1:204285820-204285842 TTGGAGAAGGAAGAAGAGTTGGG + Intronic
920702560 1:208228870-208228892 TTGGAGGAGAGAAAGGAGATTGG - Intronic
920702616 1:208229203-208229225 TTGGAGGAGAGAAAGGAGATTGG + Intronic
920813804 1:209311850-209311872 GTGGGGAAGCAAAATAAAATAGG + Intergenic
921021006 1:211235621-211235643 TTGGAGGATCACAATGAGGTTGG + Intergenic
921557874 1:216621023-216621045 TTGTAAAAGCAAAATGGGATGGG - Intronic
921721302 1:218474803-218474825 TTGGAGCAGCAAAATGATTAAGG + Intergenic
922029827 1:221787209-221787231 TTGGAAAAGAAAAAAGAGAATGG + Intergenic
922630931 1:227110004-227110026 TTGGAGGAAGAAAATTAGATGGG - Intronic
923529057 1:234798367-234798389 TTGAAAAAGAAAAATGAAATGGG + Intergenic
924118293 1:240769756-240769778 TTGGAGAATCAAATGGAAATGGG - Intergenic
924545734 1:245025531-245025553 TTGGTGAGCTAAAATGAGATGGG + Intronic
1064290948 10:14033482-14033504 TTGGATAAAGAAAATGTGATAGG + Intronic
1065436923 10:25712410-25712432 TTGGAGGGGCAAAAACAGATAGG - Intergenic
1065681353 10:28236564-28236586 ACGGAGAAAAAAAATGAGATCGG + Intronic
1066386006 10:34941753-34941775 TTGGAAATGCAAATTAAGATGGG + Intergenic
1066511308 10:36099768-36099790 AAGGAGAAGGAAAATGATATAGG + Intergenic
1066597652 10:37069126-37069148 TTGGAGAAGCAAAAAAGGACAGG - Intergenic
1067257313 10:44654415-44654437 TTGAAGAAGAAAAATAAAATTGG - Intergenic
1068033756 10:51735019-51735041 CTGAAGAAGCAGAGTGAGATAGG + Intronic
1068165663 10:53329107-53329129 CTGGAGAATAAAAATAAGATGGG - Intergenic
1068168778 10:53365891-53365913 TTTGAGAAGCAGAATGGGAATGG + Intergenic
1068631237 10:59299974-59299996 TGGCAGAAGAAAAATGAGACTGG + Intronic
1069357840 10:67608102-67608124 TTTGAGAGGCCAAATGAGTTAGG + Intronic
1069704509 10:70449702-70449724 TTGAAGAAGGACAATGAGATGGG - Intergenic
1069771023 10:70900367-70900389 TTGAAGAAGAAAAATGAGATTGG - Intergenic
1070298063 10:75181859-75181881 TGGGGGAAGCAAAATTAGCTGGG + Exonic
1070366707 10:75743700-75743722 TTAGAGAAGGAAAAGGAAATGGG + Intronic
1071071448 10:81698432-81698454 TTGGAGTACCAGAAGGAGATGGG + Intergenic
1071077064 10:81767761-81767783 TTGGAGTACCAGAAGGAGATGGG - Intergenic
1071186924 10:83057307-83057329 TTGGAGAAGAAAGATGGGCTGGG + Intergenic
1071193485 10:83129379-83129401 TTGGAGAATAAAAGGGAGATGGG + Intergenic
1071780532 10:88839515-88839537 TTGGAGATGAACCATGAGATGGG - Intronic
1072324894 10:94288232-94288254 TTGGAGACTCAGAATGAGAGTGG - Intronic
1073839981 10:107487209-107487231 TTGGTGAAACAAAATAAGAAAGG + Intergenic
1074330609 10:112504236-112504258 TTGGAATGGCAAAATGGGATAGG - Intronic
1074857583 10:117484725-117484747 TTGGTTAAACAAAATGAAATAGG + Intergenic
1078861460 11:15251148-15251170 TGGAAGAAGCAAAATGAGTTTGG + Intergenic
1079852547 11:25555143-25555165 TTGGAGAAGAGAAAGAAGATGGG - Intergenic
1081004765 11:37721916-37721938 TTGAAAAAGGAAAATGAGATTGG - Intergenic
1081101714 11:39010335-39010357 ATGGAGAAGCCAAAGGAAATAGG - Intergenic
1082228473 11:49736375-49736397 TGGAAGAAACAAAAAGAGATGGG - Intergenic
1082556450 11:54568302-54568324 TGGGAGGGGCAGAATGAGATTGG + Intergenic
1082695500 11:56358899-56358921 TTTGAGAATCAAACTGAGATCGG + Intergenic
1083049394 11:59763414-59763436 CTGGAGAAGCAAAAGCAGGTAGG + Intronic
1085892152 11:80593263-80593285 TTGGAGAAGCAAAAAGGGACAGG + Intergenic
1087785066 11:102345399-102345421 TTGAAGAAGAAAAGTAAGATTGG - Intergenic
1088383233 11:109220310-109220332 TTGGAGTACCTAAAAGAGATGGG - Intergenic
1088553021 11:111033794-111033816 TTGGAGACGCAAAATGGGGAGGG + Intergenic
1089066704 11:115667424-115667446 GTGGAGGAGAAAAATGGGATGGG + Intergenic
1089082270 11:115786708-115786730 CTTAAGAAGCAAAATGAGCTTGG + Intergenic
1092010195 12:5103647-5103669 TTGGAGAAGGAACAAGAGATTGG - Intergenic
1093000925 12:13994710-13994732 TTGCAGAAGGAAAAACAGATTGG + Intergenic
1093191508 12:16080129-16080151 TTGGAGATGCTAAAAGATATGGG + Intergenic
1093855339 12:24094954-24094976 TTGGATAAACAAAAGGAGAGAGG - Intergenic
1093910473 12:24741682-24741704 GTGGAAAAGCCAGATGAGATGGG - Intergenic
1095135446 12:38595722-38595744 TTGAAATAGCAAAATGTGATTGG - Intergenic
1095320229 12:40818283-40818305 TTGGACAACCAGAAGGAGATGGG - Intronic
1095346345 12:41153908-41153930 TTGAAGAATAAAAATCAGATGGG - Intergenic
1095627500 12:44333787-44333809 ATGGAGAAGTAAAGAGAGATAGG + Intronic
1096262563 12:50102293-50102315 TTGTAGGGGCAAAATGAGAGAGG + Intergenic
1097033639 12:56107362-56107384 CTAGAGAAGCAAAAGGAGAAAGG + Intronic
1097345993 12:58493023-58493045 TTGAAGAAGAAAAATGAAGTTGG - Intergenic
1097476594 12:60064662-60064684 ATGGAGAAGAAAAATGGTATCGG - Intergenic
1097625298 12:61992707-61992729 TTGGAGCAGAAAAAGGGGATTGG - Intronic
1098059783 12:66549286-66549308 GTGCAGAAGCAAAATGATAAAGG + Intronic
1098690145 12:73477221-73477243 TTCTAGAGGCAAAGTGAGATAGG - Intergenic
1098754170 12:74337142-74337164 GTGGAGAAGGAAAATGTGGTAGG + Intergenic
1101273346 12:103171998-103172020 TTGGAGAACCAGAATGAATTAGG + Intergenic
1103133613 12:118489064-118489086 TTGGAGAATAAAACTGAGAGGGG + Intergenic
1105607758 13:21941395-21941417 TTGGAGAAGAAAAAAGAAGTAGG - Intergenic
1105828464 13:24143319-24143341 TGGGAGAAGTAAAATGAGAAAGG - Intronic
1106058494 13:26262507-26262529 CAGGAGAAGCAAAATTTGATGGG + Intronic
1106846493 13:33743146-33743168 CTGGACAAAGAAAATGAGATGGG + Intergenic
1106889981 13:34234833-34234855 TTGGAGTACCAGAAGGAGATGGG - Intergenic
1108516611 13:51209267-51209289 TTGGAGAGGCACAATTAGAGTGG + Intergenic
1109492940 13:63127146-63127168 TTGTAGAAGCACAATGACAATGG - Intergenic
1110260375 13:73477790-73477812 TTGGAGGAGCAGATTGGGATAGG - Intergenic
1110554291 13:76840858-76840880 ATGTAGAAGCAAAATGAGTGTGG + Intergenic
1110836776 13:80092705-80092727 TTGGAGTACCTAAAAGAGATGGG - Intergenic
1111956873 13:94768825-94768847 GGGGAGTAGCAAGATGAGATGGG + Intergenic
1112879931 13:104094452-104094474 TTTGAGAAGCTAAGTGTGATGGG - Intergenic
1112879935 13:104094484-104094506 TTTGAGAAGCTAAGTGTGATGGG - Intergenic
1114706123 14:24728043-24728065 TTGGAGTACCAGAATTAGATGGG + Intergenic
1114829878 14:26127974-26127996 TTAGAGAAGCAAAAAGACCTAGG + Intergenic
1115126698 14:30003518-30003540 TTTGAGATGAAAGATGAGATTGG + Intronic
1115461495 14:33666034-33666056 CTTGAGAAGAAAAATGAGATAGG + Intronic
1115720067 14:36151007-36151029 AGGGAGAAGAAAAATGATATAGG - Intergenic
1116588400 14:46739670-46739692 TTCGAGAAGGACAATGATATAGG + Intergenic
1116596564 14:46855882-46855904 TTTTAGAAGAAAAATGAGACAGG - Intronic
1116691600 14:48114175-48114197 TTTGAGAGACAAAATGTGATGGG - Intergenic
1117670099 14:58097926-58097948 TTGGTGAAACAAAATGAAATTGG - Intronic
1118376500 14:65181918-65181940 TGGGAAAAGCGAAAGGAGATGGG - Intergenic
1118841192 14:69513724-69513746 AGGGAGAAGGAAAATGATATAGG - Intronic
1119215890 14:72868805-72868827 TTAGAAAATAAAAATGAGATAGG - Intronic
1119437548 14:74607672-74607694 TTGCAGAAGAATAATGAAATAGG + Intronic
1119580739 14:75777734-75777756 TTGGTGAAGTTAAATGAGGTAGG + Intronic
1120303672 14:82739723-82739745 TTGAAGAAGTAAAATGATTTGGG + Intergenic
1120440738 14:84535689-84535711 TTGGTGAAGCAACAAGAGACTGG - Intergenic
1120878728 14:89398088-89398110 TTGGGGAAGCCAAAGGAGAAGGG - Intronic
1121002083 14:90458724-90458746 TTGCAGAGGCACAATGAAATAGG - Intergenic
1121224728 14:92312897-92312919 TTGGAGAAGCAACAAGAAATTGG + Intergenic
1121710167 14:96031736-96031758 TGGGAGAAGCCACCTGAGATGGG - Intergenic
1121748413 14:96322563-96322585 TACGAGAAGAAAAAGGAGATGGG + Exonic
1123851012 15:24357165-24357187 TTGGAAAATCAAAATGCAATGGG - Intergenic
1123855892 15:24411398-24411420 TTGGAAAATCAAAATGCAATGGG - Intergenic
1124046384 15:26154613-26154635 TTGGAGTACCAGAAAGAGATGGG - Intergenic
1126872258 15:53002307-53002329 TTGGAGGAGAAAAGTGGGATCGG - Intergenic
1127524221 15:59776127-59776149 CTGGAGAAGAGAAATGAGCTGGG - Intergenic
1133139179 16:3731771-3731793 ATGGAGAAGCACAAGGAGGTAGG - Exonic
1133812170 16:9169096-9169118 TAGAAGAAGAGAAATGAGATGGG - Intergenic
1134236373 16:12469439-12469461 TTGAGGAAGCAAAATGAATTGGG + Intronic
1134373730 16:13650233-13650255 TTACATAAGCAAAATGAGGTGGG + Intergenic
1135293087 16:21257025-21257047 TTGGAGTAGCAAAAAGCGAAGGG + Intronic
1135432737 16:22400378-22400400 TTCTAGAAGCAATATGAGAGAGG - Intronic
1135666634 16:24341057-24341079 TTAGAAAAGTAGAATGAGATTGG - Intronic
1135857735 16:26027523-26027545 TTGGAGAAGCAAAATGAGATAGG - Intronic
1136187630 16:28597412-28597434 TTGGAGGAGAAAGATGGGATAGG + Intergenic
1136348759 16:29693938-29693960 TTGGATAAACAAACTGTGATGGG + Intronic
1137482982 16:48867804-48867826 TTGAAGAAGCCAAAAGGGATGGG - Intergenic
1137823552 16:51468288-51468310 TAGGAGAAGCAAGAAGAGTTTGG - Intergenic
1138340153 16:56283878-56283900 ATGGAGCAGCAGAATGAGATGGG - Intronic
1138470123 16:57227958-57227980 TTGGGGTAGCAAAATGAGAGAGG - Intronic
1138526125 16:57608307-57608329 TTGGAGGAGCAAAAAGGGAAGGG - Intergenic
1139868945 16:70088152-70088174 TTGTAGAAGTGAAAGGAGATGGG - Intergenic
1140386443 16:74544020-74544042 TTGGAGAAGTGAAAGGAGATGGG + Intronic
1141278951 16:82613379-82613401 TTGTAAAAGAAAAATGAGACCGG + Intergenic
1141536510 16:84684866-84684888 TTAGAGAAGCACAAAAAGATGGG - Intergenic
1143795349 17:9331646-9331668 TTGGCGATGCAAATTGAGAGCGG - Intronic
1143873461 17:9974445-9974467 TGGGGGAAGAAAAATGAAATTGG + Intronic
1144516230 17:15919142-15919164 TTGGGGAAGGAAACTGTGATGGG + Intergenic
1145982714 17:29023330-29023352 TTGGGGAAGAATAATGAGATTGG + Intronic
1146933602 17:36795649-36795671 ATGGATAAGCAAAATGTGGTAGG - Intergenic
1147202203 17:38810268-38810290 TTGGAGATGCTAAATGTGAGTGG - Intronic
1147499973 17:40953619-40953641 TTGGAGAAGGAAAAAGAGAAAGG + Intergenic
1147907803 17:43833906-43833928 TTGCAGAACCAAAATAAGAATGG - Intergenic
1149278318 17:55071091-55071113 AGGGAGAAGAAAAAGGAGATGGG - Intronic
1149841434 17:59968410-59968432 TTCAAGAAGAAGAATGAGATTGG + Intronic
1150995900 17:70317152-70317174 TGGAAGATGCAAAATGAGGTTGG - Intergenic
1151953136 17:77366251-77366273 CTGGAGTACAAAAATGAGATGGG - Intronic
1153297474 18:3561493-3561515 TGAGAGAAGGAAAATGACATAGG - Intronic
1154059990 18:11050746-11050768 TTGGAGAGGCAGAATTAGAAAGG - Intronic
1154352819 18:13600813-13600835 TTGTATAACCAAAATTAGATGGG + Intronic
1155403166 18:25460525-25460547 TTGCAGAAGCAGAAAGAGAATGG + Intergenic
1155438403 18:25836333-25836355 TTGGAGAAGAGTAAGGAGATGGG + Intergenic
1155528683 18:26743774-26743796 ATTCAGAAGCAAAGTGAGATTGG + Intergenic
1155617016 18:27734124-27734146 TTAGGGAAAGAAAATGAGATAGG + Intergenic
1155998275 18:32356103-32356125 TTTAAGGAGCAAAATGAGAAAGG + Intronic
1156184515 18:34646570-34646592 TTTTAGAAGCAATATGACATCGG + Intronic
1156287500 18:35713032-35713054 TTGAAGAAGAAAAATAAAATTGG + Intergenic
1156424035 18:36989225-36989247 TTTGAGAATAAAAATGAGGTTGG + Intronic
1156664731 18:39391295-39391317 TTGGAGAACCTGAAAGAGATGGG + Intergenic
1156905466 18:42347520-42347542 TCTGAGAAGCAAAATGGGTTTGG + Intergenic
1157078144 18:44490956-44490978 TTTGATAAGGAAAAAGAGATTGG - Intergenic
1158343486 18:56490879-56490901 TGGGAAAAGCAAATTGAGACTGG - Intergenic
1159024546 18:63170634-63170656 TTGCAGAAGGATAATGAAATGGG - Intronic
1159321848 18:66861347-66861369 TTGGAGAAACTATATGAAATGGG + Intergenic
1159345130 18:67192271-67192293 ATGGAGAAACAAAAAGAGATGGG - Intergenic
1160116090 18:76080986-76081008 CTGGAGAAGCAACATGAGTTGGG + Intergenic
1161506549 19:4647083-4647105 ATGAATAAACAAAATGAGATCGG - Intronic
1162991757 19:14307416-14307438 GGGGAGAAGAAAAATGAGACAGG - Intergenic
1165657116 19:37543816-37543838 GTCAAGAAGCAAAATGAAATAGG + Intronic
1166108860 19:40610869-40610891 ATGGAGAAGCAGAATGAGGAGGG + Intronic
1166532552 19:43551810-43551832 TGGGAGAAACAAAAAGAGGTTGG + Intronic
1168103540 19:54153521-54153543 CAGGAGAAGGAAAATGAGACAGG - Intronic
925277156 2:2658242-2658264 TTGTAGAATCATTATGAGATTGG + Intergenic
925600611 2:5605243-5605265 TTGGAGAGGGAAACTGAGTTTGG + Intergenic
926458616 2:13100005-13100027 TTGTAGATGCACTATGAGATTGG + Intergenic
927015369 2:18954036-18954058 TTGGAAAAGAAAAATAAAATTGG - Intergenic
927220332 2:20701860-20701882 ATGGAGAAGCCAGATGAGGTTGG - Intronic
927645387 2:24873868-24873890 TTGGAGTTGAGAAATGAGATGGG + Intronic
928009768 2:27596214-27596236 TTGGAGAACTGAAATAAGATTGG - Intronic
929432241 2:41897129-41897151 TTGGAAAAGGGAAATGAGAGTGG - Intergenic
929802654 2:45117480-45117502 TTGGGGAAGCAAAATAATTTTGG + Intergenic
930146509 2:48012433-48012455 TTGGAAAACTAAAATGAAATTGG + Intergenic
930294232 2:49534148-49534170 TTGGATAACCTAAAAGAGATGGG + Intergenic
930501131 2:52219513-52219535 TTGGAGAATCAAGACCAGATAGG + Intergenic
931291220 2:60875677-60875699 TGGTAGAAAGAAAATGAGATGGG - Intergenic
931674770 2:64683366-64683388 TTGGAGAAAAAGAAAGAGATAGG + Intronic
931871341 2:66463734-66463756 CTGGAAATGCAAAATGAGAGTGG - Intronic
931940978 2:67252147-67252169 TTTGAGGAGCAAAATAAGTTGGG + Intergenic
932936365 2:76107642-76107664 AGGGAGAAGGAAAATGATATAGG - Intergenic
933161678 2:79031020-79031042 TGGGAGAAGGGAAATGATATAGG + Intergenic
933214882 2:79618609-79618631 TTGGAGAAGAAAAACAAGAATGG - Intronic
934626162 2:95855891-95855913 CTGGAGAAGCAAAGAGAGAGCGG - Exonic
935703692 2:105837393-105837415 TTGGAGAAACAATATGCAATTGG - Intronic
935829405 2:106985007-106985029 TAGAACAAGCAAAATGACATGGG + Intergenic
936997019 2:118426256-118426278 GTGAAGCAGCAAGATGAGATTGG - Intergenic
937113775 2:119388493-119388515 TTGGGGAAGCATACTGACATCGG - Intergenic
938994731 2:136666067-136666089 TTGGTGAAGCAAAATCACAGAGG - Intergenic
939265638 2:139869260-139869282 TTGGAGTAGCAAAGTGTAATAGG - Intergenic
939535073 2:143417414-143417436 TGGGGGAAGTAAAATGAGAGGGG + Intronic
939900182 2:147842186-147842208 TTTGGGAAGGAAAATGAGAAAGG - Intergenic
940127273 2:150340649-150340671 TTGGGGAAGTAAAAAGAGACAGG - Intergenic
940484647 2:154282059-154282081 TTTTAGAAGCAAACTGACATTGG + Intronic
940577673 2:155532150-155532172 TTAAAGAATGAAAATGAGATAGG + Intergenic
942282533 2:174380568-174380590 TTGAAAAAGCAACATAAGATGGG + Intronic
943851970 2:192735062-192735084 TTGTAGAAGTAAAATTAAATAGG - Intergenic
944834871 2:203569488-203569510 TTGGAGGAGCAAGAGGAAATAGG + Intergenic
945990404 2:216391423-216391445 TTGGTGAGGGAAAATGAGCTGGG - Intergenic
946658579 2:221975666-221975688 TTGGAGAGGAAAATTGAGAATGG - Intergenic
947251775 2:228114763-228114785 TAGGAGAAGAAAAATGAGAATGG - Intronic
947647350 2:231753161-231753183 CTGGAGGAGAAAAATGAGTTGGG - Intronic
948664135 2:239523954-239523976 TTCCAGAAGCAGAATGAGGTTGG + Intergenic
1169245637 20:4022363-4022385 TGGGAGGAGCAAAAGTAGATGGG - Intergenic
1170223872 20:13969566-13969588 TTGGCTAAGAAAAATAAGATTGG - Intronic
1171204211 20:23266618-23266640 TTTGGGAAGGAAAGTGAGATAGG + Intergenic
1172711333 20:36926686-36926708 TTTGAGAAGTAAAATTAGGTTGG - Intronic
1173445847 20:43117422-43117444 TTGGAACAGGAAAATAAGATTGG - Intronic
1173465112 20:43274445-43274467 TTGGAAATCAAAAATGAGATTGG - Intergenic
1174765766 20:53252633-53252655 TTGTAGATGCAAAATGCTATTGG - Intronic
1174853855 20:54024038-54024060 TTTTAGAAGTTAAATGAGATAGG - Intronic
1175538210 20:59730036-59730058 TATGAGAACCAAAAGGAGATGGG - Intronic
1177115126 21:17075821-17075843 TTGGAGAAGGGAAATGAGCATGG + Intergenic
1178206039 21:30467396-30467418 TTCCAAAAGGAAAATGAGATCGG + Intergenic
1179433234 21:41339997-41340019 TTTGAGAATCAATAGGAGATGGG + Intronic
1182938791 22:34254062-34254084 CTGGAGTACCAAAAGGAGATGGG - Intergenic
1185035324 22:48473213-48473235 TTGGAGGTCCAAACTGAGATAGG - Intergenic
951178562 3:19631343-19631365 ATGGAAAATCACAATGAGATAGG - Intergenic
952121354 3:30248708-30248730 TAGGAGAAGAAGAATGAGATAGG - Intergenic
952212611 3:31243732-31243754 TTTGAGAAGCAAAATGAAACTGG + Intergenic
953363936 3:42325633-42325655 TTGTAGAAGCAAAAGGAGAGAGG - Intergenic
954929415 3:54268352-54268374 TTAGTGAGGCACAATGAGATTGG - Intronic
954978307 3:54718616-54718638 TTGAAGAATCAAAATGATATTGG - Intronic
955167702 3:56530532-56530554 TTAAAGAAGCAAAGTGTGATGGG - Intergenic
955481350 3:59393731-59393753 TTGGGGAAGGAAAATGAAAAAGG - Intergenic
956697089 3:71927810-71927832 TTGGAGAAGCAAAGTGAAGATGG - Intergenic
956720406 3:72112569-72112591 TTGTAGAAGGAAAATGAGACTGG + Intergenic
957283711 3:78187833-78187855 TTGCAGAAGAAAAATGACTTAGG - Intergenic
957394882 3:79623721-79623743 TTGGAGTACCAGAAGGAGATGGG + Intronic
957933522 3:86912985-86913007 TTGGAGAAACAGAATGACACTGG + Intergenic
959381747 3:105649256-105649278 TTAGAGATTCAAAATGAGAGCGG - Intergenic
959385837 3:105705372-105705394 CTGGAGAAGAAAAAGGACATTGG - Intronic
959927930 3:111945717-111945739 AAGGAGAAGCAAAATAAGAGAGG - Intronic
960083595 3:113567443-113567465 GGAGAGAAGCAAAATGAGATAGG + Intronic
960413885 3:117360258-117360280 TTGGAGTACCAGAAGGAGATGGG + Intergenic
960462939 3:117959280-117959302 GTAGAGAAGAAAAGTGAGATTGG + Intergenic
960477111 3:118143898-118143920 TTGGAGTACCAGAAGGAGATGGG - Intergenic
960494828 3:118361384-118361406 TTGAGGAAGCAAAAAGTGATTGG + Intergenic
960603286 3:119479262-119479284 ATGGATGAGCAAAATGAGAAGGG - Intronic
962377130 3:134867635-134867657 TTGGTGATGGAAAATGGGATGGG + Intronic
963242781 3:143026045-143026067 TGGGAAAAGCAAAAGGATATTGG - Intronic
964018643 3:151979264-151979286 TTAGAGAAGAAAAATGAAAAAGG - Intergenic
964205555 3:154171010-154171032 TTGGAGAAGAGAAATGGGAGAGG + Intronic
964326804 3:155555743-155555765 TTAGGTAAGCAAAATGAGAAGGG - Intronic
964646502 3:158963697-158963719 AAGGAGAAGCAAAATTTGATGGG + Intronic
965073630 3:163948388-163948410 TTGGAGCAACAAAATGAAGTAGG + Intergenic
966241636 3:177760796-177760818 TTGGAGAAGGAAAAAGTGGTTGG + Intergenic
966790694 3:183666861-183666883 TTGGACAAGCAGATGGAGATGGG - Intronic
967035164 3:185643563-185643585 TGGGAGAAGCTAAACTAGATCGG - Intergenic
967453864 3:189658275-189658297 TTGGATAAGCAAATTAATATAGG + Intronic
967929681 3:194681702-194681724 TTAAAGAAGCAAAAAGAAATAGG + Intergenic
969871349 4:10106996-10107018 TTGGGGAAGAAGAATGAGATTGG + Intronic
969942574 4:10749068-10749090 CTGGGTAAGGAAAATGAGATAGG + Intergenic
970142846 4:13001293-13001315 TAGGAGAAGAAAAATGACCTAGG - Intergenic
970186936 4:13465661-13465683 AGGGAGAAGGAAAATGATATGGG + Intronic
970792993 4:19881156-19881178 TTGGAGAGGGAAAATAAGGTTGG - Intergenic
970968654 4:21956055-21956077 TTGGAAAAGAAAAAAGAAATAGG + Intergenic
971746298 4:30585857-30585879 TTGGAGTAGCTGAAAGAGATGGG - Intergenic
973543654 4:51959098-51959120 TTGAAGAAGCAAAATTAACTTGG + Intergenic
973722716 4:53741606-53741628 TTGGAGAAAGAAAACGAGAGAGG + Intronic
973930080 4:55783223-55783245 TTGAAGAAGTAAAAGGGGATTGG + Intergenic
974692764 4:65320458-65320480 TAGGAAAAACAAAATGAGAAAGG + Exonic
975690278 4:76956305-76956327 ATAGAGAAGGAAAATGAGACAGG + Intronic
975696711 4:77021234-77021256 GTGGAGACGCAAAATGTGAAGGG + Intronic
976920021 4:90428235-90428257 TTGGAGAGGGAAAAAGAGAAAGG - Intronic
978312920 4:107405641-107405663 ATGGAGGAGGAAAATGAAATAGG + Intergenic
979197681 4:117940348-117940370 TTGGAGTATCAGAAGGAGATGGG - Intergenic
979775594 4:124584595-124584617 TTGGAGTACCAGAAGGAGATGGG + Intergenic
980524739 4:133975115-133975137 TTGGATCAACAAAATGGGATTGG + Intergenic
981056076 4:140362889-140362911 TGGGAGAAGCAAACTGGGATGGG + Intronic
981135363 4:141205436-141205458 TTGGAAAGGCAAAATTAGAGAGG + Intronic
982383947 4:154780478-154780500 TTAGAGAATCAACATGAGCTAGG + Intergenic
982920134 4:161263660-161263682 GTGGAGATGAAAAATGAAATCGG - Intergenic
983734356 4:171039172-171039194 TTGGAAAAGCAAGAGGAGTTGGG - Intergenic
984625950 4:182008350-182008372 TTGGAGTACCAGAAGGAGATGGG - Intergenic
984677620 4:182568374-182568396 TTGGAGAAACAGAATGAGAAGGG + Intronic
985325832 4:188769039-188769061 TTGGAGTAGCAAAATAAGGCTGG + Intergenic
986019508 5:3788158-3788180 TTGGAGGAGCTAATTGAGACTGG - Intergenic
986878669 5:12142783-12142805 TTGGAGAAACAAAATGTCAGAGG + Intergenic
987568167 5:19620566-19620588 ATGAAGAAGCAGAATGAGAGAGG + Intronic
987778595 5:22401859-22401881 GTGGAGAAGGAAGAAGAGATTGG + Intronic
988193355 5:27967235-27967257 TTGAAGAAGTAAAGAGAGATAGG + Intergenic
988951074 5:36261140-36261162 TTGGAAAAGCAAAAGGGGTTGGG - Intronic
989554399 5:42775572-42775594 GGAGAGAAGCAAAATGATATAGG + Intronic
991636422 5:68710590-68710612 TTGGAGAAGGACAAGGAGAGGGG - Intergenic
992969951 5:82046169-82046191 TTGGAGAAGCAGGAAGAGGTAGG - Intronic
993776383 5:92003230-92003252 TTGGAAAAGCAAACTGCGCTGGG + Intergenic
994662212 5:102667618-102667640 CAGTAGCAGCAAAATGAGATTGG + Intergenic
994801010 5:104375745-104375767 ATGTAGAAAGAAAATGAGATAGG + Intergenic
994930231 5:106173244-106173266 TTGGAGAACAAACATGAGAGGGG - Intergenic
994943396 5:106354693-106354715 TGGGAGAAGAAAAATAATATAGG - Intergenic
995696605 5:114884976-114884998 TGGGAAAAGCAATATGAGAAAGG - Intergenic
995968143 5:117934687-117934709 TTCCAGAAGAAAAATGAGAGAGG + Intergenic
996247145 5:121278724-121278746 TTGCAGAAGCATAAACAGATTGG + Intergenic
996282793 5:121751675-121751697 TTGCAGAAGAAAAAGGAGAGAGG + Intergenic
996518083 5:124395653-124395675 TTTGAGAAGCAGAGTGAGCTGGG - Intergenic
997218236 5:132132968-132132990 AGGGAGAAGGAAAATGATATAGG - Intergenic
997903423 5:137790042-137790064 TTGGAGAAGAAAAACAAGCTAGG + Intergenic
998466224 5:142346370-142346392 TTAGAAATGCAAAATGAGGTGGG + Intergenic
998650668 5:144118120-144118142 TTGGAGGAGAAAACTGAGATGGG - Intergenic
999187617 5:149724401-149724423 TGGGAGCAACAAAATTAGATAGG - Intergenic
999325002 5:150638464-150638486 ATGGTGAAGCAAAATGTGAAGGG + Intronic
999528167 5:152431105-152431127 TTGGAGATGCAAACTTATATGGG + Intronic
1001869845 5:175142463-175142485 TGGGAGAAGGAAAATGACATAGG + Intergenic
1002610436 5:180414320-180414342 TTTGAAAAGTAAACTGAGATTGG + Intergenic
1002815024 6:671560-671582 AGGGAGAAGCAAAATGATATAGG - Intronic
1002969701 6:2001982-2002004 TTGATGAAGCAAAATAAAATTGG - Intronic
1002971603 6:2028340-2028362 TTGCAGAAGCTAAATGATTTAGG - Intronic
1003093251 6:3121991-3122013 ATGTAGAAGAAAAAGGAGATGGG + Intronic
1003686942 6:8313943-8313965 TTGGAGTACCAGAAGGAGATGGG - Intergenic
1004355389 6:14925808-14925830 TTGGGTAAGCCAAATGGGATCGG + Intergenic
1004659087 6:17693973-17693995 GCTGGGAAGCAAAATGAGATGGG - Intronic
1004804305 6:19185346-19185368 TTGAAGAAGCACACTGAGAAAGG + Intergenic
1004929488 6:20448096-20448118 CTGGACAAGGAAAATGGGATTGG - Intronic
1005210602 6:23455959-23455981 TTCTTGGAGCAAAATGAGATTGG + Intergenic
1005354102 6:24966039-24966061 TTAGAAAAACAGAATGAGATTGG + Intronic
1005665892 6:28053973-28053995 TTGGAGAAGAAAAAATACATAGG + Intergenic
1005725956 6:28648990-28649012 TTGAAGAACCAAAATGAGGAAGG - Intergenic
1006251022 6:32785253-32785275 TTAGAAAAGCAAAGTGGGATGGG - Intergenic
1007183383 6:39947023-39947045 ATTGATTAGCAAAATGAGATGGG - Intergenic
1007197023 6:40071081-40071103 TTGGATGAACAAAATCAGATGGG - Intergenic
1008125082 6:47659018-47659040 TTGGACAAGAAGAAAGAGATGGG - Exonic
1008703386 6:54128696-54128718 TGGGAAAACCAAAATGAGATGGG + Intronic
1008773485 6:55007997-55008019 TTGGAGTACCAGAAGGAGATGGG - Intergenic
1009197211 6:60701665-60701687 TTGGAGAAATAACATCAGATTGG + Intergenic
1010073603 6:71773390-71773412 TTGGAGAAGCAGAAGGGGAAAGG - Intergenic
1010289216 6:74115964-74115986 CTGAAGAAGGAAAAAGAGATTGG - Intergenic
1010483067 6:76378071-76378093 TTGGAGTACCAATAGGAGATGGG - Intergenic
1010857816 6:80863861-80863883 ATAGAGAAGAAAAATGAGATAGG + Intergenic
1011159662 6:84374757-84374779 TTGAAGAAGCTGAAGGAGATGGG - Intergenic
1011493986 6:87920826-87920848 TTGGAGAATCAATATGATCTAGG - Intergenic
1012425922 6:99114322-99114344 TGAGAGAGGCAAAAGGAGATAGG - Intergenic
1013461683 6:110380105-110380127 TTGGAGTACCAGAAAGAGATAGG + Intergenic
1014697978 6:124647697-124647719 GTAGGGAAGCAAAATGATATTGG + Intronic
1015358343 6:132306388-132306410 TTGGAGTACCAGAAGGAGATGGG + Intronic
1015884172 6:137899406-137899428 TTGGAGATGCAAAAGTAAATAGG + Intergenic
1017359879 6:153555353-153555375 TTGGAGAAGGAAAAGGAAACTGG - Intergenic
1017605021 6:156124472-156124494 TTGGGGAAACAAAAGAAGATAGG + Intergenic
1018570274 6:165202781-165202803 TTGGAGAAAAAAAAAGAGATAGG + Intergenic
1019113373 6:169736930-169736952 TTGGAGTAGCAGAAGGAGATGGG - Intergenic
1020673354 7:11147952-11147974 TGGGAGAAGTAAATTGTGATGGG - Intronic
1021432672 7:20578723-20578745 TGGGAGAAGCTGAATGAGAAAGG - Intergenic
1021578891 7:22131225-22131247 TTGGAGAGGCAATTTGAAATTGG + Intronic
1021613442 7:22479248-22479270 TGGAAGAAACAAAAGGAGATAGG + Intronic
1021842421 7:24731738-24731760 TTTGATTAGCAAAATGGGATCGG - Intronic
1022551302 7:31242024-31242046 GGGGAGAAGAGAAATGAGATAGG + Intergenic
1023213021 7:37829065-37829087 TGGGGGAATCAAAGTGAGATGGG - Intronic
1023276574 7:38525400-38525422 TGGGAGAAGCTGAATAAGATGGG - Intronic
1023363548 7:39440299-39440321 CTGGAGTACCAGAATGAGATAGG - Intronic
1024678873 7:51662415-51662437 TGGGAGAAGCAAACTGAGCTGGG + Intergenic
1024960768 7:54972184-54972206 AGGGAGAGGAAAAATGAGATTGG - Intergenic
1025767674 7:64471763-64471785 TTGGAAAAACAAAATTAGCTGGG + Intergenic
1026015863 7:66670053-66670075 TTTAAGAAGGAGAATGAGATGGG - Intronic
1026050756 7:66944585-66944607 TTGTAGTTGCAAAATGAGTTTGG + Intronic
1026935265 7:74251147-74251169 TTTGAGAAACAAAAAGAGTTTGG - Intronic
1027744478 7:82056335-82056357 TTGGAGAAGCAACATGAGGATGG + Intronic
1027978105 7:85184972-85184994 TCGGAGAAGGAAAAGGAGAAGGG + Intronic
1028038346 7:86015222-86015244 TTGAAGAGGCAAAATGGCATGGG + Intergenic
1028338684 7:89691128-89691150 TTGAAGAGGCAAAAAGGGATGGG + Intergenic
1028421946 7:90642957-90642979 CTGGAGATGCAAAGTGAGAAAGG + Intronic
1030883543 7:114911838-114911860 TTTGAGAAGTAAAATGGGTTTGG - Intergenic
1030897696 7:115082250-115082272 TAGGAGAAACAAAAAGAGAATGG + Intergenic
1031279382 7:119777622-119777644 AGGGAGAAGAAAAATGACATAGG + Intergenic
1031804741 7:126293884-126293906 TTGGAGTACCAAAAGGAGACAGG + Intergenic
1031806550 7:126314891-126314913 TTGGAGAAGCATGAATAGATTGG + Intergenic
1031939786 7:127776199-127776221 TGGGATGAGCTAAATGAGATGGG + Intronic
1033823865 7:145165492-145165514 TTGGAGAAGCAACATTTCATAGG - Intergenic
1033870780 7:145751499-145751521 TTGGAGGGGCAAGATGAGACTGG + Intergenic
1034132692 7:148735113-148735135 TTTGAGAATGAGAATGAGATTGG + Intronic
1036223456 8:6939758-6939780 ATGTAGAGGCAAAATGAGAAGGG + Intergenic
1036236327 8:7042501-7042523 ATGTAGAGGCAAAATGAGAAGGG + Intergenic
1037103038 8:15071736-15071758 TGGGAGTAGCATAATCAGATGGG + Intronic
1037350862 8:17953988-17954010 GTGGAAAAGGAAAAGGAGATAGG - Intronic
1037378490 8:18258708-18258730 TGGGAGAAGGATAGTGAGATGGG + Intergenic
1038029316 8:23623174-23623196 ATGGAAAGGGAAAATGAGATAGG + Intergenic
1039027500 8:33273513-33273535 TTGTAAAAGCAAAATGAGAAAGG + Intergenic
1039327092 8:36497450-36497472 TCAGAGAAGAAAAATGAGAAAGG + Intergenic
1039685768 8:39800642-39800664 TTGGAGTATCAGAAGGAGATGGG - Intronic
1039695605 8:39907122-39907144 ATGGAGAAAAAAAATGATATAGG + Intronic
1040855152 8:51941462-51941484 TTGGGGAAACATAATGAGTTTGG - Intergenic
1041318337 8:56587621-56587643 TTGGAGAACCAACATGAGAAAGG + Intergenic
1042467707 8:69147184-69147206 TTGGAGAAAAAAAATAATATCGG - Intergenic
1043090610 8:75897722-75897744 ATACAGAAGCTAAATGAGATTGG - Intergenic
1043106623 8:76121427-76121449 TTGGAAATGCAAAATGAGCTGGG + Intergenic
1043211056 8:77518505-77518527 TTGAAGAATGAAAATGAGAGAGG + Intergenic
1044048570 8:87469772-87469794 TTGGAGTGCCAAAAAGAGATGGG + Intronic
1044176630 8:89132805-89132827 CTAGAGAAGCAATATGACATAGG - Intergenic
1044274857 8:90287266-90287288 TTTGAAAAGCAAAATAAAATAGG - Intergenic
1045186862 8:99846913-99846935 TAGGAAAAGGAATATGAGATGGG + Intronic
1045265454 8:100614941-100614963 CTGGGGAAGCAAAGTGAGAATGG + Intronic
1045326387 8:101120718-101120740 TTTGAGAAGCAAAATGAAAAAGG - Intergenic
1046376785 8:113393604-113393626 CTGGAGAAGGAAAATGAGAAAGG + Intronic
1046860374 8:119085082-119085104 TTGGATGAGAAAACTGAGATTGG + Intronic
1047554413 8:125913682-125913704 GTGGAGAACCAAAATGATATGGG + Intergenic
1047564983 8:126034308-126034330 TTGGAAAAGCCAAATGCAATGGG - Intergenic
1047838652 8:128722114-128722136 TTGAAGAAACAGAATGAGAGTGG - Intergenic
1048079187 8:131106447-131106469 ATGGAGAAGCAATAAGAGAAGGG - Intergenic
1048155851 8:131950234-131950256 CTGAAGTAGCAAAATGAGAATGG + Intronic
1048289148 8:133166717-133166739 TTTGATCAGCAACATGAGATTGG + Intergenic
1048711520 8:137217152-137217174 TTGGAGAATAAACCTGAGATGGG - Intergenic
1048787603 8:138066961-138066983 TTGGAGAAGCAGAAGCAGAAGGG + Intergenic
1048849977 8:138635801-138635823 TTGGAAAAACAAAATGTGTTTGG - Intronic
1050494753 9:6229274-6229296 TTGAAGAAGCAAAGGTAGATTGG - Intronic
1051611838 9:18968910-18968932 TTAGAGAAGCATAATAAGGTAGG + Intronic
1051936085 9:22444667-22444689 TTGGTGAACCAAAATTAGATTGG - Intergenic
1052781656 9:32787294-32787316 TGGGAGAAGAAACATGAAATAGG - Exonic
1055433906 9:76272881-76272903 TTGGAGAAGCAAGAAGAGGCAGG - Intronic
1055935466 9:81600460-81600482 TTTAAAAAGAAAAATGAGATGGG - Intronic
1056128260 9:83558364-83558386 TTGGAGAAGTAAAGTGAAAATGG + Intergenic
1058448085 9:105071463-105071485 TAAGTGAAGAAAAATGAGATGGG - Intergenic
1058642940 9:107104825-107104847 TTGCAGAAGGAAGTTGAGATGGG + Intergenic
1060733750 9:126053414-126053436 AAGGAGAAGGAAATTGAGATGGG - Intergenic
1060926456 9:127458831-127458853 TTTGAGAAGGAAAATGAGGCGGG + Intronic
1060989795 9:127841892-127841914 TTGGAGAAGGAAACTGAGGCTGG - Intronic
1185846121 X:3439838-3439860 TTGGAGTACCAGAAGGAGATGGG - Intergenic
1185928009 X:4168927-4168949 CTGGAGAAAGAAAATGCGATTGG - Intergenic
1187877445 X:23816029-23816051 TTGGGGAAGCCAGATAAGATGGG - Intergenic
1187909415 X:24097062-24097084 TTGAAGAAGGTAAATGAGAGGGG + Intergenic
1188169045 X:26899069-26899091 TTTAAGAATAAAAATGAGATTGG - Intergenic
1188347350 X:29083351-29083373 TTGGTCAATCAAATTGAGATAGG - Intronic
1188643471 X:32535403-32535425 TTGGAGAAGAAAAAAGACCTTGG - Intronic
1188811099 X:34655866-34655888 TTGAAGAATCAAAATTAGAAAGG + Intronic
1189189391 X:39085944-39085966 TTGGATAAGCTAGATGAAATGGG + Intergenic
1189733912 X:44049732-44049754 TTTGAGAAAGAAAATGTGATGGG + Intergenic
1191976238 X:66874708-66874730 AGGGAGAAGCAAGGTGAGATTGG + Intergenic
1193048230 X:77075728-77075750 TTGGAGTAACAGAAGGAGATGGG - Intergenic
1193922122 X:87442086-87442108 TTGGAGCTGAAAAATGAAATTGG - Intergenic
1194828936 X:98596931-98596953 GTGCAGAAGCAAAATGTGTTGGG - Intergenic
1196639977 X:118047745-118047767 TGTGAGAAGGAATATGAGATGGG + Intronic
1197592468 X:128425420-128425442 GTAAAGAAGAAAAATGAGATAGG + Intergenic
1198465644 X:136902474-136902496 TGGGAGAAGCATATTTAGATTGG + Intergenic
1199247831 X:145626828-145626850 TTGGAGCTGAAAAATGAAATAGG + Intergenic
1200371904 X:155736308-155736330 AGGGAGAAGGAAAATGATATAGG - Intergenic
1201479076 Y:14418056-14418078 TTGGAGAACAAATATGAGAAGGG + Intergenic
1201613167 Y:15865750-15865772 TTGGAGAATGAGAATGAGCTTGG - Intergenic