ID: 1135861957

View in Genome Browser
Species Human (GRCh38)
Location 16:26064344-26064366
Sequence CTTAGGGTATAGAGGGTAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 119
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 107}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1135861947_1135861957 24 Left 1135861947 16:26064297-26064319 CCCTATCCAAAAAAAAAGTTTCC 0: 1
1: 0
2: 10
3: 121
4: 870
Right 1135861957 16:26064344-26064366 CTTAGGGTATAGAGGGTAGAAGG 0: 1
1: 0
2: 1
3: 10
4: 107
1135861949_1135861957 18 Left 1135861949 16:26064303-26064325 CCAAAAAAAAAGTTTCCAATGCT 0: 1
1: 0
2: 1
3: 41
4: 374
Right 1135861957 16:26064344-26064366 CTTAGGGTATAGAGGGTAGAAGG 0: 1
1: 0
2: 1
3: 10
4: 107
1135861948_1135861957 23 Left 1135861948 16:26064298-26064320 CCTATCCAAAAAAAAAGTTTCCA 0: 1
1: 0
2: 3
3: 50
4: 593
Right 1135861957 16:26064344-26064366 CTTAGGGTATAGAGGGTAGAAGG 0: 1
1: 0
2: 1
3: 10
4: 107
1135861950_1135861957 3 Left 1135861950 16:26064318-26064340 CCAATGCTGTCTTAATGTCCAAG 0: 1
1: 0
2: 0
3: 11
4: 151
Right 1135861957 16:26064344-26064366 CTTAGGGTATAGAGGGTAGAAGG 0: 1
1: 0
2: 1
3: 10
4: 107

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1135861957 Original CRISPR CTTAGGGTATAGAGGGTAGA AGG Intronic
902711423 1:18242663-18242685 CATAGAGTAAAGAGGGTTGAAGG - Intronic
904793947 1:33044843-33044865 CTTAGGGAAGAGAGGGAAGAAGG + Intronic
905726316 1:40254712-40254734 TTTAGGTTAGACAGGGTAGATGG + Intergenic
909389050 1:75096701-75096723 CTTTAGGTATAAAGGGGAGAGGG - Intergenic
909924294 1:81420718-81420740 CTTAGGGTCTAAAGGCCAGATGG + Intronic
911655135 1:100435229-100435251 AGTAGTGTTTAGAGGGTAGAAGG + Intronic
917135718 1:171786441-171786463 CTGAGGGTATAAATGGAAGAGGG + Intronic
919019285 1:192083675-192083697 CTTACGGTATAGAGTGGAGCAGG + Intergenic
919548359 1:198951673-198951695 TTTGGGGAATGGAGGGTAGAGGG - Intergenic
920658931 1:207898727-207898749 TTTAGGGAATAGAGAGTAAACGG - Intronic
920834346 1:209494964-209494986 CTTAGGGTATATAAGCCAGAGGG + Intergenic
923369338 1:233295274-233295296 CTGTGGGTATGGAGGGAAGAAGG - Intronic
1063038614 10:2314760-2314782 CTCAGGGGATAGAGAGAAGAGGG + Intergenic
1066700646 10:38124280-38124302 CTGAACTTATAGAGGGTAGAAGG + Exonic
1068202686 10:53803285-53803307 CTTAAGGTATAAAGTGCAGAAGG + Intronic
1070845082 10:79515167-79515189 GTTAGGGTGTAGAGAGGAGAAGG + Exonic
1070928719 10:80245142-80245164 GTTAGGGTGTAGAGAGGAGACGG - Intergenic
1071176837 10:82936443-82936465 CATAGGGTTTAGGGGGAAGATGG + Intronic
1071488993 10:86123251-86123273 CCTAGGGAACAGAGGGCAGAGGG + Intronic
1074481604 10:113826866-113826888 CTCAGGCTAGAAAGGGTAGATGG - Intergenic
1076097393 10:127742983-127743005 CTTTAGGTATGGAGGGTAGGGGG - Intergenic
1080921738 11:36715977-36715999 CTTGGGGTATAGAGTGGAGTAGG + Intergenic
1083599512 11:63938332-63938354 CTCAGGGTTTAGAGGGGAGACGG - Intergenic
1086816947 11:91383671-91383693 CTAAGAGTATAGTTGGTAGAAGG + Intergenic
1087491766 11:98837075-98837097 CTGAGGGTGTGGAGGGTGGAGGG - Intergenic
1092103958 12:5907823-5907845 CTTAGGGTATGGAGAGTGAAGGG - Intronic
1096095453 12:48932601-48932623 CTTAGGTTATAGATAGGAGATGG - Intronic
1097743821 12:63277137-63277159 TTTAGGGTACAGGGGTTAGAAGG + Intergenic
1100644714 12:96516547-96516569 CTTAGGGAATAGAGGGCGGTCGG + Intronic
1102131991 12:110538884-110538906 ATAAGGGAATAGAGAGTAGAAGG - Intronic
1103015955 12:117494746-117494768 CTTATTGGATAGAGAGTAGATGG + Intronic
1107821196 13:44287135-44287157 CTCAGGGTATTGAGGGTGGATGG + Intergenic
1114376645 14:22153518-22153540 CTATGGACATAGAGGGTAGAAGG + Intergenic
1117574227 14:57082058-57082080 CTTAGTGTATGGATAGTAGATGG + Intergenic
1117995857 14:61477837-61477859 ACAAGGGTATAGAGGGTCGAAGG - Intronic
1122625276 14:103082337-103082359 GTTGGGGTATTGATGGTAGATGG + Intergenic
1127217044 15:56834207-56834229 CTCAAGGTACAGAGGCTAGAAGG + Intronic
1127987239 15:64083329-64083351 CTTAGGGTTTGGAGGTCAGAAGG - Intronic
1129282512 15:74497100-74497122 CTTAGGATATAAAGGATACAGGG - Intergenic
1135171417 16:20187275-20187297 CTTAGGGCTGAGAGGGTGGAGGG - Intergenic
1135861957 16:26064344-26064366 CTTAGGGTATAGAGGGTAGAAGG + Intronic
1140520285 16:75575172-75575194 CTTAGGGGGCAGTGGGTAGAGGG - Intronic
1141665211 16:85462348-85462370 CTGAGGGTAGGGAGGGTGGAGGG - Intergenic
1142265847 16:89063668-89063690 CTTACGGTGCAGAGGGGAGATGG - Intergenic
1143425249 17:6831283-6831305 CTTAGGGTAGAGATGGGAGTGGG - Intronic
1144094384 17:11886709-11886731 CTTAGGGGATGGAGTGAAGAGGG - Intronic
1146603320 17:34236747-34236769 GTTGGGGTATAGTGGGTTGATGG - Intergenic
1155391473 18:25342018-25342040 CCTAGAGTACAGAGGGTAAATGG + Intronic
1155868247 18:30993054-30993076 CCTAGAGTTTAGAGGCTAGAGGG - Exonic
1157328079 18:46683518-46683540 CTGAGGGCAGAGAGGGAAGAAGG + Intronic
1157728728 18:49985738-49985760 CTTAGGGTTTTCAGGGAAGAGGG - Intronic
1159210812 18:65318938-65318960 CATAGGGTAGATAGGGAAGATGG - Intergenic
1159832425 18:73293718-73293740 CTCATGGCATAGAGAGTAGAAGG + Intergenic
1162824436 19:13243064-13243086 CTTTGGGTCAAGAGGTTAGAAGG - Intronic
1163383748 19:16986249-16986271 CTCAGGGCATGGAGGGAAGATGG - Intronic
1164740542 19:30572451-30572473 GTTAGGGAGTGGAGGGTAGAGGG - Intronic
925581195 2:5413370-5413392 CTCCAGGTATAGAGGGTACAGGG - Intergenic
926849361 2:17178087-17178109 CCTAGGGTGGAGAGGGTAGAAGG - Intergenic
928873743 2:36012521-36012543 ATTAAGTTATAGAGGGTAGAAGG - Intergenic
931589860 2:63871200-63871222 ATTAGGGGAGAGGGGGTAGAAGG - Intronic
933206104 2:79510505-79510527 CATAGGGTAGACAGGGTTGAGGG + Intronic
936053147 2:109240769-109240791 CTCAGGGTCTAGAGAGGAGAAGG - Intronic
937339164 2:121079968-121079990 CTGAGGGTCTGGAGGGTAGGAGG + Intergenic
937795802 2:126018892-126018914 CTTAAGGTCTAGAGGAAAGATGG - Intergenic
940739793 2:157494007-157494029 GTTAGGCTTTAGAGGCTAGATGG - Intergenic
941273244 2:163457150-163457172 CTGAGGGTAAAGAGAGAAGAGGG - Intergenic
942050698 2:172137819-172137841 CTTAGGGAATGGAGTTTAGAAGG - Intergenic
943499173 2:188665849-188665871 CTTAAAGTCTAGAGGGTAGAAGG + Intergenic
948094103 2:235320024-235320046 CCTGGGGTAGAGAGGGGAGAGGG - Intergenic
948127727 2:235576989-235577011 TTTGGGGTATGGAGGGAAGATGG - Intronic
1173377053 20:42495317-42495339 CCTAGAGAAGAGAGGGTAGAGGG - Intronic
1178120475 21:29464882-29464904 CTTAGGGTATTGAGGCTAGCTGG + Intronic
1181685737 22:24526755-24526777 GTCAGGGTAAAGAGGGTAGTTGG + Intronic
1182319239 22:29467567-29467589 CTTAGGGCATAGAGGATGGGTGG + Intergenic
950551526 3:13669100-13669122 CCTAGGGCATAGAGCCTAGAAGG + Intergenic
959780157 3:110221873-110221895 TTTAGGGTATGCAGGGTAAATGG + Intergenic
960966812 3:123111231-123111253 CTCTGGATAAAGAGGGTAGAAGG - Intronic
961325716 3:126108239-126108261 CTCAGGGTCTAGAGGGGACAGGG - Intronic
965997201 3:174898287-174898309 CTCATGATATAGAGAGTAGAAGG + Intronic
969060281 4:4428610-4428632 CTTTGAGACTAGAGGGTAGAAGG - Intronic
970662988 4:18306948-18306970 CTTAGGAGAGAGAGAGTAGATGG - Intergenic
975914919 4:79312930-79312952 CTTAGGTCATAGAGAGTAAAAGG + Intronic
977711033 4:100125834-100125856 CATAGGGAAGAGAGGGGAGAAGG + Intergenic
978113932 4:104996407-104996429 ACTAGGGTATTGAGGGAAGAAGG + Intergenic
979645491 4:123062321-123062343 CATATGGTATATAGTGTAGAAGG - Intronic
981812631 4:148793026-148793048 CTAAGGGGATAGGGGATAGAGGG + Intergenic
984653519 4:182293431-182293453 CTTACAGTAAAGAGGGTGGAAGG + Intronic
990674653 5:58169946-58169968 CTTAGGGTTGAGATGGGAGAGGG - Intergenic
999361257 5:150988541-150988563 CTTAGGTTGGAGAGGGGAGAAGG + Intergenic
1001557610 5:172647233-172647255 CTTAGAGCAGAGAGGGAAGAGGG + Intronic
1003640983 6:7874826-7874848 GTTAGGGCATAGAGAGTACAGGG - Intronic
1006519534 6:34563317-34563339 CTGAGGGTAGGGAGGGTAGTGGG + Intergenic
1006938862 6:37738116-37738138 GTTAGGGTTTGGAGGGTGGATGG + Intergenic
1007027351 6:38589886-38589908 CTTAAGGTAGAGAAGGAAGAAGG - Intronic
1008858552 6:56121170-56121192 CTCATGGCATAGAGGGTAGAAGG + Intronic
1009933666 6:70206896-70206918 CTTAGGCTACAGAGGACAGAAGG + Exonic
1012827024 6:104159248-104159270 CTTTGGGTAGGGAGGGTAGAGGG + Intergenic
1014140041 6:117930981-117931003 ATAAGGGTATAGAGGCTAAAAGG - Intronic
1014450743 6:121578536-121578558 ATTAGGGAATAGAGGGTGGAGGG + Intergenic
1015503789 6:133960675-133960697 CTTTGGGTATAGAGGAAAAATGG + Intronic
1030292093 7:107883099-107883121 CTTAGGGAAAAGAGGGTAAGAGG - Intergenic
1032425069 7:131815969-131815991 CCTGGGGAATAGAGGGCAGAGGG - Intergenic
1033765082 7:144480527-144480549 ATTAGGGAATGGAGTGTAGAGGG + Intronic
1033921017 7:146391833-146391855 TTTGGAGGATAGAGGGTAGAAGG + Intronic
1037771479 8:21802758-21802780 ATTATGGTATAGTGGGGAGAAGG + Intronic
1046009398 8:108528138-108528160 ATTTGGGTATAGAAAGTAGAGGG - Intergenic
1048732973 8:137464270-137464292 CTGAGAGTAAAGATGGTAGAAGG + Intergenic
1049095207 8:140544601-140544623 CAGAGGGAGTAGAGGGTAGAAGG - Intronic
1050980726 9:12010944-12010966 CTAAGAATATAGAGGATAGAAGG + Intergenic
1054997117 9:71404772-71404794 ATTAGGGCATAGAAGTTAGAGGG - Intronic
1060077111 9:120601764-120601786 CCTAGGGGATAGAGGGTAGAGGG + Exonic
1061152044 9:128834315-128834337 CCCTGGGTATAGAGGGCAGAGGG + Intronic
1188318957 X:28711537-28711559 ATTAAGGGATTGAGGGTAGATGG + Intronic
1190248797 X:48707294-48707316 CTCATGGTATAAAGGGTAGTGGG + Intronic
1190857968 X:54315983-54316005 TTGAGGGTCTAAAGGGTAGACGG - Intronic
1191767894 X:64720311-64720333 CTTAGAGTGAAAAGGGTAGAGGG - Intergenic
1194788141 X:98112326-98112348 CTTTGGGTATAAAGCTTAGAGGG + Intergenic
1195588569 X:106597224-106597246 ATTAGGGGGTGGAGGGTAGATGG + Intergenic
1196251326 X:113463515-113463537 TTATGGGGATAGAGGGTAGAAGG - Intergenic