ID: 1135864682

View in Genome Browser
Species Human (GRCh38)
Location 16:26090476-26090498
Sequence CCCTTTTCATGCCCCTCTGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 241
Summary {0: 1, 1: 0, 2: 2, 3: 18, 4: 220}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1135864682_1135864686 2 Left 1135864682 16:26090476-26090498 CCTGCAGAGGGGCATGAAAAGGG 0: 1
1: 0
2: 2
3: 18
4: 220
Right 1135864686 16:26090501-26090523 CACAAAATTTCCCATGGGAGTGG 0: 1
1: 0
2: 0
3: 21
4: 178
1135864682_1135864685 -3 Left 1135864682 16:26090476-26090498 CCTGCAGAGGGGCATGAAAAGGG 0: 1
1: 0
2: 2
3: 18
4: 220
Right 1135864685 16:26090496-26090518 GGGTGCACAAAATTTCCCATGGG 0: 1
1: 0
2: 0
3: 4
4: 77
1135864682_1135864684 -4 Left 1135864682 16:26090476-26090498 CCTGCAGAGGGGCATGAAAAGGG 0: 1
1: 0
2: 2
3: 18
4: 220
Right 1135864684 16:26090495-26090517 AGGGTGCACAAAATTTCCCATGG 0: 1
1: 0
2: 2
3: 15
4: 151
1135864682_1135864687 3 Left 1135864682 16:26090476-26090498 CCTGCAGAGGGGCATGAAAAGGG 0: 1
1: 0
2: 2
3: 18
4: 220
Right 1135864687 16:26090502-26090524 ACAAAATTTCCCATGGGAGTGGG 0: 1
1: 0
2: 5
3: 16
4: 186

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1135864682 Original CRISPR CCCTTTTCATGCCCCTCTGC AGG (reversed) Intronic
900205740 1:1431256-1431278 CTCATTTCATGCCCCCCTCCTGG - Intergenic
900788482 1:4664569-4664591 CCCCGGTCATGCCCTTCTGCCGG + Intronic
901272097 1:7960403-7960425 CCCTGTTCATCCCCTTCTCCTGG - Intronic
901427195 1:9189841-9189863 TCCTTTTCAGTCTCCTCTGCTGG + Intergenic
901636562 1:10673107-10673129 CCCTTTTCCAGCCCCTCCGCAGG - Intronic
901654538 1:10761919-10761941 CCCTTTCCTTCCCCCTTTGCGGG + Intronic
902090270 1:13897609-13897631 TCATTTTCATGCCACCCTGCAGG + Intergenic
902868234 1:19295334-19295356 CCCTTTTTGCACCCCTCTGCTGG - Intergenic
903061224 1:20670260-20670282 TCCTTTTCATGCCCCTCCATTGG - Intronic
905375156 1:37514936-37514958 GCCGTTTCCTGCCCCTCGGCTGG + Intergenic
908432119 1:64069690-64069712 CCATTGTCATGAACCTCTGCAGG - Intronic
916503530 1:165407479-165407501 CCCTTCTCAGGTTCCTCTGCTGG + Intronic
917292491 1:173485463-173485485 CCCTTTTCATCCTTCTCTGCTGG - Exonic
918587350 1:186203188-186203210 CCTTTTTCCTGGCCCTTTGCAGG + Intergenic
921107946 1:212001826-212001848 TCCTTTTCAGGCCCCTTTGCTGG + Intronic
922691884 1:227699510-227699532 CCCTTTGCATACCCCTATACTGG + Intergenic
924205849 1:241710727-241710749 CCCTCCTCTTGCCCCTGTGCTGG - Intronic
924321767 1:242858097-242858119 CCCTTTTCCAGAACCTCTGCCGG - Intergenic
1062863709 10:831452-831474 CCCTGTTCATGTCCCTCTCAGGG - Intronic
1063392641 10:5660345-5660367 CCCCTCTCTTGCCCCTTTGCTGG + Intronic
1063433157 10:6008613-6008635 AGGTTTTCCTGCCCCTCTGCTGG + Intergenic
1064065939 10:12181628-12181650 GCCATTTCATGACCCTCTGTGGG + Intronic
1067695864 10:48535317-48535339 CCCTTTTCATGCTGACCTGCAGG - Intronic
1069721379 10:70551618-70551640 TCCTTTTCCTGGCCCCCTGCCGG + Intronic
1069806849 10:71131671-71131693 CCCTTTTGGTGCCCCTCTCTGGG + Intergenic
1071102442 10:82054666-82054688 TCGTTTTCATTCCCCTTTGCTGG - Intronic
1071374719 10:84990855-84990877 ACATTTGCAAGCCCCTCTGCTGG - Intergenic
1071425233 10:85542826-85542848 GCCTATTGATGCCCCTCTGGAGG - Intergenic
1071427394 10:85572703-85572725 CCCTTGTCATGAGCCTCTGATGG + Intergenic
1074314251 10:112347313-112347335 CCCTTTTCCAGCCCACCTGCTGG + Intergenic
1074517793 10:114187032-114187054 CCCTTTTAATTCCCCTGGGCAGG + Intronic
1075879986 10:125842662-125842684 TGCTTTTCATGCCTCTCTACTGG - Intronic
1076244008 10:128932262-128932284 CCTTTCCCATGGCCCTCTGCTGG - Intergenic
1076427415 10:130377452-130377474 CCCATTCCATGCCTCTCTCCTGG - Intergenic
1077007714 11:366341-366363 CCCTCTGCAAGCACCTCTGCTGG - Intergenic
1077105094 11:838716-838738 CCCTGTTCATGTGCCTCTGCGGG + Exonic
1077226984 11:1442850-1442872 CCACTTACATGCCCCTCTCCTGG + Intronic
1077334462 11:1997282-1997304 CCCCCATCCTGCCCCTCTGCTGG + Intergenic
1077902146 11:6498087-6498109 CCCTTCTCTGGCCCCTCTGCTGG + Exonic
1080564884 11:33498826-33498848 CCTTTTCCTCGCCCCTCTGCAGG - Intergenic
1080587711 11:33696660-33696682 TCCTTTTCATTCTCCTTTGCAGG + Intergenic
1081669605 11:44935662-44935684 CCCTTTTCATCCCCCGCCCCAGG - Exonic
1083543909 11:63535163-63535185 CTGTTTTTATGGCCCTCTGCAGG - Intergenic
1084899261 11:72297495-72297517 CCCTTTTCCTGCCCCAAGGCAGG - Intronic
1085398361 11:76219218-76219240 CCCTTCTCAAGGCCCTGTGCTGG - Intergenic
1088325706 11:108598766-108598788 CCTTTTTTATGTCCCTCTTCTGG - Intergenic
1089808238 11:121111093-121111115 CCCTTTTCCTTCCCTTCTGTTGG - Intronic
1090413316 11:126523671-126523693 CCCATTTCCAGCCCCTCTCCTGG - Intronic
1202817445 11_KI270721v1_random:52464-52486 CCCCCATCCTGCCCCTCTGCTGG + Intergenic
1094777745 12:33750998-33751020 CCCATTTTGTGCCTCTCTGCTGG - Intergenic
1095418847 12:42004195-42004217 CCTTTCCCCTGCCCCTCTGCTGG - Intergenic
1096806695 12:54145353-54145375 TCCTTCTCATGCCCCTCTACTGG - Intergenic
1099873051 12:88371566-88371588 CCCTTTTCATTACCCACAGCTGG + Intergenic
1102572459 12:113835447-113835469 CCCTTGTCATGCCCCTCCCCTGG - Intronic
1103023911 12:117558293-117558315 CCTGTTTCTTGCCCCTCTACTGG - Intronic
1103564387 12:121808186-121808208 CCCCTTTCCTGCCCATCTACAGG + Exonic
1104711992 12:130993864-130993886 CCCTTTTCTCGCCCAGCTGCAGG + Intronic
1104960497 12:132486493-132486515 CCCTTTTCTCTCCACTCTGCTGG - Intergenic
1108409834 13:50134390-50134412 TCATTTTCATGCCTTTCTGCAGG - Intronic
1108530759 13:51325056-51325078 CCCATTGCGTGCCCCTCTGCAGG - Intergenic
1108802694 13:54118836-54118858 CCCTTTTCATGTTACTCTGTGGG - Intergenic
1109439296 13:62349025-62349047 CCCTTTTCATTCCTGTCTGTGGG - Intergenic
1110014387 13:70382753-70382775 CCGATTTCAGGCCTCTCTGCAGG - Intergenic
1110262250 13:73498720-73498742 CTCTGTTCCTGCCCCTCTACAGG + Intergenic
1111327540 13:86719035-86719057 CCCTTTTCTTGCCCCTCCTCTGG + Intergenic
1112634470 13:101199929-101199951 CCCTTTGCATGCTCCTTTGCTGG + Intronic
1113554040 13:111216757-111216779 CCCTTTTCTTGCTCCTGTGCCGG + Intronic
1114486206 14:23063549-23063571 CCATTCTCCTGGCCCTCTGCAGG + Exonic
1114548997 14:23522620-23522642 CCCTTTCCATTGCCCCCTGCTGG - Exonic
1115510834 14:34136476-34136498 CCCTTTTCCTGCCTCTCTAGTGG + Intronic
1116966791 14:51023034-51023056 TCCTTTTCATTCCCTTCAGCAGG - Intronic
1117373769 14:55102329-55102351 CGCTATTCATGCCCTCCTGCAGG - Intergenic
1117508929 14:56429412-56429434 CCTTTTACCTGCCCCTCTCCTGG + Intergenic
1117629448 14:57674803-57674825 CCCTCTTCATGTCACTCTGTAGG - Intronic
1117848512 14:59940039-59940061 TCCTTTTCAGTCTCCTCTGCAGG - Intronic
1118952494 14:70447084-70447106 CCCTCCTCATGTCCCTCTACAGG + Intergenic
1119155421 14:72405752-72405774 CTCCTTGCCTGCCCCTCTGCTGG + Intronic
1122116348 14:99529273-99529295 CCCTTCCCAGGTCCCTCTGCAGG + Intronic
1122268635 14:100558391-100558413 CCCTTCTCAGGCTCCTCTGTGGG + Intronic
1122551094 14:102550449-102550471 CCTTTTCCAGGCCCCTGTGCAGG + Intergenic
1125172916 15:36786921-36786943 CCCTGTTGATGCCTGTCTGCCGG + Intronic
1126428681 15:48557426-48557448 CCCTTCTGTTGCTCCTCTGCAGG - Intronic
1126748278 15:51849528-51849550 CCCATCTCATTCTCCTCTGCTGG - Intronic
1126910468 15:53412089-53412111 CCCTGTTCCTGACCCTCTGATGG - Intergenic
1127798464 15:62457685-62457707 CCTTTGTCAAGTCCCTCTGCTGG - Intronic
1128247816 15:66144757-66144779 ACCTTTACCTGCACCTCTGCAGG + Intronic
1129257850 15:74344201-74344223 TCCTCCACATGCCCCTCTGCAGG - Intronic
1133528226 16:6627218-6627240 CCCATCTCATTCCCCTGTGCTGG - Intronic
1135864682 16:26090476-26090498 CCCTTTTCATGCCCCTCTGCAGG - Intronic
1137384868 16:48031931-48031953 CCCTTGTCATTCCTCTCTGCAGG + Intergenic
1138395463 16:56701069-56701091 CGCTTTTTATTCCCCACTGCTGG + Intronic
1142484445 17:237466-237488 CCCTCCTCAGGCCTCTCTGCAGG - Intronic
1142956555 17:3526957-3526979 CCCTCTTCATGGCCCTCAGCAGG + Intronic
1144789354 17:17848772-17848794 CCCTTTTGTTGCCTCTGTGCAGG - Intronic
1148130206 17:45257717-45257739 CCCCATTCCTGCTCCTCTGCCGG + Intronic
1148807605 17:50272184-50272206 CCCTCCTCCTGCCCCTCTTCAGG + Intronic
1150644179 17:66967977-66967999 CCTTCTGCCTGCCCCTCTGCTGG + Intronic
1151362377 17:73596358-73596380 ACCGTGTCATGCCCCTCTCCAGG - Intronic
1151731677 17:75915037-75915059 CCCTTTCCATGGCCATCTGCTGG + Exonic
1151843928 17:76637736-76637758 AGCTCTTCTTGCCCCTCTGCAGG - Intronic
1152033757 17:77859238-77859260 TCCTTTTCCTGCCTCCCTGCTGG - Intergenic
1152083824 17:78205349-78205371 CCCTGGTCCTGCCCCTCTGGCGG + Intronic
1152757723 17:82093938-82093960 CTCTGTTCTGGCCCCTCTGCAGG - Intronic
1153459353 18:5316406-5316428 TCCTTTTAATACTCCTCTGCTGG - Intergenic
1153930105 18:9870686-9870708 CCCTTTTCATTTTCCTTTGCTGG + Intergenic
1158695248 18:59697549-59697571 CCCTTTACCTGCTTCTCTGCTGG - Intergenic
1161253764 19:3295152-3295174 CCCTTGCCCTGCCCCTCTACTGG + Intronic
1161595812 19:5150550-5150572 CCCTCCTCTTGCACCTCTGCTGG + Intronic
1162646673 19:12055044-12055066 CCCGATTCTTGCCCCACTGCAGG - Intergenic
1163301530 19:16450399-16450421 CCTGTGTCATGCCCCACTGCAGG + Intronic
1164560013 19:29284443-29284465 CCCATTTCAGGCCCCTCCACAGG + Intergenic
1165301885 19:34975370-34975392 CCCTTTTCCTGCTCCTCTTGAGG + Intergenic
1166232299 19:41431999-41432021 CCCTTTCCATGCCCCTGTTCAGG - Exonic
1166232378 19:41432396-41432418 CCCTTTTCAGGAACCTCCGCAGG - Exonic
1168294714 19:55373057-55373079 CCCTTTTCTTGCTCCCCAGCTGG - Intergenic
925200768 2:1966035-1966057 CCCCTTTCAGGCTCCTGTGCTGG + Intronic
925796582 2:7551747-7551769 CCCTCTTCAACCCCCTCTCCAGG + Intergenic
926674129 2:15605312-15605334 TCCTCCTCATTCCCCTCTGCTGG - Intronic
927144680 2:20155099-20155121 CCCTTCTCAAGGTCCTCTGCTGG - Intergenic
927384561 2:22518133-22518155 CCCTTTACCTGCCCCCATGCTGG - Intergenic
929861320 2:45680351-45680373 CCCCCTTCTTTCCCCTCTGCAGG + Intronic
929995938 2:46826253-46826275 CCCTTTCCTTTCCCCTCTTCAGG + Intronic
931759321 2:65402581-65402603 CCCTTCTCCTTTCCCTCTGCAGG - Intronic
933947377 2:87298318-87298340 CCCTTTTTATGCCTCTCAGGAGG + Intergenic
935623652 2:105150377-105150399 TCCTCGTCCTGCCCCTCTGCTGG + Intergenic
935745003 2:106182735-106182757 CCCTCTTCACGCCTCACTGCAGG + Intronic
936332817 2:111563249-111563271 CCCTTTTTATGCCTCTCAGGAGG - Intergenic
938379657 2:130829403-130829425 CCCGATTCTTGCCCCTCTGACGG - Intergenic
938588737 2:132716862-132716884 CCCTTTTCAAGCCTGTCTGAGGG + Intronic
939431725 2:142118085-142118107 CCCTTTTTCTTCCCTTCTGCAGG - Intronic
942594102 2:177575819-177575841 CTCTTTTGATGCCCTTCTCCTGG + Intergenic
943725913 2:191251159-191251181 CCCTTTTCTTACCCCCTTGCTGG + Intronic
944486206 2:200208377-200208399 CCCTCTCCATGCCCCACTCCAGG - Intergenic
944697963 2:202219706-202219728 CCCTTTTCCTGACCCTTTTCTGG - Intronic
946900549 2:224367881-224367903 CCCTTTTCATGTCCCCGTGAGGG - Intergenic
948191763 2:236064630-236064652 CTCTTTCCATGCTCCTCAGCAGG - Intronic
1170560485 20:17553089-17553111 TCCTTTTCAGGCTCCTTTGCTGG - Intronic
1170895417 20:20408651-20408673 CCCTTTCAAGGCCTCTCTGCCGG + Intronic
1171797405 20:29577234-29577256 CCATTTTCCAGCCCCTCTCCCGG - Intergenic
1171850847 20:30306927-30306949 CCATTTTCCAGCCCCTCTCCAGG + Intergenic
1172856167 20:38004370-38004392 CCCATTTCAGTTCCCTCTGCTGG + Intronic
1173261543 20:41440704-41440726 CCTTTTTGAGGCCCCTCTTCTGG - Intronic
1173813342 20:45969688-45969710 CCTGTTTCATGCCCCTCAGGAGG - Exonic
1175581548 20:60103703-60103725 CCCTTTCTATGCCCCCCAGCTGG - Intergenic
1175966932 20:62664484-62664506 CCTTTTTCAGGCCCTGCTGCTGG + Intronic
1178314624 21:31558311-31558333 CGCTTTTAATGCCCCCCTCCGGG + Intronic
1178387207 21:32162413-32162435 CCCATCTCTTGCCCCTCTGTGGG + Intergenic
1178621542 21:34181334-34181356 ACATTTTCATGACCCTCTGAGGG - Intergenic
1178674990 21:34623319-34623341 CCCTTCTCAGGCACCACTGCTGG - Intergenic
1179819374 21:43927857-43927879 CCCTCACCAGGCCCCTCTGCAGG - Intronic
1181173928 22:21025546-21025568 CCCTTCACATCCCCCGCTGCTGG + Intronic
1181545329 22:23599215-23599237 CCCTGTTCCTGCCCCTCTGCAGG + Intergenic
1182473457 22:30562581-30562603 TCCCTTCCATGCCCCGCTGCAGG + Intronic
1184378337 22:44129250-44129272 CCCTTCTGAGGCCCCTCTCCTGG - Intronic
949105532 3:197252-197274 CCCTTTTCACGCCCCGCCCCCGG + Intronic
950432368 3:12958234-12958256 CCCTTTCTGTGCCCCTGTGCTGG - Intronic
950442485 3:13018228-13018250 GCCATCTGATGCCCCTCTGCAGG - Intronic
951607303 3:24450289-24450311 CCATTTACCTGCCTCTCTGCAGG - Intronic
951645463 3:24885767-24885789 CCCATTTAATGCTCTTCTGCTGG + Intergenic
952982191 3:38745859-38745881 TCCTTTTCAGTCTCCTCTGCTGG + Intronic
953215853 3:40917401-40917423 CTATTTTCCTGCCCCTCAGCTGG - Intergenic
954684350 3:52362289-52362311 CCCTGTTGATGCCCCTGTCCTGG - Intronic
956917430 3:73887092-73887114 CCCATTTCAGGCCCCTCTTCTGG + Intergenic
960639135 3:119810169-119810191 CCTTCTTCATGCCGCTCTCCAGG - Exonic
964133172 3:153313817-153313839 CCCTTCTCAGGCTCCTCTGTAGG + Intergenic
965871628 3:173271947-173271969 TCTTTTTCATGTCCCTCTGTTGG - Intergenic
966157339 3:176931086-176931108 CACTTTTAATGCCTGTCTGCTGG - Intergenic
967533636 3:190577551-190577573 GCCTTTTCTTTCCCCCCTGCAGG + Intronic
967793381 3:193572773-193572795 CCCTTTACATTCCCATCAGCTGG - Intronic
969247724 4:5946168-5946190 CCCTTGTCCTGCCCCTGAGCAGG + Intronic
972699895 4:41483632-41483654 CCCTTCTCATCCCCACCTGCCGG + Intronic
974744727 4:66057268-66057290 CCCTGTTCATGTGACTCTGCTGG + Intergenic
979730377 4:124016808-124016830 CCCATTTTATGCCACACTGCTGG + Intergenic
980642301 4:135596454-135596476 CCCTTTTTGTGCCTCTCTACTGG + Intergenic
984822580 4:183895358-183895380 GCCATTTGATGCCCCTCTGCTGG + Intronic
985616158 5:923165-923187 CCCTTCTCCTGCCCCTCCTCAGG - Intergenic
986757186 5:10848747-10848769 CCCTTTTCGTGCTCCACTTCTGG - Intergenic
992781998 5:80136333-80136355 CCTTTTTCCTGCCCTTATGCTGG - Intronic
994265064 5:97705310-97705332 CCCTTCTGCTGCCCGTCTGCTGG + Intergenic
997169589 5:131702857-131702879 TCCTTTTCCTTCGCCTCTGCTGG + Intronic
997241086 5:132308793-132308815 CCCTCTCCCTGCCCCTCTGATGG - Intronic
1001256760 5:170189330-170189352 ACATTTTCATGCCTCACTGCGGG + Intergenic
1002457992 5:179356555-179356577 CGCTTCTCCAGCCCCTCTGCAGG + Intergenic
1002898854 6:1394095-1394117 CTCTTCTCCTGCCCCTCCGCAGG - Intronic
1003057080 6:2831664-2831686 CACTTCTCATTCCCCTCTTCTGG + Intergenic
1003059687 6:2853481-2853503 CCCTTTCCCTGACCCTCTCCTGG + Intergenic
1003059724 6:2853572-2853594 CCCTTTCCCTGACCCTCTCCTGG + Intergenic
1003059738 6:2853604-2853626 CCCTTTCCCTGACCCTCTCCTGG + Intergenic
1003975960 6:11344927-11344949 CTCATTTCAAGCCCTTCTGCTGG + Intronic
1004025183 6:11811322-11811344 ACCATTTCATTCCCCTCTTCCGG + Intergenic
1010029273 6:71256298-71256320 CTGTTTTTATGACCCTCTGCCGG + Intergenic
1011335868 6:86259206-86259228 CCCTCTTCATCCCCCCTTGCTGG - Intergenic
1011805108 6:91062563-91062585 CACTTTTCATGCCTTTCTGGTGG - Intergenic
1015791329 6:136967390-136967412 CCTTCTGCATGCCCCACTGCAGG - Intergenic
1022286501 7:28959026-28959048 CCCTTCTGATGGCCTTCTGCAGG - Intergenic
1023767480 7:43524872-43524894 AGCATTTCATGCCCCTCTACAGG - Intronic
1024113256 7:46168829-46168851 TCCTTTCCATGCCCTTCTTCGGG + Intergenic
1024218067 7:47264636-47264658 CCCTTTGCATTCCTATCTGCTGG + Intergenic
1028269716 7:88773784-88773806 CCCCTTTCTTGCCCCTGTTCTGG - Intronic
1028416069 7:90581901-90581923 CTCTGTTCATGCCCCTTTGCAGG + Intronic
1032433318 7:131880444-131880466 CCCTTTGGTTGTCCCTCTGCAGG + Intergenic
1034260416 7:149751791-149751813 CCCTCTTTAAGCCCCTCTGTGGG - Intergenic
1034546595 7:151793675-151793697 GCCTTGGCAGGCCCCTCTGCTGG + Intronic
1034826462 7:154269442-154269464 CCCTTGTCCTGCCCTTCTCCTGG + Intronic
1035579286 8:730076-730098 CCTTGTTCATGACCCTCTCCTGG - Intronic
1037822719 8:22142785-22142807 CCGGTTCCATGGCCCTCTGCAGG - Intergenic
1037960770 8:23096340-23096362 CAGTTTTTATGGCCCTCTGCAGG - Intronic
1037970992 8:23171783-23171805 CGGTTTTTATGGCCCTCTGCAGG + Intergenic
1040508358 8:48071836-48071858 CACTTTTCATGGCCCTCTGCTGG + Intergenic
1041428535 8:57751106-57751128 CCCTTTGCATGCCAGTGTGCTGG + Intergenic
1043565063 8:81538620-81538642 TCTTTTTCATGCCTCTCTTCTGG - Intergenic
1044822400 8:96163206-96163228 CCCCTTCACTGCCCCTCTGCTGG + Intergenic
1045036865 8:98182627-98182649 TCTGTTTCATGCCTCTCTGCTGG + Intergenic
1045711028 8:104984198-104984220 CCTTTTTCCTGCCACTTTGCAGG + Intronic
1048596593 8:135873235-135873257 CCATCTTCATAACCCTCTGCAGG + Intergenic
1049069988 8:140349060-140349082 CCCCCTTCAGCCCCCTCTGCCGG - Intronic
1049614826 8:143571569-143571591 CCCTTTTCAGCTCCCTCTTCTGG + Intronic
1050873385 9:10604490-10604512 CCATTTTCCTGCCCCTCAGGAGG - Intronic
1053482764 9:38428227-38428249 CACTTTCCAGGCCACTCTGCAGG + Intergenic
1053788626 9:41670219-41670241 CCATTTTCCAGCCCCTCTCCCGG + Intergenic
1054156512 9:61644549-61644571 CCATTTTCCAGCCCCTCTCCCGG - Intergenic
1054176911 9:61881558-61881580 CCATTTTCCAGCCCCTCTCCCGG + Intergenic
1054476283 9:65575558-65575580 CCATTTTCCAGCCCCTCTCCCGG - Intergenic
1054660624 9:67699248-67699270 CCATTTTCCAGCCCCTCTCCCGG - Intergenic
1055803431 9:80066472-80066494 CCCTTTTCATTCTCCTTTCCAGG + Intergenic
1057204862 9:93165196-93165218 CTCATGTCATGCCCCTCTGTAGG - Intergenic
1057271631 9:93654784-93654806 CCCATTGCTGGCCCCTCTGCAGG - Intronic
1057812349 9:98267807-98267829 CCCTTTTCATTACCCACAGCTGG - Intergenic
1059973111 9:119687743-119687765 CCCTTTTCAAATCCCTCTGATGG + Intergenic
1060735042 9:126061457-126061479 TCCTTTCCATCCCCCTCTGGTGG - Intergenic
1061048551 9:128180676-128180698 CCCCATTCATGTCCCTCTGAAGG + Intronic
1186818731 X:13264493-13264515 TCCTTTTCATGCTCCTTTGGTGG + Intergenic
1186998449 X:15149352-15149374 CCATTGGCAGGCCCCTCTGCAGG + Intergenic
1187065994 X:15838529-15838551 CCCTTTGCAGGTCCCTGTGCAGG + Intronic
1190031342 X:46976128-46976150 CCCTATTCACTGCCCTCTGCAGG - Intronic
1190286934 X:48967515-48967537 CCCTTTTCATTCCCCTATAGGGG + Intronic
1192039255 X:67600144-67600166 TCCTTTCCATGTCCCTCTCCAGG - Intronic
1197708802 X:129652154-129652176 CCCTTCTCCTCCCCCTCCGCAGG - Intronic
1199340066 X:146667143-146667165 TCCTATTCATGTCCCTCTGGAGG - Intergenic
1200092025 X:153640448-153640470 GCCTTTGCATGCTCCTCTTCCGG + Intergenic
1200107883 X:153724723-153724745 CCCTGTTCTCGCCCCTCGGCGGG - Intergenic