ID: 1135862240

View in Genome Browser
Species Human (GRCh38)
Location 16:26067274-26067296
Sequence CTGATTCAGAACTTCTCTCT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 864
Summary {0: 1, 1: 0, 2: 2, 3: 29, 4: 832}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1135862240 Original CRISPR CTGATTCAGAACTTCTCTCT AGG (reversed) Intronic
901095984 1:6680334-6680356 CAGATACAGAGCTTCTGTCTGGG - Intronic
903001601 1:20270082-20270104 CAGATTCTGATCTTCTCTGTAGG + Intergenic
903312824 1:22473215-22473237 CTGATTCAGAAGTTCTGGGTGGG - Intronic
906001316 1:42428424-42428446 TTGTTTTAGAACTTCTCTTTTGG + Intergenic
909588420 1:77317833-77317855 CTAATTCAGTAATTCTCTCAGGG - Intronic
911114115 1:94226184-94226206 ATGTTTCAGAACTTATCACTAGG + Intronic
915775117 1:158474602-158474624 CTGATTCATAACATCTTTATTGG - Intergenic
918130883 1:181628182-181628204 CTGATTCAGGACTGATCACTGGG + Intronic
918905471 1:190486943-190486965 CTTATTCAGCACTTTTTTCTAGG - Intergenic
919153902 1:193735935-193735957 CTGGCTCAGTAGTTCTCTCTGGG + Intergenic
920912441 1:210231945-210231967 TTAATTCATAACTTCTGTCTAGG - Intergenic
923247473 1:232146583-232146605 CTGAATACGAACTTCACTCTTGG + Intergenic
923295442 1:232590560-232590582 CTGATTCAGACCCTAGCTCTCGG + Intergenic
1064079502 10:12297007-12297029 CTGATTCAAAACTTCTGGGTTGG + Intergenic
1064638650 10:17393592-17393614 CTGTGTCAGATCTCCTCTCTGGG - Intronic
1066104259 10:32143117-32143139 CTTATTTAGAGCTTATCTCTGGG + Intergenic
1066681002 10:37937063-37937085 ATGTTGCAGAATTTCTCTCTGGG + Intergenic
1066708250 10:38204054-38204076 CTGATTCAGGCCTTGGCTCTTGG + Intergenic
1067841264 10:49681183-49681205 CTGATTCAGCACCTCTGTCTAGG - Intronic
1068136353 10:52953853-52953875 ATGTTGCAGAATTTCTCTCTAGG - Intergenic
1069443025 10:68446368-68446390 CTGGATCAGCTCTTCTCTCTTGG + Exonic
1069492720 10:68875133-68875155 CTGTGTCAGACCTTCTCTCAGGG + Intronic
1073276126 10:102313065-102313087 CCCATTCAGAACTACTTTCTTGG - Intronic
1073494817 10:103881295-103881317 CTGATTCTGAACTCCTTCCTGGG + Intergenic
1074138486 10:110649491-110649513 CTACTTCTGAACTTCTCTTTTGG - Intronic
1075257100 10:120934016-120934038 CTGGTCCAGAACTTTTCACTAGG + Intergenic
1075861446 10:125680206-125680228 CTGAGTCAACACTTCCCTCTCGG + Intronic
1076056701 10:127380647-127380669 GTGATTGAGCCCTTCTCTCTTGG + Intronic
1076638657 10:131899940-131899962 CGGAATCAGAACTTCTTTCAGGG - Intergenic
1078505228 11:11935042-11935064 ATGAATCAGAATTTCTCTGTTGG + Intronic
1079243716 11:18738484-18738506 CTGAGTCTGAACTTCTCTCCTGG + Intronic
1080702417 11:34655185-34655207 CTGGTTAAGAATTTCTCTCCTGG - Intronic
1081299359 11:41431691-41431713 CTTATTCAGAGCTTCTCTTGAGG + Intronic
1082695442 11:56358097-56358119 CTTCTTCATAACTTCTGTCTTGG - Intergenic
1085876248 11:80409239-80409261 GTGATTCTGAAATTTTCTCTTGG - Intergenic
1086263622 11:84971733-84971755 CTGATTTTGAAGTTTTCTCTAGG - Intronic
1087153318 11:94877924-94877946 GGGATTGAGAACTTCTCTCCTGG - Intergenic
1087930169 11:103967838-103967860 TTGATTCTAACCTTCTCTCTAGG + Intronic
1089776230 11:120838201-120838223 CTGAGTCAGGACTTGACTCTGGG - Intronic
1091846039 12:3657012-3657034 CTGCTTCAGCACCTCTCTGTGGG - Intronic
1092575609 12:9779239-9779261 ATTATTTAGATCTTCTCTCTTGG + Intergenic
1093045763 12:14442416-14442438 CTGATTCTGCCCTTCACTCTGGG + Intronic
1093748621 12:22772444-22772466 CTGACTGAGAGCTTCTATCTTGG + Intergenic
1094082162 12:26548732-26548754 CTGAGACAGAACTGCTCCCTTGG - Intronic
1098752180 12:74308384-74308406 CTAATTCTGAACCCCTCTCTTGG + Intergenic
1099318083 12:81109682-81109704 CTGCTCCAGAACTTCTTTATAGG - Exonic
1102094788 12:110229157-110229179 CCAATTTAGGACTTCTCTCTAGG + Intergenic
1102275943 12:111581864-111581886 CTGATAGAGAACTTGGCTCTGGG - Intronic
1105325909 13:19370573-19370595 TTGATTCAGACCTTCTCTCAAGG - Intergenic
1105867598 13:24474521-24474543 TTGATTCAGACCTTCTCTCAAGG + Intronic
1106235121 13:27854774-27854796 ATGACTCAGCACTTCACTCTTGG - Intergenic
1106385569 13:29282234-29282256 CAGAGGCAGCACTTCTCTCTGGG - Intronic
1108770515 13:53694855-53694877 CTAATTCATATCTTCTCTCTGGG + Intergenic
1108944963 13:56010815-56010837 CTGATTCAGAAATTCTGTGGTGG + Intergenic
1110024247 13:70513642-70513664 CTGAACTCGAACTTCTCTCTAGG - Intergenic
1110200832 13:72848543-72848565 ATGATTAAGAACTTAACTCTTGG + Intronic
1112994521 13:105556824-105556846 GAGATTGAGAACCTCTCTCTGGG - Intergenic
1115468116 14:33738412-33738434 CTGATTGAGACCTTCCCTCTGGG + Intronic
1115711076 14:36051334-36051356 CTGATTTAGAGTTTCTCTTTTGG + Intergenic
1117713252 14:58554557-58554579 CTCATGCAGATTTTCTCTCTAGG - Intergenic
1118454950 14:65937079-65937101 CTGGTACAGAATTTCTTTCTGGG + Intergenic
1119973389 14:78998037-78998059 ATGATGCAGAAATTCTCTCCAGG + Intronic
1120611519 14:86646847-86646869 CTGATTAAGAGCCTATCTCTTGG + Intergenic
1120687403 14:87554157-87554179 CTGATTCAGAATTTCACTGCTGG + Intergenic
1121917930 14:97853318-97853340 CAGAGTCAGAATTTCTTTCTTGG + Intergenic
1122246506 14:100406951-100406973 GGGATTCAGAATTGCTCTCTGGG + Intronic
1124171746 15:27380649-27380671 CTTATTAAGAACAACTCTCTAGG - Intronic
1125375764 15:39027694-39027716 CAGATGCAGAAGTTATCTCTTGG + Intergenic
1126790120 15:52213187-52213209 CTCATTCAGAACCTCATTCTTGG - Exonic
1128583785 15:68829335-68829357 CTTAGTCACAATTTCTCTCTTGG - Intronic
1130612629 15:85375350-85375372 CTGATACAGAGCCTCTATCTAGG - Intergenic
1134514039 16:14872515-14872537 CTGATTCAGAAATTACCTGTGGG + Intronic
1134701681 16:16271014-16271036 CTGATTCAGAAATTACCTGTGGG + Intronic
1134970149 16:18523636-18523658 CTGATTCAGAAATTACCTGTGGG - Intronic
1135862240 16:26067274-26067296 CTGATTCAGAACTTCTCTCTAGG - Intronic
1139491429 16:67288158-67288180 CTTATGCAGAAGTTCGCTCTCGG + Exonic
1140479157 16:75253261-75253283 CTGGTTCAGACCTGCTCTCTGGG - Intronic
1142980289 17:3667679-3667701 CTGGCTGAGCACTTCTCTCTGGG + Intronic
1146705148 17:34995863-34995885 CTGTTTCAGTACTTCTGTCCGGG - Intronic
1146741368 17:35286778-35286800 CTGATTGGGAAGTTCTTTCTGGG - Intergenic
1147692609 17:42326100-42326122 CTGCTGCAGAACTTACCTCTAGG + Exonic
1148542838 17:48493625-48493647 CTGATTCAAAACTTCTGTGAGGG - Intergenic
1148603852 17:48913701-48913723 CAGTTTCAGAACCACTCTCTTGG + Intronic
1149354189 17:55822774-55822796 CTGATTCTGAGCTTCCCGCTTGG - Intronic
1150190911 17:63237992-63238014 CTGTTTCCAAATTTCTCTCTGGG - Exonic
1150868882 17:68882370-68882392 CAGATTCTGAAATTCTTTCTTGG + Intronic
1151516460 17:74599273-74599295 CTGACTCAGTGCTCCTCTCTAGG - Intergenic
1153897196 18:9575777-9575799 CTGTTTCACAACTACTCACTCGG - Intronic
1155456983 18:26028049-26028071 CTGATTAAGGACTTGTATCTAGG + Intronic
1158037848 18:53055783-53055805 CCTATTCAGAGCTTCTCTCCCGG - Intronic
1158788467 18:60744806-60744828 TTTATTGAGAACTTTTCTCTAGG - Intergenic
1160228778 18:77030860-77030882 CTGTTTCAGACCTTCTCTTATGG + Intronic
1163871983 19:19829892-19829914 CTGGTTCTGAACTTCTTTTTTGG - Intergenic
1164408570 19:27977079-27977101 CTGATTCAGGCCTTGGCTCTTGG + Intergenic
1168541884 19:57219586-57219608 CTGAACCAAAACTTCTTTCTTGG + Exonic
925443133 2:3905590-3905612 CTCTATCAGAACTTCTCTGTGGG + Intergenic
927200887 2:20577464-20577486 ATGGTCTAGAACTTCTCTCTGGG - Intronic
930613012 2:53563811-53563833 ATGGTTCAGAATTTCTCTCCTGG + Intronic
930654236 2:53992324-53992346 CTGATTAAAAACTTGTCTATAGG - Intronic
930932049 2:56897298-56897320 ATAATTCAGAACTTCTTTATGGG + Intergenic
933944731 2:87276175-87276197 CTGACCTCGAACTTCTCTCTAGG + Intergenic
934552520 2:95271044-95271066 CTGTCTCAGACCCTCTCTCTGGG - Intergenic
935752822 2:106252670-106252692 CTGATTCAGGACTTTTCTTTTGG + Intergenic
935913241 2:107920211-107920233 CTGATTCAGGACTTTTCTTTTGG + Intergenic
936083842 2:109453159-109453181 CTGAACCAGAGCTCCTCTCTGGG + Intronic
936335480 2:111585404-111585426 CTGACCTCGAACTTCTCTCTAGG - Intergenic
937875790 2:126824282-126824304 CAGAATCACAACTTCTCCCTTGG + Intergenic
942586027 2:177479050-177479072 GTGGTTCAGAGATTCTCTCTGGG - Intronic
942594159 2:177576375-177576397 CTTCTTCAGAAGCTCTCTCTGGG + Intergenic
942865023 2:180663056-180663078 CTGATTCAGTACCTAGCTCTGGG + Intergenic
943369641 2:187001675-187001697 CAGAATCAGAACTGCTCCCTGGG - Intergenic
943570037 2:189563638-189563660 CAGATTCAGGACTTGTCTCCGGG + Exonic
944108291 2:196103154-196103176 CTCATCCAGAATTTGTCTCTAGG + Intergenic
944134371 2:196382578-196382600 CCTATTCAGAAATTCTTTCTGGG - Intronic
1169301342 20:4444241-4444263 CTGTTTCAGCCCATCTCTCTGGG - Intergenic
1169408776 20:5349170-5349192 CTCAATCAGATCTTCTCTATTGG + Intergenic
1169743550 20:8920221-8920243 CTGCTTCAGAACTGCACTCTGGG + Intronic
1171313456 20:24165620-24165642 CTGGTTCAGATCTTCTCTCTGGG - Intergenic
1173209579 20:41021732-41021754 CTGCTTCACAACTTCTCTTTGGG + Intergenic
1173765222 20:45601100-45601122 CAGGTTCAGAACCTCTCTCTAGG + Intergenic
1174756501 20:53163770-53163792 CTGATTCAGAATCTCTCACCAGG - Intronic
1179710428 21:43210107-43210129 CTGACTTAGAACTTCTCCGTTGG + Intergenic
1179962451 21:44776629-44776651 ATGATTCAGTACTTCCCACTGGG - Intronic
1181178621 22:21052215-21052237 GTGAGTCAGAAGGTCTCTCTTGG + Intronic
1203293230 22_KI270736v1_random:15531-15553 CTAAATCAGAACTTCTCCTTGGG + Intergenic
950006870 3:9697072-9697094 CTGATTCATCCCTTCCCTCTGGG + Intronic
953076340 3:39573954-39573976 CTGAGTGAGAACTTCTATCCCGG - Intergenic
953404120 3:42652135-42652157 CAGAGGCAGAATTTCTCTCTTGG - Intergenic
953727169 3:45409811-45409833 CTGATTCTGTTATTCTCTCTAGG + Intronic
954309530 3:49754357-49754379 CAGATTCAGATCTTGTCTCAGGG + Intronic
956031225 3:65040126-65040148 CTAATATAGAACTACTCTCTTGG + Intergenic
956291184 3:67662000-67662022 CTGATTCAGTAGGTCTGTCTTGG + Intergenic
956432125 3:69197836-69197858 CTGATTAAGAATTTCTCTTAAGG + Intronic
957186107 3:76943450-76943472 CTAATTCAAAAGTTCACTCTGGG - Intronic
957732596 3:84159524-84159546 CTGGTTCTGATCTTCTCTCCTGG - Intergenic
958173362 3:89964620-89964642 CTTCTTCAAAACTTCTCTCTAGG + Intergenic
958274264 3:91553993-91554015 CTGTTTCATAACTGCTCTATAGG - Intergenic
958274614 3:91559771-91559793 CTGTTTCATAACTGCTCTATAGG - Intergenic
958274783 3:91562328-91562350 CTGTTTCATAACTGCTCTATTGG - Intergenic
958274957 3:91565222-91565244 CTGTTTCATAACTGCTCTATAGG - Intergenic
958275138 3:91568117-91568139 CTGCTTCATAACTGCTCTATAGG - Intergenic
958275296 3:91570668-91570690 CTGTTTCATAACTGCTCTATAGG - Intergenic
958275471 3:91573562-91573584 CTGTTTCATAACTGCTCTATAGG - Intergenic
958276005 3:91582230-91582252 CTGTTTCATAACTGCTCTATAGG - Intergenic
958276177 3:91585123-91585145 CTGTTTCATAACTGCTCTATAGG - Intergenic
958276355 3:91588015-91588037 CTGTTTCATAACTGCTCTATAGG - Intergenic
958276662 3:91592949-91592971 CTGTTTCATAACTGCTCTATAGG - Intergenic
958276854 3:91596179-91596201 CTGTTTCATAACTGCTCTATAGG - Intergenic
958277029 3:91599070-91599092 CTGTTTCATAACTGCTCTATAGG - Intergenic
958277206 3:91601961-91601983 CTGTTTCATAACTGCTCTATAGG - Intergenic
958277384 3:91604855-91604877 CTGCTTCATAACTGCTCTATAGG - Intergenic
958277733 3:91610637-91610659 CTGTTTCATAACTGCTCTATAGG - Intergenic
958278069 3:91616081-91616103 CTGTTTCATAACTGCTCTATAGG - Intergenic
958278244 3:91618973-91618995 CTGTTTCATAACTGCTCTATAGG - Intergenic
958278590 3:91624757-91624779 CTGTTTCATAACTGCTCTATAGG - Intergenic
958278764 3:91627649-91627671 CTGTTTCATAACTGCTCTATAGG - Intergenic
958279290 3:91636319-91636341 CTGTTTCATAACTGCTCTATAGG - Intergenic
958279548 3:91640568-91640590 CTGTTTCATAACTGCTCTATAGG - Intergenic
958279725 3:91643461-91643483 CTGTTTCATAACTGCTCTATAGG - Intergenic
958279904 3:91646353-91646375 CTGTTTCATAACTGCTCTATAGG - Intergenic
958280081 3:91649242-91649264 CTGTTTCATAACTGCTCTATAGG - Intergenic
958280256 3:91652140-91652162 CTGTTTCATAACTGCTCTATAGG - Intergenic
958280435 3:91655033-91655055 CTGTTTCATAACTGCTCTATAGG - Intergenic
958280611 3:91657926-91657948 CTGTTTCATAACTGCTCTATAGG - Intergenic
958280765 3:91660483-91660505 CTGTTTCATAACTGCTCTATAGG - Intergenic
958281116 3:91666268-91666290 CTGTTTCATAACTGCTCTATAGG - Intergenic
958281290 3:91669159-91669181 CTGTTTCATAACTGCTCTATAGG - Intergenic
958281640 3:91674944-91674966 CTGTTTCATAACTGCTCTATAGG - Intergenic
958281815 3:91677836-91677858 CTGTTTCATAACTGCTCTATAGG - Intergenic
958281996 3:91680723-91680745 CTGTTTCATAACTGCTCTATAGG - Intergenic
958282174 3:91683615-91683637 CTGTTTCATAACTGCTCTATAGG - Intergenic
958282347 3:91686506-91686528 CTGTTTCATAACTGCTCTATAGG - Intergenic
958282524 3:91689398-91689420 CTGTTTCACAACTGCTCTATAGG - Intergenic
958282698 3:91692289-91692311 CTGTTTCATAACTGCTCTATAGG - Intergenic
958282871 3:91695180-91695202 CTGTTTCATAACTGCTCTATAGG - Intergenic
958282964 3:91696717-91696739 CTGTTTCATAACTGCTCTATAGG - Intergenic
958283137 3:91699608-91699630 CTGTTTCATAACTGCTCTATAGG - Intergenic
958283289 3:91702160-91702182 CTGTTTCATAACTGCTCTATAGG - Intergenic
958283423 3:91704375-91704397 CTGTTTCATAACTGCTCTATAGG - Intergenic
958283774 3:91710160-91710182 CTGTTTCATAACTGCTCTATAGG - Intergenic
958283949 3:91713053-91713075 CTGTTTCATAACTGCTCTATAGG - Intergenic
958284132 3:91715943-91715965 CTGTTTCATAACTGCTCTATAGG - Intergenic
958284507 3:91721727-91721749 CTGTTTCATAACTGCTCTATAGG - Intergenic
958284681 3:91724619-91724641 CTGTTTCATAACTGCTCTATAGG - Intergenic
958284857 3:91727510-91727532 CTGTTTCATAACTGCTCTATAGG - Intergenic
958285033 3:91730403-91730425 CTGTTTCATAACTGCTCTATAGG - Intergenic
958285207 3:91733295-91733317 CTGTTTCATAACTGCTCTATAGG - Intergenic
958285381 3:91736188-91736210 CTGTTTCATAACTGCTCTATAGG - Intergenic
958285555 3:91739082-91739104 CTGTTTCATAACTGCTCTATAGG - Intergenic
958285903 3:91744524-91744546 CTGTTTCATAACTGCTCTATAGG - Intergenic
958286076 3:91747416-91747438 CTGTTTCATAACTGCTCTATAGG - Intergenic
958286253 3:91750306-91750328 CTGTTTCATAACTGCTCTATAGG - Intergenic
958286424 3:91753198-91753220 CTGTTTCATAACTGCTCTATAGG - Intergenic
958286600 3:91756089-91756111 CTGTTTCATAACTGCTCTATAGG - Intergenic
958286775 3:91758984-91759006 CTGTTTCATAACTGCTCTATAGG - Intergenic
958287130 3:91764764-91764786 CTGTTTCATAACTGCTCTATAGG - Intergenic
958287311 3:91767655-91767677 CTGTTTCATAACTGCTCTATAGG - Intergenic
958287488 3:91770550-91770572 CTGTTTCATAACTGCTCTATAGG - Intergenic
958287664 3:91773441-91773463 CTGTTTCATAACTGCTCTATAGG - Intergenic
958287839 3:91776333-91776355 CTGTTTCATAACTGCTCTATAGG - Intergenic
958288019 3:91779226-91779248 CTGTTTCATAACTGCTCTATAGG - Intergenic
958288190 3:91782119-91782141 CTGTTTCATAACTGCTCTATAGG - Intergenic
958288363 3:91785010-91785032 CTGTTTCATAACTGCTCTATAGG - Intergenic
958288537 3:91787901-91787923 CTGTTTCATAACTGCTCTATAGG - Intergenic
958288714 3:91790792-91790814 CTGTTTCATAACTGCTCTATAGG - Intergenic
958288888 3:91793683-91793705 CTGTTTCATAACTGCTCTATAGG - Intergenic
958289064 3:91796574-91796596 CTGTTTCATAACTGCTCTATAGG - Intergenic
958289258 3:91799805-91799827 CTGTTTCATAACTGCTCTATAGG - Intergenic
958289436 3:91802696-91802718 CTGTTTCATAACTGCTCTATAGG - Intergenic
958289787 3:91808475-91808497 CTGTTTCACAACTGCTCTATAGG - Intergenic
958289964 3:91811367-91811389 CTGTTTCATAACTGCTCTATAGG - Intergenic
958290139 3:91814258-91814280 CTGCTTCATAACTGCTCTATAGG - Intergenic
958290316 3:91817151-91817173 CTGTTTCATAACTGCTCTATAGG - Intergenic
958290490 3:91820042-91820064 CTGTTTCATAACTGCTCTATAGG - Intergenic
958290665 3:91822933-91822955 CTGTTTCATAACTGCTCTATAGG - Intergenic
958290837 3:91825826-91825848 CTGCTTCATAACTGCTCTATAGG - Intergenic
958290998 3:91828379-91828401 CTGTTTCATAACTGCTCTATAGG - Intergenic
958291172 3:91831271-91831293 CTGTTTCATAACTGCTCTATAGG - Intergenic
958291350 3:91834162-91834184 CTGTTTCATAACTGCTCTATAGG - Intergenic
958291506 3:91836715-91836737 CTGTTTCATAACTGCTCTATAGG - Intergenic
958291683 3:91839608-91839630 CTGTTTCATAACTGCTCTATAGG - Intergenic
958291867 3:91842500-91842522 CTGTTTCATAACTGCTCTATAGG - Intergenic
958292044 3:91845394-91845416 CTGTTTCATAACTGCTCTATAGG - Intergenic
958292203 3:91847945-91847967 CTGCTTCATAACTGCTCTATAGG - Intergenic
958292396 3:91851178-91851200 CTGTTTCATAACTGCTCTATAGG - Intergenic
958292572 3:91854070-91854092 CTGTTTCACAACTGCTCTATAGG - Intergenic
958292747 3:91856963-91856985 CTGTTTCATAACTGCTCTATAGG - Intergenic
958292926 3:91859858-91859880 CTGCTTCATAACTGCTCTATAGG - Intergenic
958293278 3:91865637-91865659 CTGTTTCATAACTGCTCTATAGG - Intergenic
958294147 3:91879402-91879424 CTGTTTCATAACTGCTCTATAGG - Intergenic
958294303 3:91881955-91881977 CTGTTTCATAACTGCTCTATAGG - Intergenic
958294478 3:91884848-91884870 CTGTTTCATAACTGCTCTATAGG - Intergenic
958294657 3:91887739-91887761 CTGTTTCATAACTGCTCTATAGG - Intergenic
958294833 3:91890630-91890652 CTGTTTCATAACTGCTCTATAGG - Intergenic
958295082 3:91893943-91893965 CTGTTTCATAACTGCTCTATAGG - Intergenic
958295253 3:91896837-91896859 CTGTTTCATAACTGCTCTATAGG - Intergenic
958295424 3:91899728-91899750 CTGTTTCATAACTGCTCTATAGG - Intergenic
958295555 3:91901938-91901960 CTGTTTCATAACTGCTCTATAGG - Intergenic
958295912 3:91907722-91907744 CTGTTTCATAACTGCTCTATAGG - Intergenic
958295961 3:91908580-91908602 CTGTTTCATAACTGCTCTATAGG - Intergenic
958296133 3:91911475-91911497 CTGTTTCATAACTGCTCTATAGG - Intergenic
958296307 3:91914367-91914389 CTGTTTCATAACTGCTCTATAGG - Intergenic
958296482 3:91917260-91917282 CTGTTTCATAACTGCTCTATAGG - Intergenic
958296657 3:91920151-91920173 CTGTTTCATAACTGCTCTATAGG - Intergenic
958296767 3:91922026-91922048 CTGTTTCATAACTGCTCTATAGG - Intergenic
958296942 3:91924917-91924939 CTGTTTCATAACTGCTCTATAGG - Intergenic
958297117 3:91927810-91927832 CTGTTTCATAACTGCTCTATAGG - Intergenic
958297289 3:91930701-91930723 CTGTTTCATAACTGCTCTATAGG - Intergenic
958297654 3:91936486-91936508 CTGTTTCATAACTGCTCTATAGG - Intergenic
958297838 3:91939373-91939395 CTGTTTCATAACTGCTCTATAGG - Intergenic
958298012 3:91942265-91942287 CTGTTTCATAACTGCTCTATAGG - Intergenic
958298188 3:91945157-91945179 CTGTTTCATAACTGCTCTATAGG - Intergenic
958298530 3:91950943-91950965 CTGTTTCATAACTGCTCTATAGG - Intergenic
958298701 3:91953833-91953855 CTGTTTCATAACTGCTCTATAGG - Intergenic
958298880 3:91956725-91956747 CTGTTTCATAACTGCTCTATAGG - Intergenic
958299256 3:91962507-91962529 CTGTTTCATAACTGCTCTATAGG - Intergenic
958299434 3:91965399-91965421 CTGTTTCATAACTGCTCTATAGG - Intergenic
958299607 3:91968292-91968314 CTGTTTCATAACTGCTCTATAGG - Intergenic
958299783 3:91971182-91971204 CTGTTTCATAACTGCTCTATAGG - Intergenic
958299959 3:91974073-91974095 CTGTTTCATAACTGCTCTATAGG - Intergenic
958300134 3:91976966-91976988 CTGTTTCATAACTGCTCTATAGG - Intergenic
958300307 3:91979860-91979882 CTGTTTCATAACTGCTCTATAGG - Intergenic
958300652 3:91985642-91985664 CTGTTTCATAACTGCTCTATAGG - Intergenic
958301213 3:91994654-91994676 CTGTTTCATAACTGCTCTATAGG - Intergenic
958301387 3:91997546-91997568 CTGTTTCATAACTGCTCTATAGG - Intergenic
958301555 3:92000439-92000461 CTGTTTCATAACTGCTCTATAGG - Intergenic
958302050 3:92008435-92008457 CTGTTTCATAACTGCTCTATAGG - Intergenic
958302224 3:92011326-92011348 CTGTTTCATAACTGCTCTATAGG - Intergenic
958302399 3:92014217-92014239 CTGTTTCATAACTGCTCTATAGG - Intergenic
958302575 3:92017110-92017132 CTGTTTCATAACTGCTCTATAGG - Intergenic
958302750 3:92020003-92020025 CTGTTTCATAACTGCTCTATAGG - Intergenic
958302925 3:92022897-92022919 CTGTTTCATAACTGCTCTATAGG - Intergenic
958303104 3:92025788-92025810 CTGTTTCATAACTGCTCTATAGG - Intergenic
958303270 3:92028680-92028702 CTGTTTCATAACTGCTCTATAGG - Intergenic
958303448 3:92031576-92031598 CTGCTTCATAACTGCTCTATAGG - Intergenic
958303620 3:92034467-92034489 CTGTTTCATAACTGCTCTATAGG - Intergenic
958303735 3:92036343-92036365 CTGTTTCATAACTGCTCTATAGG - Intergenic
958303910 3:92039234-92039256 CTGTTTCATAACTGCTCTATAGG - Intergenic
958304082 3:92042125-92042147 CTGTTTCATAACTGCTCTATAGG - Intergenic
958304418 3:92047568-92047590 CTGTTTCATAACTGCTCTATAGG - Intergenic
958304594 3:92050460-92050482 CTGTTTCATAACTGCTCTATAGG - Intergenic
958304769 3:92053352-92053374 CTGCTTCATAACTGCTCTATAGG - Intergenic
958304941 3:92056242-92056264 CTGTTTCATAACTGCTCTATAGG - Intergenic
958305118 3:92059135-92059157 CTGTTTCATAACTGCTCTATAGG - Intergenic
958305301 3:92062025-92062047 CTGTTTCATAACTGCTCTATAGG - Intergenic
958305460 3:92064583-92064605 CTGTTTCATAACTGCTCTATAGG - Intergenic
958305635 3:92067475-92067497 CTGCTTCATAACTGCTCTATAGG - Intergenic
958305817 3:92070368-92070390 CTGTTTCATAACTGCTCTATAGG - Intergenic
958305996 3:92073261-92073283 CTGTTTCATAACTGCTCTATAGG - Intergenic
958306168 3:92076152-92076174 CTGTTTCATAACTGCTCTATAGG - Intergenic
958306301 3:92078369-92078391 CTGTTTCATAACTGCTCTATAGG - Intergenic
958306474 3:92081266-92081288 CTGTTTCATAACTGCTCTATAGG - Intergenic
958306649 3:92084159-92084181 CTGTTTCATAACTGCTCTCTAGG - Intergenic
958306826 3:92087050-92087072 CTGTTTCATAACTGCTCTATAGG - Intergenic
958307007 3:92089940-92089962 CTGTTTCATAACTGCTCTATAGG - Intergenic
958307183 3:92092831-92092853 CTGTTTCATAACTGCTCTCTAGG - Intergenic
958307296 3:92094705-92094727 CTGTTTCATAACTGCTCTATAGG - Intergenic
958307469 3:92097596-92097618 CTGTTTCATAACTGCTCTATAGG - Intergenic
958307645 3:92100488-92100510 CTGTTTCATAACTGCTCTATAGG - Intergenic
958307801 3:92103042-92103064 CTGTTTCATAACTGCTCTATAGG - Intergenic
958307980 3:92105933-92105955 CTGTTTCATAACTGCTCTATAGG - Intergenic
958308324 3:92111711-92111733 CTGTTTCATAACTGCTCTATAGG - Intergenic
958308499 3:92114604-92114626 CTGTTTCATAACTGCTCTATAGG - Intergenic
958308948 3:92122087-92122109 CTGTTTCATAACTGCTCTATAGG - Intergenic
958309126 3:92124978-92125000 CTGTTTCATAACTGCTCTATAGG - Intergenic
958309301 3:92127872-92127894 CTGTTTCATAACTGCTCTATAGG - Intergenic
958309475 3:92130763-92130785 CTGTTTCATAACTGCTCTATAGG - Intergenic
958309808 3:92136209-92136231 CTGTTTCATAACTGCTCTATAGG - Intergenic
958309979 3:92139100-92139122 CTGTTTCATAACTGCTCTATAGG - Intergenic
958310154 3:92141990-92142012 CTGTTTCATAACTGCTCTATAGG - Intergenic
958310347 3:92145224-92145246 CTGTTTCATAACTGCTCTATAGG - Intergenic
958310522 3:92148116-92148138 CTGTTTCATAACTGCTCTATAGG - Intergenic
958310698 3:92151009-92151031 CTGTTTCATAACTGCTCTATAGG - Intergenic
958310874 3:92153907-92153929 CTGTTTCATAACTGCTCTATAGG - Intergenic
958311239 3:92159686-92159708 CTGTTTCATAACTGCTCTATAGG - Intergenic
958311414 3:92162577-92162599 CTGTTTCATAACTGCTCTATAGG - Intergenic
958311586 3:92165468-92165490 CTGTTTCATAACTGCTCTATAGG - Intergenic
958311762 3:92168362-92168384 CTGCTTCATAACTGCTCTATAGG - Intergenic
958311948 3:92171252-92171274 CTGTTTCATAACTGCTCTATAGG - Intergenic
958312128 3:92174148-92174170 CTGTTTCATAACTGCTCTATAGG - Intergenic
958312304 3:92177042-92177064 CTGTTTCATAACTGCTCTATAGG - Intergenic
958312479 3:92179933-92179955 CTGTTTCATAACTGCTCTATAGG - Intergenic
958312653 3:92182823-92182845 CTGTTTCATAACTGCTCTATAGG - Intergenic
958312935 3:92187412-92187434 CTGTTTCATAACTGCTCTATAGG - Intergenic
958313114 3:92190305-92190327 CTGTTTCATAACTGCTCTATAGG - Intergenic
958313274 3:92192859-92192881 CTGTTTCATAACTGCTCTATAGG - Intergenic
958313466 3:92196090-92196112 CTGTTTCATAACTGCTCTATAGG - Intergenic
958313650 3:92198983-92199005 CTGTTTCATAACTGCTCTATAGG - Intergenic
958313847 3:92202215-92202237 CTGTTTCATAACTGCTCTATAGG - Intergenic
958314022 3:92205110-92205132 CTGTTTCATAACTGCTCTATAGG - Intergenic
958314206 3:92208000-92208022 CTGTTTCATAACTGCTCTATAGG - Intergenic
958314383 3:92210893-92210915 CTGCTTCATAACTGCTCTATAGG - Intergenic
958314543 3:92213446-92213468 CTGTTTCATAACTGCTCTATAGG - Intergenic
958314718 3:92216340-92216362 CTGTTTCATAACTGCTCTATAGG - Intergenic
958314895 3:92219230-92219252 CTGTTTCATAACTGCTCTATAGG - Intergenic
958315069 3:92222122-92222144 CTGTTTCATAACTGCTCTATAGG - Intergenic
958315243 3:92225016-92225038 CTGTTTCATAACTGCTCTATAGG - Intergenic
958315403 3:92227571-92227593 CTGTTTCATAACTGCTCTATAGG - Intergenic
958315580 3:92230464-92230486 CTGTTTCATAACTGCTCTATAGG - Intergenic
958315958 3:92236250-92236272 CTGTTTCATAACTGCTCTATAGG - Intergenic
958316131 3:92239144-92239166 CTGTTTCATAACTGCTCTATAGG - Intergenic
958316305 3:92242036-92242058 CTGTTTCATAACTGCTCTATAGG - Intergenic
958316481 3:92244927-92244949 CTGTTTCATAACTGCTCTATAGG - Intergenic
958316658 3:92247822-92247844 CTGTTTCATAACTGCTCTATAGG - Intergenic
958316832 3:92250717-92250739 CTGTTTCATAACTGCTCTATAGG - Intergenic
958317008 3:92253608-92253630 CTGTTTCATAACTGCTCTATAGG - Intergenic
958317453 3:92260753-92260775 CTGTTTCATAACTGCTCTATAGG - Intergenic
958317626 3:92263645-92263667 CTGTTTCATAACTGCTCTATAGG - Intergenic
958317801 3:92266537-92266559 CTGTTTCATAACTGCTCTATAGG - Intergenic
958317979 3:92269429-92269451 CTGTTTCATAACTGCTCTATAGG - Intergenic
958318332 3:92275215-92275237 CTGTTTCATAACTGCTCTATTGG - Intergenic
958318502 3:92278106-92278128 CTGTTTCATAACTGCTCTATAGG - Intergenic
958318615 3:92279979-92280001 CTGTTTCATAACTGCTCTATAGG - Intergenic
958318776 3:92282533-92282555 CTGCTTCATAACTGCTCTATAGG - Intergenic
958318948 3:92285426-92285448 CTGTTTCATAACTGCTCTATAGG - Intergenic
958319142 3:92288659-92288681 CTGTTTCATAACTGCTCTATAGG - Intergenic
958319320 3:92291552-92291574 CTGTTTCATAACTGCTCTATAGG - Intergenic
958319495 3:92294446-92294468 CTGTTTCATAACTGCTCTATAGG - Intergenic
958319667 3:92297337-92297359 CTGTTTCATAACTGCTCTATAGG - Intergenic
958319842 3:92300228-92300250 CTGTTTCATAACTGCTCTATAGG - Intergenic
958320109 3:92304649-92304671 CTGTTTCATAACTGCTCTATAGG - Intergenic
958320268 3:92307202-92307224 CTGTTTCATAACTGCTCTATAGG - Intergenic
958320445 3:92310099-92310121 CTGTTTCATAACTGCTCTATAGG - Intergenic
958320618 3:92312990-92313012 CTGTTTCATAACTGCTCTATAGG - Intergenic
958320791 3:92315883-92315905 CTGTTTCATAACTGCTCTATAGG - Intergenic
958320966 3:92318775-92318797 CTGTTTCATAACTGCTCTATAGG - Intergenic
958321144 3:92321668-92321690 CTGTTTCATAACTGCTCTATAGG - Intergenic
958321324 3:92324563-92324585 CTGTTTCATAACTGCTCTATAGG - Intergenic
958321448 3:92326778-92326800 CTGTTTCATAACTGCTCTATAGG - Intergenic
958321559 3:92328654-92328676 CTGCTTCATAACTGCTCTATAGG - Intergenic
958321719 3:92331209-92331231 CTGTTTCATAACTGCTCTATAGG - Intergenic
958321893 3:92334099-92334121 CTGTTTCATAACTGCTCTATAGG - Intergenic
958322069 3:92336991-92337013 CTGTTTCATAACTGCTCTATAGG - Intergenic
958322243 3:92339885-92339907 CTGTTTCATAACTGCTCTATAGG - Intergenic
958322419 3:92342778-92342800 CTGTTTCATAACTGCTCTATAGG - Intergenic
958322594 3:92345670-92345692 CTGTTTCATAACTGCTCTATAGG - Intergenic
958322768 3:92348567-92348589 CTGTTTCATAACTGCTCTATAGG - Intergenic
958322945 3:92351457-92351479 CTGTTTCATAACTGCTCTATAGG - Intergenic
958323121 3:92354349-92354371 CTGTTTCATAACTGCTCTATAGG - Intergenic
958323295 3:92357240-92357262 CTGTTTCATAACTGCTCTATAGG - Intergenic
958323469 3:92360132-92360154 CTGTTTCATAACTGCTCTATAGG - Intergenic
958323646 3:92363025-92363047 CTGTTTCATAACTGCTCTATAGG - Intergenic
958323804 3:92365579-92365601 CTGTTTCATAACTGCTCTATAGG - Intergenic
958323916 3:92367454-92367476 CTGTTTCATAACTGCTCTATAGG - Intergenic
958324032 3:92369331-92369353 CTGTTTCATAACTGCTCTATAGG - Intergenic
958324561 3:92378008-92378030 CTGTTTCATAACTGCTCTATAGG - Intergenic
958324744 3:92380898-92380920 CTGTTTCATAACTGCTCTATAGG - Intergenic
958324920 3:92383789-92383811 CTGTTTCATAACTGCTCTATAGG - Intergenic
958325093 3:92386680-92386702 CTGTTTCATAACTGCTCTATAGG - Intergenic
958325266 3:92389572-92389594 CTGTTTCATAACTGCTCTATAGG - Intergenic
958325604 3:92395018-92395040 CTGTTTCATAACTGCTCTATAGG - Intergenic
958325780 3:92397911-92397933 CTGTTTCATAACTGCTCTATAGG - Intergenic
958325959 3:92400803-92400825 CTGTTTCATAACTGCTCTATAGG - Intergenic
958326134 3:92403697-92403719 CTGTTTCATAACTGCTCTATAGG - Intergenic
958326308 3:92406591-92406613 CTGTTTCATAACTGCTCTATAGG - Intergenic
958326485 3:92409483-92409505 CTGTTTCATAACTGCTCTATAGG - Intergenic
958326661 3:92412375-92412397 CTGTTTCATAACTGCTCTATAGG - Intergenic
958326831 3:92415265-92415287 CTGTTTCATAACTGCTCTATAGG - Intergenic
958327003 3:92418158-92418180 CTGTTTCATAACTGCTCTATAGG - Intergenic
958327367 3:92423944-92423966 CTGTTTCATAACTGCTCTATAGG - Intergenic
958327542 3:92426835-92426857 CTGTTTCATAACTGCTCTATAGG - Intergenic
958327719 3:92429726-92429748 CTGTTTCATAACTGCTCTATAGG - Intergenic
958327896 3:92432617-92432639 CTGTTTCATAACTGCTCTATAGG - Intergenic
958328070 3:92435514-92435536 CTGTTTCATAACTGCTCTATAGG - Intergenic
958328418 3:92441297-92441319 CTGTTTCATAACTGCTCTATAGG - Intergenic
958328596 3:92444188-92444210 CTGTTTCATAACTGCTCTATAGG - Intergenic
958328767 3:92447079-92447101 CTGTTTCATAACTGCTCTATAGG - Intergenic
958328946 3:92449972-92449994 CTGTTTCATAACTGCTCTATAGG - Intergenic
958329120 3:92452863-92452885 CTGTTTCATAACTGCTCTATAGG - Intergenic
958329299 3:92455754-92455776 CTGTTTCATAACTGCTCTATAGG - Intergenic
958329473 3:92458644-92458666 CTGTTTCATAACTGCTCTATAGG - Intergenic
958329634 3:92461198-92461220 CTGTTTCATAACTGCTCTATAGG - Intergenic
958329809 3:92464093-92464115 CTGTTTCATAACTGCTCTATAGG - Intergenic
958329986 3:92466983-92467005 CTGTTTCATAACTGCTCTATAGG - Intergenic
958330493 3:92475318-92475340 CTGTTTCATAACTGCTCTATAGG - Intergenic
958330844 3:92481104-92481126 CTGCTTCATAACTGCTCTATAGG - Intergenic
958331021 3:92483996-92484018 CTGTTTCATAACTGCTCTATAGG - Intergenic
958331754 3:92495557-92495579 CTGTTTCATAACTGCTCTATAGG - Intergenic
958331929 3:92498449-92498471 CTGTTTCATAACTGCTCTATAGG - Intergenic
958332102 3:92501339-92501361 CTGTTTCATAACTGCTCTATAGG - Intergenic
958332279 3:92504231-92504253 CTGTTTCATAACTGCTCTATAGG - Intergenic
958332457 3:92507124-92507146 CTGTTTCATAACTGCTCTATAGG - Intergenic
958332634 3:92510016-92510038 CTGTTTCATAACTGCTCTATAGG - Intergenic
958332804 3:92512907-92512929 CTGTTTCATAACTGCTCTATAGG - Intergenic
958332982 3:92515801-92515823 CTGTTTCATAACTGCTCTATAGG - Intergenic
958333336 3:92521585-92521607 CTGTTTCATAACTGCTCTATAGG - Intergenic
958333513 3:92524477-92524499 CTGTTTCACAACTGCTCTATAGG - Intergenic
958333690 3:92527364-92527386 CTGTTTCATAACTGCTCTATAGG - Intergenic
958333868 3:92530258-92530280 CTGCTTCATAACTGCTCTATAGG - Intergenic
958334045 3:92533148-92533170 CTGTTTCATAACTGCTCTATAGG - Intergenic
958334220 3:92536042-92536064 CTGTTTCATAACTGCTCTATAGG - Intergenic
958334330 3:92537920-92537942 CTGTTTCATAACTGCTCTATAGG - Intergenic
958334507 3:92540811-92540833 CTGCTTCATAACTGCTCTATAGG - Intergenic
958334858 3:92546597-92546619 CTGTTTCATAACTGCTCTATAGG - Intergenic
958335032 3:92549490-92549512 CTGTTTCATAACTGCTCTATAGG - Intergenic
958335204 3:92552381-92552403 CTGTTTCATAACTGCTCTATAGG - Intergenic
958335380 3:92555274-92555296 CTGCTTCATAACTGCTCTATAGG - Intergenic
958335556 3:92558169-92558191 CTGTTTCATAACTGCTCTATAGG - Intergenic
958335729 3:92561059-92561081 CTGTTTCATAACTGCTCTATAGG - Intergenic
958335843 3:92562934-92562956 CTGTTTCATAACTGCTCTATAGG - Intergenic
958335958 3:92564808-92564830 CTGTTTCATAACTGCTCTATAGG - Intergenic
958336308 3:92570592-92570614 CTGTTTCATAACTGCTCTATAGG - Intergenic
958336484 3:92573483-92573505 CTGTTTCATAACTGCTCTATAGG - Intergenic
958336659 3:92576375-92576397 CTGTTTCATAACTGCTCTATAGG - Intergenic
958336833 3:92579266-92579288 CTGTTTCATAACTGCTCTATAGG - Intergenic
958337007 3:92582158-92582180 CTGTTTCATAACTGCTCTATAGG - Intergenic
958337178 3:92585050-92585072 CTGTTTCATAACTGCTCTATAGG - Intergenic
958337541 3:92590834-92590856 CTGTTTCATAACTGCTCTATAGG - Intergenic
958337716 3:92593728-92593750 CTGTTTCATAACTGCTCTATAGG - Intergenic
958337888 3:92596621-92596643 CTGTTTCATAACTGCTCTATAGG - Intergenic
958338060 3:92599514-92599536 CTGTTTCATAACTGCTCTATAGG - Intergenic
958338235 3:92602405-92602427 CTGTTTCATAACTGCTCTATAGG - Intergenic
958338388 3:92604961-92604983 CTGTTTCATAACTGCTCTATAGG - Intergenic
958338563 3:92607856-92607878 CTGTTTCATAACTGCTCTATAGG - Intergenic
958338742 3:92610751-92610773 CTGTTTCATAACTGCTCTATAGG - Intergenic
958338923 3:92613641-92613663 CTGTTTCATAACTGCTCTATAGG - Intergenic
958339099 3:92616532-92616554 CTGTTTCATAACTGCTCTATAGG - Intergenic
958339250 3:92619087-92619109 CTGTTTCATAACTGCTCTATAGG - Intergenic
958339597 3:92624873-92624895 CTGTTTCATAACTGCTCTATAGG - Intergenic
958339774 3:92627767-92627789 CTGTTTCATAACTGCTCTATAGG - Intergenic
958339952 3:92630659-92630681 CTGTTTCATAACTGCTCTATAGG - Intergenic
958340137 3:92633552-92633574 CTGTTTCATAACTGCTCTATAGG - Intergenic
958340312 3:92636443-92636465 CTGTTTCATAACTGCTCTATAGG - Intergenic
958340489 3:92639334-92639356 CTGTTTCATAACTGCTCTATAGG - Intergenic
958340662 3:92642226-92642248 CTGTTTCATAACTGCTCTATAGG - Intergenic
958340840 3:92645118-92645140 CTGTTTCATAACTGCTCTATAGG - Intergenic
958341131 3:92649880-92649902 CTGTTTCATAACTGCTCTATAGG - Intergenic
958341291 3:92652433-92652455 CTGTTTCATAACTGCTCTATAGG - Intergenic
958341448 3:92654986-92655008 CTGTTTCATAACTGCTCTATAGG - Intergenic
958341623 3:92657880-92657902 CTGTTTCATAACTGCTCTATAGG - Intergenic
958341797 3:92660771-92660793 CTGTTTCATAACTGCTCTATAGG - Intergenic
958341956 3:92663324-92663346 CTGTTTCATAACTGCTCTATAGG - Intergenic
958342136 3:92666219-92666241 CTGCTTCATAACTGCTCTATAGG - Intergenic
958342319 3:92669111-92669133 CTGTTTCATAACTGCTCTATAGG - Intergenic
958342498 3:92672003-92672025 CTGCTTCATAACTGCTCTATAGG - Intergenic
958342852 3:92677787-92677809 CTGTTTCATAACTGCTCTATAGG - Intergenic
958343030 3:92680679-92680701 CTGTTTCATAACTGCTCTATAGG - Intergenic
958343206 3:92683570-92683592 CTGTTTCATAACTGCTCTATAGG - Intergenic
958343556 3:92689354-92689376 CTGTTTCATAACTGCTCTATAGG - Intergenic
958343728 3:92692248-92692270 CTGTTTCATAACTGCTCTATAGG - Intergenic
958343905 3:92695140-92695162 CTGTTTCATAACTGCTCTATAGG - Intergenic
958344085 3:92698032-92698054 CTGTTTCATAACTGCTCTATAGG - Intergenic
958344418 3:92703482-92703504 CTGTTTCATAACTGCTCTATTGG - Intergenic
958344598 3:92706373-92706395 CTGTTTCATAACTGCTCTATAGG - Intergenic
958344770 3:92709264-92709286 CTGTTTCATAACTGCTCTATAGG - Intergenic
958344929 3:92711818-92711840 CTGTTTCATAACTGCTCTATAGG - Intergenic
958345449 3:92720154-92720176 CTGTTTCATAACTGCTCTATAGG - Intergenic
958345623 3:92723045-92723067 CTGTTTCATAACTGCTCTATAGG - Intergenic
958345794 3:92725935-92725957 CTGTTTCATAACTGCTCTATAGG - Intergenic
958345977 3:92728827-92728849 CTGTTTCATAACTGCTCTATAGG - Intergenic
958346167 3:92731719-92731741 CTGTTTCATAACTGCTCTATAGG - Intergenic
958346342 3:92734609-92734631 CTGTTTCATAACTGCTCTATAGG - Intergenic
958346611 3:92738858-92738880 CTGTTTCATAACTGCTCTATAGG - Intergenic
958346787 3:92741753-92741775 CTGTTTCATAACTGCTCTATAGG - Intergenic
958347136 3:92747536-92747558 CTGTTTCATAACTGCTCTATAGG - Intergenic
958347312 3:92750429-92750451 CTGTTTCATAACTGCTCTATAGG - Intergenic
958347659 3:92756214-92756236 CTGTTTCATAACTGCTCTATAGG - Intergenic
958347818 3:92758767-92758789 CTGTTTCATAACTGCTCTATAGG - Intergenic
958347997 3:92761661-92761683 CTGTTTCATAACTGCTCTATAGG - Intergenic
958348296 3:92766766-92766788 CTGTTTCATAACTGCTCTATAGG - Intergenic
958348473 3:92769657-92769679 CTGTTTCATAACTGCTCTATAGG - Intergenic
958348652 3:92772550-92772572 CTGTTTCATAACTGCTCTATAGG - Intergenic
958348825 3:92775443-92775465 CTGTTTCATAACTGCTCTATAGG - Intergenic
958349068 3:92779348-92779370 CTGTTTCATAACTGCTCTATAGG - Intergenic
958349414 3:92785130-92785152 CTGTTTCATAACTGCTCTATAGG - Intergenic
958349765 3:92790910-92790932 CTGTTTCATAACTGCTCTATAGG - Intergenic
958349944 3:92793801-92793823 CTGTTTCATAACTGCTCTATAGG - Intergenic
958350302 3:92799593-92799615 CTGTTTCATAACTGCTCTATAGG - Intergenic
958350415 3:92801469-92801491 CTGTTTCATAACTGCTCTATAGG - Intergenic
958350575 3:92804022-92804044 CTGTTTCATAACTGCTCTATAGG - Intergenic
958350750 3:92806911-92806933 CTGTTTCATAACTGCTCTATAGG - Intergenic
958350989 3:92810817-92810839 CTGTTTCATAACTGCTCTATAGG - Intergenic
958351173 3:92813709-92813731 CTGTTTCATAACTGCTCTATAGG - Intergenic
958351344 3:92816599-92816621 CTGTTTCATAACTGCTCTATAGG - Intergenic
958351695 3:92822386-92822408 CTGTTTCATAACTGCTCTATAGG - Intergenic
958351866 3:92825278-92825300 CTGCTTCATAACTGCTCTATAGG - Intergenic
958352043 3:92828171-92828193 CTGTTTCATAACTGCTCTATAGG - Intergenic
958352175 3:92830381-92830403 CTGTTTCATAACTGCTCTATAGG - Intergenic
958352355 3:92833272-92833294 CTGTTTCATAACTGCTCTATAGG - Intergenic
958352532 3:92836163-92836185 CTGTTTCATAACTGCTCTATAGG - Intergenic
958352710 3:92839057-92839079 CTGTTTCATAACTGCTCTATAGG - Intergenic
958352882 3:92841946-92841968 CTGTTTCATAACTGCTCTATAGG - Intergenic
958353053 3:92844839-92844861 CTGTTTCATAACTGCTCTATAGG - Intergenic
958353228 3:92847730-92847752 CTGTTTCATAACTGCTCTATAGG - Intergenic
958353407 3:92850624-92850646 CTGTTTCATAACTGCTCTATAGG - Intergenic
958353583 3:92853517-92853539 CTGTTTCATAACTGCTCTATAGG - Intergenic
958353762 3:92856407-92856429 CTGTTTCATAACTGCTCTATAGG - Intergenic
958354109 3:92862190-92862212 CTGTTTCATAACTGCTCTATAGG - Intergenic
958354283 3:92865082-92865104 CTGTTTCATAACTGCTCTATAGG - Intergenic
958354452 3:92867974-92867996 CTGTTTCATAACTGCTCTATAGG - Intergenic
958354628 3:92870865-92870887 CTGTTTCATAACTGCTCTATAGG - Intergenic
958354977 3:92876649-92876671 CTGCTTCATAACTGCTCTATAGG - Intergenic
958355154 3:92879540-92879562 CTGTTTCATAACTGCTCTATAGG - Intergenic
958355329 3:92882432-92882454 CTGTTTCATAACTGCTCTATAGG - Intergenic
958355679 3:92888217-92888239 CTGTTTCATAACTGCTCTATAGG - Intergenic
958355978 3:92893317-92893339 CTGTTTCATAACTGCTCTATAGG - Intergenic
958356150 3:92896205-92896227 CTGTTTCATAACTGCTCTATAGG - Intergenic
958356504 3:92901987-92902009 CTGTTTCATAACTGCTCTATAGG - Intergenic
958356676 3:92904879-92904901 CTGTTTCATAACTGCTCTATAGG - Intergenic
958356857 3:92907769-92907791 CTGTTTCATAACTGCTCTATAGG - Intergenic
958357034 3:92910664-92910686 CTGTTTCATAACTGCTCTATAGG - Intergenic
958357207 3:92913557-92913579 CTGTTTCATAACTGCTCTATAGG - Intergenic
958357386 3:92916452-92916474 CTGTTTCATAACTGCTCTATAGG - Intergenic
958357566 3:92919344-92919366 CTGTTTCATAACTGCTCTATAGG - Intergenic
958357721 3:92921898-92921920 CTGTTTCATAACTGCTCTATAGG - Intergenic
958358249 3:92930583-92930605 CTGTTTCATAACTGCTCTATAGG - Intergenic
958358424 3:92933475-92933497 CTGTTTCATAACTGCTCTATAGG - Intergenic
958358600 3:92936366-92936388 CTGTTTCATAACTGCTCTATAGG - Intergenic
958358776 3:92939259-92939281 CTGTTTCATAACTGCTCTATAGG - Intergenic
958358950 3:92942150-92942172 CTGTTTCATAACTGCTCTATAGG - Intergenic
958359123 3:92945043-92945065 CTGTTTCATAACTGCTCTATAGG - Intergenic
958359298 3:92947935-92947957 CTGTTTCATAACTGCTCTATAGG - Intergenic
958359457 3:92950488-92950510 CTGTTTCATAACTGCTCTATAGG - Intergenic
958359645 3:92953718-92953740 CTGTTTCATAACTGCTCTATAGG - Intergenic
958359821 3:92956609-92956631 CTGTTTCATAACTGCTCTATAGG - Intergenic
958359996 3:92959500-92959522 CTGTTTCATAACTGCTCTATAGG - Intergenic
958360349 3:92965285-92965307 CTGTTTCATAACTGCTCTATAGG - Intergenic
958360531 3:92968175-92968197 CTGTTTCATAACTGCTCTATAGG - Intergenic
958360781 3:92972078-92972100 CTGTTTCATAACTGCTCTATAGG - Intergenic
958360957 3:92974971-92974993 CTGTTTCACAACTGCTCTATAGG - Intergenic
958361050 3:92976500-92976522 CTGTTTCATAACTGCTCTATAGG - Intergenic
958361225 3:92979391-92979413 CTGTTTCATAACTGCTCTATAGG - Intergenic
958361396 3:92982278-92982300 CTGTTTCATAACTGCTCTATAGG - Intergenic
958361614 3:92985848-92985870 CTGTTTCATAACTGCTCTATAGG - Intergenic
958361788 3:92988738-92988760 CTGTTTCATAACTGCTCTATAGG - Intergenic
958362138 3:92994522-92994544 CTGTTTCATAACTGCTCTATAGG - Intergenic
958362319 3:92997415-92997437 CTGTTTCATAACTGCTCTATAGG - Intergenic
958362497 3:93000308-93000330 CTGTTTCACAACTGCTCTATAGG - Intergenic
958362676 3:93003201-93003223 CTGTTTCATAACTGCTCTATAGG - Intergenic
958362851 3:93006093-93006115 CTGTTTCATAACTGCTCTATAGG - Intergenic
958363008 3:93008646-93008668 CTGTTTCATAACTGCTCTATAGG - Intergenic
958363369 3:93014428-93014450 CTGTTTCATAACTGCTCTATAGG - Intergenic
958363543 3:93017320-93017342 CTGTTTCATAACTGCTCTATAGG - Intergenic
958363718 3:93020211-93020233 CTGTTTCATAACTGCTCTATAGG - Intergenic
958364050 3:93025650-93025672 CTGTTTCATAACTGCTCTATAGG - Intergenic
958364238 3:93028541-93028563 CTGTTTCATAACTGCTCTATAGG - Intergenic
958364414 3:93031433-93031455 CTGCTTCATAACTGCTCTATAGG - Intergenic
958364588 3:93034325-93034347 CTGTTTCACAACTGCTCTATAGG - Intergenic
958364769 3:93037214-93037236 CTGTTTCATAACTGCTCTATAGG - Intergenic
958364947 3:93040109-93040131 CTGTTTCATAACTGCTCTATAGG - Intergenic
958365319 3:93045892-93045914 CTGTTTCATAACTGCTCTATAGG - Intergenic
958365495 3:93048789-93048811 CTGTTTCATAACTGCTCTATAGG - Intergenic
958365674 3:93051681-93051703 CTGTTTCATAACTGCTCTATAGG - Intergenic
958365854 3:93054572-93054594 CTGTTTCATAACTGCTCTATAGG - Intergenic
958366029 3:93057465-93057487 CTGTTTCATAACTGCTCTATAGG - Intergenic
958366205 3:93060355-93060377 CTGTTTCATAACTGCTCTATAGG - Intergenic
958366376 3:93063246-93063268 CTGTTTCATAACTGCTCTATAGG - Intergenic
958366535 3:93065802-93065824 CTGTTTCATAACTGCTCTATAGG - Intergenic
958366715 3:93068693-93068715 CTGTTTCATAACTGCTCTATAGG - Intergenic
958367069 3:93074476-93074498 CTGTTTCATAACTGCTCTATAGG - Intergenic
958367607 3:93083156-93083178 CTGTTTCATAACTGCTCTATAGG - Intergenic
958367778 3:93086048-93086070 CTGTTTCATAACTGCTCTATAGG - Intergenic
958368132 3:93091829-93091851 CTGTTTCATAACTGCTCTATAGG - Intergenic
958368244 3:93093706-93093728 CTGTTTCATAACTGCTCTATAGG - Intergenic
958368417 3:93096597-93096619 CTGTTTCATAACTGCTCTATAGG - Intergenic
958368591 3:93099489-93099511 CTGTTTCATAACTGCTCTATAGG - Intergenic
958368946 3:93105269-93105291 CTGTTTCATAACTGCTCTATAGG - Intergenic
958369123 3:93108161-93108183 CTGTTTCATAACTGCTCTATAGG - Intergenic
958369297 3:93111053-93111075 CTGTTTCATAACTGCTCTATAGG - Intergenic
958369632 3:93116493-93116515 CTGTTTCATAACTGCTCTATAGG - Intergenic
958369757 3:93118711-93118733 CTGTTTCATAACTGCTCTATAGG - Intergenic
958369934 3:93121602-93121624 CTGTTTCATAACTGCTCTATAGG - Intergenic
958370118 3:93124494-93124516 CTGTTTCATAACTGCTCTATAGG - Intergenic
958370276 3:93127049-93127071 CTGTTTCATAACTGCTCTATAGG - Intergenic
958370434 3:93129603-93129625 CTGTTTCATAACTGCTCTATAGG - Intergenic
958370607 3:93132493-93132515 CTGTTTCATAACTGCTCTATAGG - Intergenic
958370781 3:93135385-93135407 CTGTTTCATAACTGCTCTATAGG - Intergenic
958370955 3:93138276-93138298 CTGTTTCATAACTGCTCTATAGG - Intergenic
958371135 3:93141169-93141191 CTGCTTCATAACTGCTCTATAGG - Intergenic
958371306 3:93144057-93144079 CTGTTTCATAACTGCTCTATAGG - Intergenic
958371477 3:93146947-93146969 CTGTTTCATAACTGCTCTATAGG - Intergenic
958371655 3:93149841-93149863 CTGTTTCATAACTGCTCTATAGG - Intergenic
958372006 3:93155627-93155649 CTGTTTCATAACTGCTCTATAGG - Intergenic
958372184 3:93158519-93158541 CTGTTTCATAACTGCTCTATAGG - Intergenic
958372370 3:93161409-93161431 CTGTTTCATAACTGCTCTATAGG - Intergenic
958372549 3:93164301-93164323 CTGTTTCATAACTGCTCTATAGG - Intergenic
958372728 3:93167192-93167214 CTGTTTCATAACTGCTCTATAGG - Intergenic
958372902 3:93170084-93170106 CTGTTTCATAACTGCTCTATAGG - Intergenic
958373077 3:93172972-93172994 CTGTTTCATAACTGCTCTATAGG - Intergenic
958373250 3:93175863-93175885 CTGTTTCATAACTGCTCTATAGG - Intergenic
958373426 3:93178755-93178777 CTGTTTCATAACTGCTCTATAGG - Intergenic
958373600 3:93181647-93181669 CTGTTTCATAACTGCTCTATAGG - Intergenic
958373779 3:93184539-93184561 CTGTTTCATAACTGCTCTATAGG - Intergenic
958373953 3:93187430-93187452 CTGTTTCATAACTGCTCTATAGG - Intergenic
958374125 3:93190324-93190346 CTGTTTCATAACTGCTCTATAGG - Intergenic
958374287 3:93192877-93192899 CTGTTTCATAACTGCTCTATAGG - Intergenic
958374465 3:93195770-93195792 CTGTTTCATAACTGCTCTATAGG - Intergenic
958374641 3:93198662-93198684 CTGTTTCATAACTGCTCTATAGG - Intergenic
958374815 3:93201551-93201573 CTGTTTCATAACTGCTCTATAGG - Intergenic
958374992 3:93204443-93204465 CTGTTTCATAACTGCTCTATAGG - Intergenic
958375166 3:93207336-93207358 CTGTTTCATAACTGCTCTATAGG - Intergenic
958375297 3:93209551-93209573 CTGTTTCATAACTGCTCTATAGG - Intergenic
958375642 3:93215337-93215359 CTGTTTCATAACTGCTCTATAGG - Intergenic
958375989 3:93221118-93221140 CTGTTTCATAACTGCTCTATAGG - Intergenic
958376165 3:93224010-93224032 CTGTTTCATAACTGCTCTATAGG - Intergenic
958376348 3:93226902-93226924 CTGTTTCATAACTGCTCTATAGG - Intergenic
958376530 3:93229793-93229815 CTGTTTCATAACTGCTCTATAGG - Intergenic
958376881 3:93235239-93235261 CTGTTTCATAACTGCTCTATAGG - Intergenic
958377057 3:93238134-93238156 CTGTTTCATAACTGCTCTATAGG - Intergenic
958377230 3:93241024-93241046 CTGTTTCATAACTGCTCTATAGG - Intergenic
958377410 3:93243921-93243943 CTGTTTCATAACTGCTCTATAGG - Intergenic
958377752 3:93249368-93249390 CTGTTTCATAACTGCTCTATTGG - Intergenic
958377927 3:93252260-93252282 CTGTTTCATAACTGCTCTATAGG - Intergenic
958378100 3:93255150-93255172 CTGTTTCATAACTGCTCTATAGG - Intergenic
958378265 3:93257703-93257725 CTGTTTCATAACTGCTCTATAGG - Intergenic
958378445 3:93260594-93260616 CTGTTTCATAACTGCTCTATAGG - Intergenic
958378622 3:93263483-93263505 CTGTTTCATAACTGCTCTATAGG - Intergenic
958378798 3:93266376-93266398 CTGTTTCATAACTGCTCTATAGG - Intergenic
958379160 3:93272159-93272181 CTGTTTCATAACTGCTCTATAGG - Intergenic
958379334 3:93275049-93275071 CTGTTTCATAACTGCTCTATAGG - Intergenic
958379513 3:93277943-93277965 CTGCTTCATAACTGCTCTATAGG - Intergenic
958379672 3:93280498-93280520 CTGTTTCATAACTGCTCTATAGG - Intergenic
958379843 3:93283393-93283415 CTGTTTCATAACTGCTCTATTGG - Intergenic
958380019 3:93286286-93286308 CTGTTTCATAACTGCTCTATAGG - Intergenic
958380194 3:93289178-93289200 CTGTTTCATAACTGCTCTATAGG - Intergenic
958380554 3:93294965-93294987 CTGTTTCATAACTGCTCTATAGG - Intergenic
958380664 3:93296840-93296862 CTGTTTCATAACTGCTCTATAGG - Intergenic
958380835 3:93299711-93299733 CTGTTTCATAACTGCTCTATAGG - Intergenic
958380993 3:93302264-93302286 CTGTTTCATAACTGCTCTATAGG - Intergenic
958381175 3:93305156-93305178 CTGTTTCATAACTGCTCTATAGG - Intergenic
958381352 3:93308050-93308072 CTGTTTCATAACTGCTCTATAGG - Intergenic
958381707 3:93313835-93313857 CTGTTTCATAACTGCTCTATAGG - Intergenic
958381890 3:93316727-93316749 CTGTTTCATAACTGCTCTATAGG - Intergenic
958382064 3:93319622-93319644 CTGTTTCATAACTGCTCTATAGG - Intergenic
958382554 3:93327615-93327637 CTGTTTCATAACTGCTCTATAGG - Intergenic
958382728 3:93330508-93330530 CTGTTTCATAACTGCTCTATAGG - Intergenic
958382897 3:93333396-93333418 CTGTTTCATAACTGCTCTATAGG - Intergenic
958383329 3:93340372-93340394 CTGTTTCATAACTGCTCTATAGG - Intergenic
958383620 3:93345143-93345165 CTGTTTCATAACTGCTCTATAGG - Intergenic
958383794 3:93348034-93348056 CTGTTTCATAACTGCTCTATAGG - Intergenic
958383970 3:93350925-93350947 CTGTTTCATAACTGCTCTATAGG - Intergenic
958384146 3:93353817-93353839 CTGTTTCATAACTGCTCTATTGG - Intergenic
958384321 3:93356706-93356728 CTGTTTCATAACTGCTCTATAGG - Intergenic
958384498 3:93359598-93359620 CTGTTTCATAACTGCTCTATAGG - Intergenic
958384673 3:93362489-93362511 CTGTTTCATAACTGCTCTATAGG - Intergenic
958384857 3:93365381-93365403 CTGTTTCATAACTGCTCTATAGG - Intergenic
958385031 3:93368268-93368290 CTGTTTCATAACTGCTCTATAGG - Intergenic
958385206 3:93371160-93371182 CTGTTTCACAACTGCTCTATAGG - Intergenic
958385383 3:93374051-93374073 CTGCTTCATAACTGCTCTATAGG - Intergenic
958385735 3:93379832-93379854 CTGTTTCATAACTGCTCTATAGG - Intergenic
958386083 3:93385616-93385638 CTGTTTCATAACTGCTCTATAGG - Intergenic
958386256 3:93388503-93388525 CTGTTTCATAACTGCTCTATAGG - Intergenic
958386436 3:93391396-93391418 CTGTTTCATAACTGCTCTATAGG - Intergenic
958386770 3:93396839-93396861 CTGTTTCATAACTGCTCTATAGG - Intergenic
958386943 3:93399728-93399750 CTGTTTCATAACTGCTCTATAGG - Intergenic
958387100 3:93402282-93402304 CTGTTTCACAACTGCTCTATAGG - Intergenic
958387276 3:93405173-93405195 CTGTTTCATAACTGCTCTATAGG - Intergenic
958387454 3:93408068-93408090 CTGTTTCATAACTGCTCTATAGG - Intergenic
958387627 3:93410959-93410981 CTGTTTCATAACTGCTCTATAGG - Intergenic
958388348 3:93422523-93422545 CTGTTTCATAACTGCTCTATAGG - Intergenic
958388632 3:93427118-93427140 CTGTTTCATAACTGCTCTATAGG - Intergenic
958388803 3:93430010-93430032 CTGTTTCATAACTGCTCTATAGG - Intergenic
958388960 3:93432564-93432586 CTGTTTCATAACTGCTCTATAGG - Intergenic
958389145 3:93435457-93435479 CTGTTTCATAACTGCTCTATAGG - Intergenic
958389318 3:93438350-93438372 CTGTTTCATAACTGCTCTATAGG - Intergenic
958389475 3:93440902-93440924 CTGTTTCATAACTGCTCTATAGG - Intergenic
958389648 3:93443793-93443815 CTGTTTCATAACTGCTCTATAGG - Intergenic
958389824 3:93446686-93446708 CTGTTTCATAACTGCTCTATAGG - Intergenic
958390001 3:93449578-93449600 CTGTTTCATAACTGCTCTATAGG - Intergenic
958390179 3:93452467-93452489 CTGTTTCATAACTGCTCTATAGG - Intergenic
958390350 3:93455352-93455374 CTGTTTCATAACTGCTCTATAGG - Intergenic
958390526 3:93458244-93458266 CTGTTTCATAACTGCTCTATAGG - Intergenic
958390704 3:93461136-93461158 CTGTTTCATAACTGCTCTATAGG - Intergenic
958391059 3:93466918-93466940 CTGTTTCATAACTGCTCTATAGG - Intergenic
958391237 3:93469810-93469832 CTGCTTCATAACTGCTCTATAGG - Intergenic
958391430 3:93473127-93473149 CTGTTTCATAACTGCTCTATAGG - Intergenic
958391608 3:93476018-93476040 CTGCTTCATAACTGCTCTATAGG - Intergenic
958391787 3:93478909-93478931 CTGTTTCATAACTGCTCTATAGG - Intergenic
958391965 3:93481800-93481822 CTGTTTCATAACTGCTCTATAGG - Intergenic
958392145 3:93484693-93484715 CTGTTTCATAACTGCTCTATAGG - Intergenic
958392503 3:93490474-93490496 CTGTTTCATAACTGCTCTATAGG - Intergenic
958392677 3:93493365-93493387 CTGTTTCATAACTGCTCTATAGG - Intergenic
958392853 3:93496256-93496278 CTGTTTCATAACTGCTCTATAGG - Intergenic
958393024 3:93499148-93499170 CTGTTTCATAACTGCTCTATAGG - Intergenic
958393207 3:93502040-93502062 CTGCTTCATAACTGCTCTATAGG - Intergenic
958393383 3:93504925-93504947 CTGTTTCATAACTGCTCTATAGG - Intergenic
958393555 3:93507814-93507836 CTGCTTCATAACTGCTCTATAGG - Intergenic
958393730 3:93510705-93510727 CTGTTTCATAACTGCTCTATAGG - Intergenic
958394078 3:93516488-93516510 CTGTTTCATAACTGCTCTATAGG - Intergenic
958394441 3:93522272-93522294 CTGTTTCATAACTGCTCTATAGG - Intergenic
958394613 3:93525163-93525185 CTGTTTCATAACTGCTCTATAGG - Intergenic
958394790 3:93528055-93528077 CTGTTTCATAACTGCTCTATAGG - Intergenic
958394976 3:93530945-93530967 CTGTTTCATAACTGCTCTATAGG - Intergenic
958395150 3:93533836-93533858 CTGTTTCATAACTGCTCTATAGG - Intergenic
958395326 3:93536728-93536750 CTGTTTCATAACTGCTCTATTGG - Intergenic
958395498 3:93539624-93539646 CTGTTTCATAACTGCTCTATAGG - Intergenic
958395678 3:93542519-93542541 CTGTTTCATAACTGCTCTATAGG - Intergenic
958395856 3:93545410-93545432 CTGTTTCATAACTGCTCTATAGG - Intergenic
958396035 3:93548303-93548325 CTGTTTCATAACTGCTCTATAGG - Intergenic
958396212 3:93551197-93551219 CTGTTTCATAACTGCTCTATAGG - Intergenic
958396390 3:93554089-93554111 CTGTTTCATAACTGCTCTATAGG - Intergenic
958396566 3:93556981-93557003 CTGTTTCATAACTGCTCTATAGG - Intergenic
958396749 3:93559871-93559893 CTGTTTCATAACTGCTCTATAGG - Intergenic
958397095 3:93565651-93565673 CTGTTTCATAACTGCTCTATAGG - Intergenic
958397611 3:93574327-93574349 CTGTTTCATAACTGCTCTATAGG - Intergenic
958397787 3:93577219-93577241 CTGTTTCATAACTGCTCTATAGG - Intergenic
958397968 3:93580112-93580134 CTGTTTCATAACTGCTCTATAGG - Intergenic
958398146 3:93583004-93583026 CTGTTTCATAACTGCTCTATAGG - Intergenic
958398315 3:93585892-93585914 CTGTTTCATAACTGCTCTATAGG - Intergenic
958398491 3:93588784-93588806 CTGTTTCATAACTGCTCTATAGG - Intergenic
958398844 3:93594569-93594591 CTGTTTCATAACTGCTCTATAGG - Intergenic
958399019 3:93597460-93597482 CTGTTTCATAACTGCTCTATAGG - Intergenic
958399369 3:93603244-93603266 CTGTTTCATAACTGCTCTATAGG - Intergenic
958399557 3:93606130-93606152 CTGTTTCATAACTGCTCTATAGG - Intergenic
958399734 3:93609022-93609044 CTGTTTCATAACTGCTCTATAGG - Intergenic
958399909 3:93611915-93611937 CTGTTTCATAACTGCTCTATAGG - Intergenic
958400262 3:93617695-93617717 CTGTTTCATAACTGCTCTATAGG - Intergenic
958400432 3:93620587-93620609 CTGTTTCATAACTGCTCTATAGG - Intergenic
958400609 3:93623481-93623503 CTGTTTCATAACTGCTCTATAGG - Intergenic
958400786 3:93626372-93626394 CTGTTTCATAACTGCTCTATAGG - Intergenic
958401133 3:93632156-93632178 CTGTTTCATAACTGCTCTATAGG - Intergenic
958401313 3:93635047-93635069 CTGCTTCATAACTGCTCTATAGG - Intergenic
958401492 3:93637939-93637961 CTGTTTCATAACTGCTCTATAGG - Intergenic
958401668 3:93640831-93640853 CTGTTTCATAACTGCTCTATAGG - Intergenic
958401841 3:93643725-93643747 CTGTTTCATAACTGCTCTATAGG - Intergenic
958402017 3:93646616-93646638 CTGTTTCATAACTGCTCTATAGG - Intergenic
958402198 3:93649508-93649530 CTGTTTCATAACTGCTCTATAGG - Intergenic
958402565 3:93655295-93655317 CTGTTTCATAACTGCTCTATAGG - Intergenic
960107544 3:113814358-113814380 CAGAATCAGACCTTGTCTCTAGG - Intergenic
961431366 3:126886233-126886255 CTGATTCACAAGTTCTCTTTTGG + Intronic
962226260 3:133612583-133612605 TTGATTCCCAACTTCTTTCTAGG + Intronic
962667532 3:137670135-137670157 CTCAGTCAACACTTCTCTCTTGG - Intergenic
962873849 3:139520410-139520432 CTGATCCAGAAATTCACTCAGGG + Intronic
963728338 3:148946712-148946734 CTGATTCAGAAATATTGTCTGGG - Intergenic
963857198 3:150267014-150267036 CTGGATCAGGACTTCACTCTAGG - Intergenic
971395571 4:26224132-26224154 CTGACACAGAACATCTATCTTGG + Intronic
974057526 4:56998849-56998871 CTGCTTCAGAACTCCTCTCATGG - Intronic
974721687 4:65748061-65748083 ATGTTTCGGAACTTCTTTCTTGG - Intergenic
976271883 4:83238749-83238771 GTGATTCTGCACTACTCTCTGGG + Intergenic
976602554 4:86951214-86951236 CTAATTCAGAACTTCCCAATTGG + Intronic
976607126 4:86994550-86994572 CTGCTTCAGAAATTATCTTTTGG + Intronic
977817272 4:101429494-101429516 CAGAATTACAACTTCTCTCTAGG + Intronic
978601872 4:110437239-110437261 CTGCTTCAAACCTTCTATCTTGG + Intronic
980876591 4:138667848-138667870 ATGATGCATGACTTCTCTCTTGG + Intergenic
984600813 4:181724761-181724783 CTGACTTTGAACTTGTCTCTGGG + Intergenic
987804813 5:22750576-22750598 TTGACTCAGAATATCTCTCTGGG - Intronic
988030363 5:25756087-25756109 CTAATTCAGAAGTTCTCTAAAGG - Intergenic
989319837 5:40121475-40121497 ATGACTCAGAAGTTTTCTCTTGG - Intergenic
989895243 5:47062538-47062560 CTGTTTAAAAACTGCTCTCTCGG + Intergenic
991139499 5:63223999-63224021 GAGATGTAGAACTTCTCTCTGGG + Intergenic
993515852 5:88834120-88834142 ATACTTCAGAACTTCTCTCAGGG + Intronic
994529494 5:100951140-100951162 ATGATTCAGAACTTCTCTGTAGG + Intergenic
995344244 5:111093000-111093022 CTGAGTTAGAAATTCACTCTAGG + Intronic
995409902 5:111844991-111845013 CTGATGCAGAACTGGTCTCTGGG + Intronic
996971334 5:129372039-129372061 CTGCTTCAGAACTTTTCCATGGG - Intergenic
998628379 5:143871447-143871469 CTGATTCAGAACCTCTGACAAGG + Intergenic
999092576 5:148950247-148950269 CTGCTCCAGAACTCCTTTCTTGG - Intronic
1000117037 5:158163057-158163079 GTGATTTAAATCTTCTCTCTCGG + Intergenic
1000265861 5:159635644-159635666 CTGGTTCAGAAATTCTGCCTGGG + Intergenic
1000592606 5:163176666-163176688 CTCTTTCAGAACCTCTCTTTGGG - Intergenic
1001395578 5:171417760-171417782 CTTACTCAGAACTGTTCTCTTGG + Intergenic
1004731844 6:18366533-18366555 CTGAGTCAGGACTGCTCCCTGGG - Intergenic
1004937234 6:20519578-20519600 CTGATTAAGAAGTTCACTCTGGG + Intergenic
1005511335 6:26514393-26514415 CTGATTCAGGAGTTCTCAGTGGG - Intergenic
1005681915 6:28216665-28216687 CTTCTGCAGTACTTCTCTCTGGG + Intergenic
1005842132 6:29750626-29750648 CTGATACAGAACTCAGCTCTGGG + Intergenic
1005945382 6:30591508-30591530 GTGATTCATACCTTCTATCTTGG + Exonic
1011224209 6:85089080-85089102 CTGTTTCAGATCTAATCTCTTGG + Intergenic
1012478514 6:99640870-99640892 CTGACTTAGAACTTGTCTCAAGG - Intergenic
1014375845 6:120671838-120671860 CTGACTCAGACTTTCTCCCTTGG + Intergenic
1015309193 6:131746847-131746869 GTGATGTAGAACTTCTCACTGGG + Exonic
1016640948 6:146348758-146348780 CTGGTTTAGGACTTCTCTCTGGG - Intronic
1016923777 6:149319607-149319629 GTGATTCAGAACTTCTGTTTGGG + Intronic
1018786768 6:167114378-167114400 GTGATTCTGAACTCCTCTCGAGG - Intergenic
1023110116 7:36801494-36801516 CTCATTCAGACATTCTCTCCTGG + Intergenic
1026565546 7:71487058-71487080 CTGATTCAGGACATCTCTGCAGG + Intronic
1027035480 7:74922174-74922196 GTGATTTAAAAATTCTCTCTGGG - Intergenic
1028125741 7:87110896-87110918 CTGATACAGAGCATCCCTCTTGG - Intergenic
1028313221 7:89365372-89365394 CTGATTCTGCTCTTCTCTTTTGG + Intergenic
1029394576 7:100298963-100298985 GTGATTTAAAAATTCTCTCTGGG + Intergenic
1029601515 7:101566169-101566191 CAGATCCAGTACTACTCTCTTGG - Intergenic
1030042866 7:105467725-105467747 CTGAGTAAGCACCTCTCTCTGGG - Intronic
1031880432 7:127192136-127192158 CTGATTAAGAAATTCTACCTGGG + Intronic
1032720980 7:134550759-134550781 ATGTTGCAGAATTTCTCTCTAGG + Intronic
1033714723 7:143988282-143988304 CTGATTAAGCACTTCCCTCTAGG + Intergenic
1033808816 7:144985726-144985748 CTGTTCCAAAACTTCTCTCATGG - Intergenic
1033995724 7:147344463-147344485 CTGCTTCATAATTTTTCTCTGGG + Intronic
1034237208 7:149581241-149581263 CTGATCCAGACATTCTCTCTGGG + Intergenic
1034677066 7:152899414-152899436 CTGATTTATTACTTTTCTCTGGG + Intergenic
1038127387 8:24689901-24689923 CTGGTACAGAACTTATCTCTTGG - Intergenic
1038765468 8:30423734-30423756 CTGAGAGAGATCTTCTCTCTTGG - Intronic
1039618749 8:38977478-38977500 CTGAGTCAGCACATCTATCTGGG - Intronic
1041009806 8:53530655-53530677 CACATTCAGAACTTGTCTCTTGG + Intergenic
1041943040 8:63409547-63409569 CTGATACAGGACTTGGCTCTGGG - Intergenic
1042546191 8:69953774-69953796 CTTTATCAGAACTTCTCTGTAGG - Intergenic
1042839323 8:73107925-73107947 ATGATTCACAACTTCACTCCTGG + Intronic
1045714354 8:105024369-105024391 CAGATTCAGAACTAGTCACTCGG - Intronic
1046214246 8:111121584-111121606 ATGATTCAGATCATCCCTCTAGG - Intergenic
1047554918 8:125918934-125918956 CTGTTTTAGAACCTCTGTCTGGG + Intergenic
1050436176 9:5613003-5613025 TTCTTTCAGAAGTTCTCTCTTGG + Intergenic
1051712155 9:19942416-19942438 CTGATTCAGGACTTATGTCCAGG + Intergenic
1051760697 9:20460502-20460524 CTCTTTCAGAACATCTCCCTTGG + Intronic
1053675503 9:40421479-40421501 ATGATTCAGTACCTCTCACTGGG - Intergenic
1054288777 9:63260005-63260027 ATGATTCAGTACCTCTCACTGGG - Intergenic
1054386602 9:64561542-64561564 ATGATTCAGTACCTCTCACTGGG - Intergenic
1054509118 9:65954813-65954835 ATGATTCAGTACCTCTCACTGGG + Intergenic
1055991859 9:82114820-82114842 CTGATTCAGAAGGTCTGGCTTGG + Intergenic
1056394769 9:86171677-86171699 CTGATAAAGAACTTGTCTCTAGG - Intergenic
1056830978 9:89917210-89917232 TTGACTCAGAGCCTCTCTCTAGG + Intergenic
1057322454 9:94027007-94027029 CTGACTCAGCAATTCACTCTGGG + Intergenic
1057480478 9:95441434-95441456 CTGATTAAAAACTTCTCCCTAGG + Intergenic
1058774925 9:108273597-108273619 CTGACTAAGAACCTTTCTCTTGG + Intergenic
1059210585 9:112511258-112511280 CTGATTCAGTATGTCTGTCTGGG - Intronic
1060538150 9:124408630-124408652 AGTATTCAGAACTTCTCTATGGG + Intronic
1061285718 9:129621300-129621322 CTGATTCAGTACGTCTCTGCTGG + Intronic
1203421363 Un_KI270521v1:855-877 GTGTTTCAAAACTTCTCTTTCGG - Intergenic
1186093753 X:6078053-6078075 TTGAGTCAGAACTTGTGTCTGGG + Intronic
1186397095 X:9220702-9220724 CTGATGCACACCTTCTCTATGGG + Intergenic
1186918727 X:14253058-14253080 CTGATTCAGAAGTTCTAAGTGGG + Intergenic
1189104821 X:38224416-38224438 CAGATTCCAAACATCTCTCTAGG + Intronic
1189304942 X:39979780-39979802 CGGATCCTGAACTTCTCTCTAGG - Intergenic
1189612541 X:42752698-42752720 TTGATTAAGGACTTCTCTCAGGG - Intergenic
1189716293 X:43870215-43870237 CTGTTTCATAATTTCTCTCTTGG + Intronic
1189735947 X:44069994-44070016 CTGATTCAGAAGTTCTGTGGTGG + Intergenic
1191085761 X:56565287-56565309 CTGATTCCGAGCTTCACTCCAGG + Exonic
1191829596 X:65402021-65402043 CAGTTTCAGGACTTCACTCTTGG + Intronic
1192920440 X:75700472-75700494 CTGATTCATTTCTTCTCACTGGG + Intergenic
1193869185 X:86776130-86776152 CTGATTCAGACATGCTCTTTTGG - Intronic
1194947129 X:100082532-100082554 TTGATTCAGACTTTCTTTCTTGG + Intergenic
1195453212 X:105038728-105038750 CTGCTGCAGAACCTCTTTCTAGG + Intronic
1197249458 X:124199902-124199924 GTGATTCACAAATTCACTCTGGG + Intronic
1197967096 X:132076757-132076779 CCCATTCAGAACTTCTCTAATGG - Intergenic
1198371264 X:135991586-135991608 CTGCTTCATCACTTCTCACTTGG + Intronic
1199001162 X:142638167-142638189 CTGTTCTAGACCTTCTCTCTAGG - Intergenic