ID: 1135864685

View in Genome Browser
Species Human (GRCh38)
Location 16:26090496-26090518
Sequence GGGTGCACAAAATTTCCCAT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 82
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 77}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1135864682_1135864685 -3 Left 1135864682 16:26090476-26090498 CCTGCAGAGGGGCATGAAAAGGG 0: 1
1: 0
2: 2
3: 18
4: 220
Right 1135864685 16:26090496-26090518 GGGTGCACAAAATTTCCCATGGG 0: 1
1: 0
2: 0
3: 4
4: 77
1135864677_1135864685 11 Left 1135864677 16:26090462-26090484 CCATTCTTTTTATTCCTGCAGAG 0: 1
1: 0
2: 4
3: 67
4: 583
Right 1135864685 16:26090496-26090518 GGGTGCACAAAATTTCCCATGGG 0: 1
1: 0
2: 0
3: 4
4: 77
1135864676_1135864685 24 Left 1135864676 16:26090449-26090471 CCTAGAGGATCATCCATTCTTTT 0: 1
1: 0
2: 2
3: 19
4: 207
Right 1135864685 16:26090496-26090518 GGGTGCACAAAATTTCCCATGGG 0: 1
1: 0
2: 0
3: 4
4: 77
1135864675_1135864685 28 Left 1135864675 16:26090445-26090467 CCTTCCTAGAGGATCATCCATTC 0: 1
1: 0
2: 0
3: 9
4: 108
Right 1135864685 16:26090496-26090518 GGGTGCACAAAATTTCCCATGGG 0: 1
1: 0
2: 0
3: 4
4: 77

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1135864685 Original CRISPR GGGTGCACAAAATTTCCCAT GGG Intronic
900283013 1:1883897-1883919 GGTTTCAGAAAATTTCTCATAGG - Intronic
900330672 1:2133035-2133057 GGGTGAACAAACTCTCCCACAGG - Intronic
908607475 1:65814403-65814425 AGGTGCACAAAATAATCCATTGG - Intronic
909871552 1:80745391-80745413 GGTTGCACAAAATTGGCTATTGG + Intergenic
913029823 1:114890251-114890273 GGGTGAGCAAAATTTCCTTTAGG + Intronic
916481450 1:165218327-165218349 GGATGCCCAAAATTCCACATTGG - Intronic
916660110 1:166915726-166915748 TAGTCCACAAAATTTCACATAGG - Exonic
917701354 1:177584875-177584897 GGGTGAATTACATTTCCCATTGG - Intergenic
918746782 1:188211473-188211495 GAGTGCACACAATTTCACATGGG - Intergenic
921960334 1:221027424-221027446 GAGAACACAAAATTTCCCATGGG + Intergenic
922200348 1:223395187-223395209 GGGTGCAGCACATTTCCCAAGGG + Exonic
1070449566 10:76544268-76544290 GGGGGGAAAAAATTGCCCATGGG - Intronic
1070842572 10:79497431-79497453 GTGTGTACATAATTTCCCCTTGG - Intergenic
1078024449 11:7681388-7681410 GAGTGCACAAGGTTTTCCATGGG - Intergenic
1079040601 11:17055911-17055933 GGGTGTACAAAATGTCACAGGGG - Intergenic
1081970918 11:47198153-47198175 GAGGTCATAAAATTTCCCATAGG - Intergenic
1082937049 11:58666022-58666044 GGGTGTACAAAATGTCACAGGGG - Intronic
1083673113 11:64310880-64310902 GGGTGCACAAAGTTTAAGATTGG - Intronic
1083863282 11:65438028-65438050 GGGTACACAGAACTTCCCAGTGG - Intergenic
1090376705 11:126294681-126294703 GGGGGCACAAAAGTACACATTGG - Intronic
1091891229 12:4056184-4056206 GGCTGGACAACATGTCCCATTGG - Intergenic
1093044783 12:14430446-14430468 GAGAGCACAAAAATTCACATAGG + Intronic
1093385297 12:18546003-18546025 GGGTCCACAAATTCTCACATGGG + Intronic
1096961265 12:55580319-55580341 GGGTAAACAAAATTTGCCAGGGG - Intergenic
1099599876 12:84720813-84720835 AGCTGCACAAAATTACCCCTTGG - Intergenic
1100226712 12:92564509-92564531 GGGTGTGCATAATTTCCCGTAGG - Intergenic
1101276563 12:103208178-103208200 TTGTGCAAATAATTTCCCATTGG - Intergenic
1101319139 12:103657865-103657887 GAGTGCAGGAAATTCCCCATCGG + Intronic
1102639315 12:114352558-114352580 GGATGCACATAATTTCCTAAGGG + Intergenic
1109991610 13:70065632-70065654 GGGTACAAAAGATTTCCCTTTGG + Intronic
1111010705 13:82310514-82310536 GTGTGCACAAAAGCTCTCATAGG - Intergenic
1114849072 14:26360640-26360662 TGGTGCACAATATTTCTGATGGG - Intergenic
1115034046 14:28835989-28836011 GGCTGGAGAAAATTGCCCATGGG + Intergenic
1118173952 14:63419145-63419167 GCATACACAAAATTACCCATTGG - Intronic
1120264648 14:82233389-82233411 GGTTGCACAGAAATACCCATGGG + Intergenic
1123482027 15:20640897-20640919 GGCTGCCCCAAAGTTCCCATCGG - Intergenic
1123635985 15:22359468-22359490 GGCTGCCCCAAAGTTCCCATCGG + Intergenic
1135864685 16:26090496-26090518 GGGTGCACAAAATTTCCCATGGG + Intronic
1138739709 16:59293937-59293959 GGGTGTAAACATTTTCCCATGGG + Intergenic
1143763257 17:9120324-9120346 AGTTGCACAGCATTTCCCATGGG - Intronic
1146840066 17:36145439-36145461 TGGTGAACAATATTTCACATGGG + Intergenic
1158624879 18:59062492-59062514 GGTTGCACAAATTTGCACATGGG - Intergenic
1158847896 18:61463855-61463877 AGGGGCACATATTTTCCCATTGG - Intronic
1160539741 18:79614037-79614059 CTGTGAACAAAACTTCCCATTGG - Intergenic
925711943 2:6749911-6749933 GGTTGGACAAAAATTCCTATAGG - Intergenic
928564256 2:32527489-32527511 GGGTGCAGAAAATTTTCAAAAGG + Intronic
933586929 2:84189167-84189189 AGGTACACAGAATTTCCCCTAGG - Intergenic
935128448 2:100243693-100243715 GGGTGCATTAAATTTCTCCTGGG - Intergenic
938643364 2:133306087-133306109 GGATCCACAAAATTCCCCCTAGG - Intronic
939423407 2:142003324-142003346 ATTTGCACAAAATTACCCATTGG - Intronic
942273525 2:174300960-174300982 GGGAGCACGAAATTACCCGTGGG + Intergenic
945996038 2:216436871-216436893 GGGTACATAAATTTGCCCATAGG + Intronic
948772702 2:240259647-240259669 GGCTGCGAAAAACTTCCCATGGG - Intergenic
1171190937 20:23159009-23159031 GGGTGTCCAACATTTGCCATTGG + Intergenic
1171732122 20:28718936-28718958 GGCTGCATAGTATTTCCCATGGG - Intergenic
1172420419 20:34812311-34812333 AGCTGCACAAATTTTCCCTTGGG - Intronic
1178363366 21:31968379-31968401 GGGTGCACGAAATTACCTGTTGG - Exonic
956766984 3:72492261-72492283 GGGGACACCAAATTTCCCAGGGG + Intergenic
957632127 3:82729980-82730002 GGGTACACTAAAATACCCATAGG + Intergenic
959825655 3:110792909-110792931 TGCTGCACAAAACTTCTCATAGG - Intergenic
969992121 4:11275449-11275471 GGGTGCAGAAAATTTATCCTGGG - Intergenic
980262598 4:130471593-130471615 GGGTGGACAAGATTTCCTAGGGG + Intergenic
985699866 5:1364320-1364342 TTGTGCACAAAATTTCACAAAGG - Intergenic
996124996 5:119715026-119715048 GGGTACACAAGGTTTACCATGGG - Intergenic
1011203564 6:84865717-84865739 GGATGCAAAAGACTTCCCATTGG + Intergenic
1011746840 6:90414593-90414615 GGGTCCACAAAATCGCCCAGTGG - Intergenic
1021830709 7:24605019-24605041 GGGTGCTGAAAATTGCCCAAAGG - Intronic
1023515663 7:40998691-40998713 GGATGCTCAAAATATCCCTTGGG - Intergenic
1027431178 7:78114379-78114401 GTGGGCACAGAATTTCCCAGTGG - Intronic
1027839734 7:83293661-83293683 GTGTGCACATAATTTGCAATTGG + Intergenic
1033017825 7:137690062-137690084 CAGAGCTCAAAATTTCCCATGGG + Intronic
1033739207 7:144256400-144256422 GGGTGTCCAAAATGTCCCAGTGG + Intergenic
1038478121 8:27883216-27883238 GGGTCCCCAACATTTCCCCTTGG - Intronic
1056799952 9:89684045-89684067 GGAAGCACAAAATATCCCATGGG + Intergenic
1059913628 9:119074702-119074724 AGGAGCATAAAATTTCCCATTGG + Intergenic
1060678775 9:125542685-125542707 GTTTTCACATAATTTCCCATGGG - Intronic
1186975891 X:14904543-14904565 AGGTGCTCAAAATTGCCCTTAGG + Intronic
1189135301 X:38543028-38543050 GGGTGCTTGAATTTTCCCATGGG + Intronic
1189391884 X:40583341-40583363 GGCTGAGGAAAATTTCCCATGGG + Intronic
1189738301 X:44093515-44093537 GGGTGCACAAGAATTACCAGGGG + Intergenic
1199340493 X:146671529-146671551 TGAAGCACACAATTTCCCATTGG - Intergenic
1199807222 X:151312241-151312263 GAGTGCACAAAAGTGCCCAATGG - Intergenic