ID: 1135864675

View in Genome Browser
Species Human (GRCh38)
Location 16:26090445-26090467
Sequence GAATGGATGATCCTCTAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 118
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 108}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1135864675_1135864684 27 Left 1135864675 16:26090445-26090467 CCTTCCTAGAGGATCATCCATTC 0: 1
1: 0
2: 0
3: 9
4: 108
Right 1135864684 16:26090495-26090517 AGGGTGCACAAAATTTCCCATGG 0: 1
1: 0
2: 2
3: 15
4: 151
1135864675_1135864681 7 Left 1135864675 16:26090445-26090467 CCTTCCTAGAGGATCATCCATTC 0: 1
1: 0
2: 0
3: 9
4: 108
Right 1135864681 16:26090475-26090497 TCCTGCAGAGGGGCATGAAAAGG 0: 1
1: 0
2: 1
3: 19
4: 204
1135864675_1135864679 -4 Left 1135864675 16:26090445-26090467 CCTTCCTAGAGGATCATCCATTC 0: 1
1: 0
2: 0
3: 9
4: 108
Right 1135864679 16:26090464-26090486 ATTCTTTTTATTCCTGCAGAGGG 0: 1
1: 0
2: 2
3: 36
4: 521
1135864675_1135864678 -5 Left 1135864675 16:26090445-26090467 CCTTCCTAGAGGATCATCCATTC 0: 1
1: 0
2: 0
3: 9
4: 108
Right 1135864678 16:26090463-26090485 CATTCTTTTTATTCCTGCAGAGG 0: 1
1: 0
2: 2
3: 33
4: 326
1135864675_1135864683 8 Left 1135864675 16:26090445-26090467 CCTTCCTAGAGGATCATCCATTC 0: 1
1: 0
2: 0
3: 9
4: 108
Right 1135864683 16:26090476-26090498 CCTGCAGAGGGGCATGAAAAGGG 0: 1
1: 0
2: 3
3: 30
4: 246
1135864675_1135864680 -3 Left 1135864675 16:26090445-26090467 CCTTCCTAGAGGATCATCCATTC 0: 1
1: 0
2: 0
3: 9
4: 108
Right 1135864680 16:26090465-26090487 TTCTTTTTATTCCTGCAGAGGGG 0: 1
1: 0
2: 2
3: 51
4: 489
1135864675_1135864685 28 Left 1135864675 16:26090445-26090467 CCTTCCTAGAGGATCATCCATTC 0: 1
1: 0
2: 0
3: 9
4: 108
Right 1135864685 16:26090496-26090518 GGGTGCACAAAATTTCCCATGGG 0: 1
1: 0
2: 0
3: 4
4: 77

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1135864675 Original CRISPR GAATGGATGATCCTCTAGGA AGG (reversed) Intronic
903247931 1:22030006-22030028 GAATGCACGATTCTCTAGCAAGG + Intergenic
907131284 1:52099615-52099637 GACTGAACGATCCTGTAGGATGG + Intergenic
909092327 1:71241878-71241900 CAATGGATGATCTTCGTGGATGG - Intergenic
910463206 1:87469737-87469759 GAATAGAGGCTCCTCTAGGCTGG + Intergenic
913646933 1:120866147-120866169 GGCTGGAAGATCTTCTAGGATGG - Intergenic
914395068 1:147258455-147258477 GTATGGAAGTTTCTCTAGGATGG - Intronic
915012744 1:152704165-152704187 AAATTTATGAACCTCTAGGAAGG - Intergenic
915491014 1:156250086-156250108 GGATGGGTGATCCTTGAGGAGGG + Exonic
924945056 1:248840414-248840436 GAATGTCTGATCCTCCTGGATGG - Intronic
1065142615 10:22733990-22734012 TAAAGGATGTTCCTCTAGGGAGG + Intergenic
1066416077 10:35223278-35223300 GAATGTTTGATCCTCTGGCATGG + Intergenic
1067259883 10:44680195-44680217 TAAAGGATGTTCCTCAAGGAGGG + Intergenic
1068008996 10:51424240-51424262 AAATGAATGATACTCTAGAATGG - Intronic
1068742117 10:60485439-60485461 GAAGGGATTATCCTCAGGGAAGG + Intronic
1069630650 10:69895227-69895249 GAAAGGTTGACCCTCTAGGCAGG - Intronic
1072822116 10:98568447-98568469 GAATGAATACTGCTCTAGGAGGG + Intronic
1079507366 11:21168539-21168561 TAATGGATGAGTCACTAGGATGG - Intronic
1080097034 11:28420433-28420455 AAATGGATCATTCTCAAGGATGG + Intergenic
1084409409 11:68997646-68997668 GGATGGCTGAGTCTCTAGGACGG + Intergenic
1085943698 11:81239481-81239503 GAATGGATGCTGCTCTTGCAAGG + Intergenic
1089130048 11:116205044-116205066 GAATGCATGTTCATTTAGGATGG + Intergenic
1092076768 12:5680467-5680489 GAATGGAAGATACTCAAGCAAGG + Intronic
1092923780 12:13256213-13256235 GAATGGAGGATCCTCCAGGGAGG + Intergenic
1106412443 13:29520002-29520024 GAATGGATGGACCGATAGGATGG - Intronic
1107010888 13:35669894-35669916 GAATGGATGAGCCTCTTCTAAGG - Intronic
1113162626 13:107399244-107399266 GAATGTATTATGCTCTGGGAAGG + Intronic
1118013077 14:61629547-61629569 GAATGGGTGAGGTTCTAGGACGG + Intronic
1121937800 14:98036594-98036616 GAATGAATGAGCCTCCAGGTAGG - Intergenic
1126320380 15:47416064-47416086 AAATGGATGATACTCTTGGTTGG - Intronic
1126807142 15:52362244-52362266 GAATGGAGGAAACTCTAGGGAGG - Intronic
1128501657 15:68230963-68230985 GAAGGGATGTGCCTCTTGGAAGG + Intronic
1129174742 15:73831922-73831944 TAATGGGGGATCCCCTAGGAAGG - Intergenic
1131802280 15:96083803-96083825 CAATGCATGATACTCTAGGAAGG + Intergenic
1134106935 16:11492062-11492084 GAATTGATGAGGCTCTAGGCTGG - Intronic
1135392865 16:22108301-22108323 GAATGGATGATCCAGGAGAAGGG + Intronic
1135864675 16:26090445-26090467 GAATGGATGATCCTCTAGGAAGG - Intronic
1137927573 16:52555235-52555257 GAAAGTATGATCCTCCCGGAGGG + Intergenic
1140143067 16:72277903-72277925 GAATGTGTGCTCCTATAGGAGGG + Intergenic
1145833339 17:27935446-27935468 GAAAGGAGGCTGCTCTAGGACGG + Intergenic
1146018949 17:29258938-29258960 GAAAGGATCCTCCTCTATGAAGG + Exonic
1146729812 17:35183649-35183671 CACTGGATGATCCTCTGGGGAGG + Intronic
1147254218 17:39172545-39172567 GAATGAATGATTCTGTAGGAAGG + Intergenic
1147435851 17:40414506-40414528 GTATAGATGATCCTCTTGAAAGG - Intronic
1148760516 17:49997353-49997375 GAATGGATGAACCCCTGAGAAGG - Intergenic
1153749421 18:8213434-8213456 GAATGGGTGAAACTTTAGGATGG + Intronic
1154114920 18:11605347-11605369 GAATGGATAATCATCTAGCCAGG + Intergenic
1157266943 18:46233269-46233291 GAATGGATGACTCTTTAGCAGGG + Intronic
1159622910 18:70659361-70659383 GAATGGATGAGCCTGAAGCATGG - Intergenic
1160290968 18:77593193-77593215 GAATTAAGGATTCTCTAGGAGGG - Intergenic
1161139401 19:2638618-2638640 GGCTGGATGATTCTCTTGGATGG + Intronic
1163099849 19:15088277-15088299 AAAAGGCTGATCCTCCAGGAGGG - Intergenic
1165150148 19:33755487-33755509 GAATGAATGATTCACTAGCAGGG - Intronic
1165922693 19:39308531-39308553 GACGGGATCATCCTGTAGGAGGG + Exonic
925376074 2:3387318-3387340 GAATGGTGGATGCTCTAGGCGGG + Intronic
927641363 2:24847732-24847754 GAAAAGATGAGCCTCTAGGAAGG + Intronic
930879555 2:56255678-56255700 TCATTGATGATCTTCTAGGAAGG + Intronic
931459095 2:62434664-62434686 GAATGAATGATCCACTAAGGTGG + Intergenic
932378434 2:71259500-71259522 CAAGGGAGGATCCTCAAGGAAGG - Intergenic
932524533 2:72449877-72449899 GAATAGCTGATTCTCTGGGATGG - Intronic
936709636 2:115117910-115117932 GCATGGATGAACATCTAAGAGGG + Intronic
939308695 2:140443431-140443453 TAATGGATGAGCTTCTAGAATGG + Intronic
939910448 2:147976616-147976638 TAAGGGATGATCCTGTGGGATGG - Intronic
941932997 2:170961164-170961186 GAGCAGATGAACCTCTAGGATGG - Intronic
942923920 2:181410415-181410437 GGATGCATGGTCCCCTAGGAAGG - Intergenic
1169605523 20:7314468-7314490 GACTGAAGGATCCTCTGGGATGG + Intergenic
1170962663 20:21039316-21039338 GAATGGATGAGCCTCAAGTCAGG - Intergenic
1172886827 20:38236930-38236952 GGAAAGATGATCCTGTAGGAAGG + Intronic
1173919423 20:46732754-46732776 GAATGAATGATGCTCAAGGAAGG + Intronic
1174776792 20:53350375-53350397 GGTTGGATGGACCTCTAGGACGG + Intronic
1175178365 20:57127600-57127622 TAATGGATGATCCCGGAGGATGG - Intergenic
1179103712 21:38379309-38379331 AAATGGATGCTCGTCTAGAAGGG - Intergenic
1182235612 22:28873864-28873886 GGAAGGATGATACCCTAGGAAGG + Intergenic
1183235743 22:36615668-36615690 GAATGGACGATCCACGAGGGCGG + Intronic
952819483 3:37473506-37473528 GAATGAATGATCTGTTAGGAAGG + Intronic
953420674 3:42751091-42751113 GACTGAATTATCCTCAAGGAAGG + Intronic
953732038 3:45458169-45458191 GAAAGGATGAACTTATAGGATGG - Intronic
955899953 3:63742227-63742249 TAAAGGATGGACCTCTAGGAGGG + Intergenic
957035259 3:75288500-75288522 AAATGCATGACCCTCCAGGAAGG - Intergenic
961079142 3:124010097-124010119 AAATGCATGACCCTCCAGGAAGG - Intergenic
961304332 3:125946372-125946394 AAATGCATGACCCTCCAGGAAGG + Intergenic
962194726 3:133351567-133351589 GAGATGATGATACTCTAGGAAGG + Intronic
965366953 3:167812951-167812973 TAATAGATAATCCTCTTGGAAGG + Intronic
967051817 3:185791935-185791957 CAATGGGGGATCTTCTAGGACGG + Intronic
971877616 4:32325624-32325646 AAACGGATGAACCTCAAGGAGGG + Intergenic
974013814 4:56630877-56630899 GAAGGCATGATGCTCTAGGCTGG - Intergenic
978325953 4:107555143-107555165 AAATGGAAGATCCTCTATGGAGG - Intergenic
978631856 4:110756763-110756785 AAATGCATTATCCTCTAAGATGG - Intergenic
980096454 4:128496281-128496303 AAATGGGTCATCTTCTAGGAAGG + Intergenic
986159620 5:5215047-5215069 GGATGGATGATATTTTAGGAAGG + Intronic
991214246 5:64143812-64143834 GAATGGATGACCTTTTAAGATGG + Intergenic
992778187 5:80106059-80106081 AAATGGAAGATCCTCTGAGAAGG + Intergenic
996366140 5:122703371-122703393 CAATGGATGTTCCAGTAGGAGGG - Intergenic
998015325 5:138726932-138726954 GGCTGGCTGATCCTCAAGGAAGG + Intronic
1004245337 6:13969993-13970015 AAATGGATGAATCTCTAGGATGG - Intronic
1005262630 6:24078214-24078236 GAATGGATTATCATCTAGTTAGG - Intergenic
1006331909 6:33397760-33397782 GAATGGATGCTCTTCCTGGAAGG - Intronic
1006973658 6:38075233-38075255 AAATGGAAGATCATCTAGAAAGG + Intronic
1007996199 6:46310803-46310825 AAATGGATGATGCTCTATGTAGG + Intronic
1015352057 6:132231769-132231791 AAATGGATGAGCCTCTAGGTGGG - Intergenic
1019146399 6:169978026-169978048 AAATGGATGCTCCTTTTGGATGG + Intergenic
1026276269 7:68879790-68879812 TAATGGATGATCATTTAGAAAGG + Intergenic
1031277969 7:119755934-119755956 GAATGGAAGATGCTTTATGAAGG + Intergenic
1032455210 7:132067975-132067997 AAATGGATGATTCTTGAGGAGGG - Intergenic
1033561564 7:142536843-142536865 GAATGGATTAACCTTTATGAGGG + Intergenic
1045458670 8:102407833-102407855 GCATTGAAGATCATCTAGGATGG + Intronic
1046724818 8:117662982-117663004 GTAGGGATGATTTTCTAGGATGG - Intergenic
1047863236 8:128991909-128991931 TAAGGGATGCTCATCTAGGATGG - Intergenic
1049022475 8:139967091-139967113 GGCTGGATGATCCTGTAGGAAGG - Intronic
1054784883 9:69201029-69201051 GAATGAATGAGCCTCTTGGTGGG + Intronic
1056423382 9:86452282-86452304 GAATGGAGAACCCTCTACGAAGG - Intergenic
1061773169 9:132943893-132943915 GAATGAATGAACGCCTAGGAGGG + Intronic
1185857520 X:3549878-3549900 GGGTGGATGATCCTCTGGGGTGG - Intergenic
1187813577 X:23207216-23207238 GAATGGATGATCATAAAGCAAGG - Intergenic
1188740842 X:33779278-33779300 AAATGGATTAACCTCTAGTAAGG - Intergenic
1190920848 X:54851298-54851320 GAAAGGATCATCCCCTAGGCTGG + Intergenic
1191679785 X:63829329-63829351 GAATTGATGTTTCTGTAGGAGGG + Intergenic
1195034642 X:100961313-100961335 AAATGGAGGAGCCTCTGGGATGG + Intergenic
1196189252 X:112777894-112777916 GAATGTATGAACCTCCAGGAGGG + Exonic