ID: 1135864706

View in Genome Browser
Species Human (GRCh38)
Location 16:26090626-26090648
Sequence GGGCCCCGAGGGTCTCCAAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 148
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 139}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1135864706_1135864714 8 Left 1135864706 16:26090626-26090648 CCCCTTGGAGACCCTCGGGGCCC 0: 1
1: 0
2: 0
3: 8
4: 139
Right 1135864714 16:26090657-26090679 GATTTGTGCCACCATCCAAAGGG 0: 1
1: 0
2: 0
3: 11
4: 130
1135864706_1135864713 7 Left 1135864706 16:26090626-26090648 CCCCTTGGAGACCCTCGGGGCCC 0: 1
1: 0
2: 0
3: 8
4: 139
Right 1135864713 16:26090656-26090678 AGATTTGTGCCACCATCCAAAGG 0: 1
1: 0
2: 3
3: 8
4: 138

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1135864706 Original CRISPR GGGCCCCGAGGGTCTCCAAG GGG (reversed) Intronic
902779957 1:18698691-18698713 GGGCGCCGAGGGTTTCCCCGGGG - Intronic
903446425 1:23425043-23425065 GGCGCCCGAGGGTGTCCCAGGGG + Intergenic
903860071 1:26359893-26359915 GGGCCCAGAGGCTCCCCACGCGG + Intergenic
912013836 1:105006018-105006040 GGGCTTCCAGGGTCTCTAAGAGG + Intergenic
921390392 1:214608666-214608688 AGGCCCGCAGGGTCCCCAAGGGG + Intronic
923534103 1:234835331-234835353 GGGTCCCCAGGGTGGCCAAGTGG + Intergenic
1067569375 10:47360340-47360362 GGCCCGCGAGGGTCCCCATGTGG - Intergenic
1069620907 10:69836744-69836766 GGCTCCCCAGGGTCTCCATGAGG - Intronic
1070803315 10:79256033-79256055 GGGCCCTGGGGGGCTCCCAGTGG - Intronic
1076839484 10:133039053-133039075 GGGACACCAGTGTCTCCAAGGGG - Intergenic
1076919545 10:133444592-133444614 GGTCCCCCAGGGTCTCCCACAGG + Intergenic
1079527237 11:21405132-21405154 GGGCCCAGGTGGTCTACAAGTGG - Intronic
1083384439 11:62297093-62297115 GGGCCCTGAGGAGCTGCAAGGGG + Intronic
1083883058 11:65557931-65557953 GGGCCCCGAGGGGCTGCTGGCGG - Exonic
1084172864 11:67409061-67409083 GGGCTCCCAGTGTCTCCAGGAGG - Exonic
1092406017 12:8222541-8222563 GGGCCCCGAGCCTCTCCTCGTGG - Exonic
1096073845 12:48789756-48789778 GGGCCCCGAGGTTCGCCTCGGGG - Intergenic
1096531024 12:52243008-52243030 GGGCCTGGAGGGTCTCAAACTGG - Exonic
1096603149 12:52744851-52744873 AGGTACCCAGGGTCTCCAAGGGG - Intergenic
1099658960 12:85530717-85530739 GGGGCCCCAGGGGCTCCGAGTGG + Intergenic
1104354581 12:128074115-128074137 GGCACTCGCGGGTCTCCAAGGGG - Intergenic
1105602159 13:21897184-21897206 GGACCCCAAGGTACTCCAAGGGG + Intergenic
1106559062 13:30833243-30833265 TGGCCCAGAGGGTCTCCATTTGG - Intergenic
1108903938 13:55447293-55447315 GGTCCCAGTGGGTCTCCTAGAGG + Intergenic
1114441133 14:22748917-22748939 GGGCACGGAGGGGCACCAAGAGG + Intergenic
1118473275 14:66094322-66094344 GGGCTCTGAGGGACTCCCAGGGG + Intergenic
1119657672 14:76429001-76429023 GGTCCCAGAGGGCCCCCAAGGGG + Intronic
1121522678 14:94597260-94597282 GGGCCCTGAGGGGCTCCCTGAGG + Intronic
1122881902 14:104694014-104694036 GGGCCCTGGGTGTCCCCAAGGGG - Intronic
1129638726 15:77351738-77351760 GGGCACAGAGGTTCTCCAACAGG + Intronic
1132574060 16:656666-656688 GGGCCCAGGGGCTCTCCAGGCGG - Intronic
1132953935 16:2581090-2581112 GGGCCCAGAGGGTGTGCACGCGG - Intronic
1132960410 16:2619073-2619095 GGGCCCAGAGGGTGTGCACGCGG + Intergenic
1133239777 16:4407600-4407622 GGGCCCCGAGGACCTCCCAGTGG - Exonic
1133346107 16:5071702-5071724 TGGCCCCGAGGGGCTCCTGGGGG + Intronic
1134218223 16:12332914-12332936 TGGCCATGAGGGTCTCAAAGCGG - Intronic
1134517223 16:14896959-14896981 GGGAGCCGAGGGCCTCCAGGTGG + Intronic
1134704891 16:16295613-16295635 GGGAGCCGAGGGCCTCCAGGTGG + Intergenic
1134962651 16:18416501-18416523 GGGAGCCGAGGGCCTCCAGGTGG - Intergenic
1134966947 16:18499100-18499122 GGGAGCCGAGGGCCTCCAGGTGG - Intronic
1135864706 16:26090626-26090648 GGGCCCCGAGGGTCTCCAAGGGG - Intronic
1136991241 16:35152483-35152505 AAGCCCCTAGGCTCTCCAAGGGG - Intergenic
1137586923 16:49669388-49669410 GGGCCTCTAGGGTCGCCATGTGG - Intronic
1139921944 16:70466179-70466201 GGGCCTCGGGGTTCTCCACGGGG - Exonic
1142303714 16:89274162-89274184 GGGCCCCGTGGCTCTCCCTGGGG - Intronic
1143847038 17:9780080-9780102 GGGCTCCCAAGGTCTGCAAGAGG - Intronic
1144816700 17:18039922-18039944 GGGGCCCGAGGGCCTCCTCGCGG + Intronic
1144829183 17:18122067-18122089 GGGCCCTGATGGGCGCCAAGGGG - Exonic
1145190745 17:20841199-20841221 AGGCCCGCAGGGTCCCCAAGGGG - Intronic
1148467299 17:47872747-47872769 GGGCCCCGAGGGACTCCCGCTGG + Intergenic
1148534646 17:48429634-48429656 GGTCCCCGAGGCTCTCCAGGGGG - Intronic
1150329294 17:64282287-64282309 GGGCCCAGTGGGTATCCCAGGGG + Intergenic
1152312374 17:79559017-79559039 GGGCTCCCAGGGTCTCCTGGTGG - Intergenic
1152467879 17:80475999-80476021 GGACCTCGAGGTTCTCCAGGCGG + Exonic
1152647673 17:81477251-81477273 GGGCCCTGGGAGTCTCAAAGGGG - Intergenic
1152773957 17:82188283-82188305 GCGCCTCGAGGGTCTCGCAGTGG + Exonic
1152935059 17:83131852-83131874 GGGTCAGGAGGGTCTCCGAGAGG - Intergenic
1156553331 18:38041360-38041382 GGACAGCGAGGGTCTCCAGGAGG + Intergenic
1160397055 18:78580256-78580278 GGGCCCCCGGGGTCTCCATCTGG + Intergenic
1160540112 18:79616737-79616759 GGGCCCCGGCGGCCTCCACGTGG - Intergenic
1161108619 19:2456415-2456437 GGGTCTCGAGGGTCTCCAGGGGG - Intronic
1161300293 19:3539216-3539238 TGGCCTCGAGGGTCCCCGAGGGG - Exonic
1161315848 19:3617334-3617356 GGGCTCTGTGGGTCTCCAGGGGG + Intronic
1161843141 19:6694394-6694416 GGGTCCCTGGGGTCTCCAAGAGG + Intronic
1163106331 19:15125041-15125063 CGGCCGCGGGGGTCTCCATGAGG + Exonic
1163217974 19:15894826-15894848 AGGTCCCGGGGATCTCCAAGAGG - Intronic
1163528342 19:17834956-17834978 GGCCCCCGAGTGTCTCCGGGAGG - Exonic
1165246347 19:34500497-34500519 GGGCACAGGGGGCCTCCAAGTGG - Exonic
1167745969 19:51352055-51352077 GGTGCCCGAGGGTCTCCTGGGGG + Intronic
1168315778 19:55484223-55484245 GGGCCCCGCGGGGCTCCCCGGGG + Exonic
926056772 2:9778322-9778344 GTGCCCCGAGTGTGCCCAAGTGG - Intergenic
928106026 2:28471231-28471253 GGGCCCTGAGGGTCTGGGAGAGG + Intronic
928178306 2:29049983-29050005 GGGACCCGTGGGGCTCTAAGGGG + Intronic
929775818 2:44929860-44929882 GGGCCGCGAGGGCTCCCAAGTGG + Intergenic
934567731 2:95349859-95349881 CGGCCCCGAGGGCCATCAAGGGG + Intronic
936269809 2:111041051-111041073 GGGCCTGGAGGGCCTCCAGGTGG + Intronic
937152148 2:119693237-119693259 GGCACCCCAGGGTCTCCAGGGGG - Intergenic
937195824 2:120155870-120155892 CGGCCCCCAGCGACTCCAAGGGG + Intronic
939065829 2:137482434-137482456 GTGCCCTGTGGGTCTCCAATGGG + Intronic
942261723 2:174171955-174171977 GGGCCCCGGCGGTCTCCAGCTGG + Intronic
945314823 2:208360339-208360361 GGGCCCCGAGGGGCTCGGGGAGG - Intronic
948449466 2:238060497-238060519 GGGCCCCGGGGGTCTCCCGCAGG - Intronic
948786735 2:240356580-240356602 GGTCCCCGAGTTTCTCCAGGAGG - Intergenic
1172629767 20:36370157-36370179 GGAGCCTGGGGGTCTCCAAGGGG + Intronic
1173681640 20:44886084-44886106 GCGGCCCGAGCCTCTCCAAGAGG - Intronic
1175931714 20:62496651-62496673 GGTCTGCGAGGGTCTCCAGGAGG + Intergenic
1176000666 20:62829984-62830006 TGGCCCCGACCGTCTCCCAGCGG - Intronic
1176104079 20:63377498-63377520 GGGCCCGGAGGGTCTCGCCGGGG - Intronic
1179656989 21:42851805-42851827 AGGCCCCGGGGGTCTTCAGGAGG - Intronic
1180161129 21:45999200-45999222 GGGTCCCGAGGGCCCCCAGGTGG + Exonic
1180219677 21:46350665-46350687 GGGCCCCTTGTGTCTCCCAGCGG + Intronic
1181121534 22:20670800-20670822 AGGCCCGCAGGGTCCCCAAGGGG + Intergenic
1181266037 22:21631502-21631524 AGGTCCCGAGGGTCTGCAGGTGG + Intergenic
1182420734 22:30247360-30247382 GGGCCCCAAGGGGCTCCGAGGGG + Intergenic
1182468797 22:30534245-30534267 GGGCCCCAAGGCCCACCAAGGGG - Intronic
1183324185 22:37182670-37182692 GGGCAGGGAGGGTCCCCAAGGGG - Exonic
1185416237 22:50711994-50712016 GGGCTCCGAGGGTCCCAGAGGGG + Intergenic
950480363 3:13239857-13239879 GGGCCCCGAGGGGCTGCGGGTGG + Intergenic
950668698 3:14512527-14512549 TGGCCTCGTGGGTCTCCCAGGGG - Intronic
954110983 3:48432905-48432927 GGGGCCTGTGAGTCTCCAAGAGG - Exonic
966735937 3:183187245-183187267 GGTACCTCAGGGTCTCCAAGGGG - Intronic
969249493 4:5957566-5957588 GGGGCCACAGGGTCTCCAGGGGG + Exonic
969564938 4:7971910-7971932 GGGCCCCCAGGGCCAGCAAGGGG + Intronic
969720871 4:8892583-8892605 GGGCCCCGGGCGCCTCCGAGAGG - Intergenic
969760108 4:9175426-9175448 GGGCCCCGAGCCTCTCCTCGTGG + Exonic
975920309 4:79379467-79379489 GGGCTCCCAGGGTATCCCAGAGG - Intergenic
977693809 4:99946339-99946361 GGGCCCCGCAGGCCTCCAGGAGG + Intronic
986721203 5:10563062-10563084 GGGCCGCGAGGGCCTCCCACCGG + Intergenic
1002092520 5:176813528-176813550 GGGCCCCTAGGTCCTCCCAGGGG + Intronic
1005953510 6:30647821-30647843 GGTCCCCGATGGTGTCCTAGAGG - Exonic
1006800974 6:36759468-36759490 GGGCACTGAGGGGCTCCTAGGGG + Intronic
1007123305 6:39401502-39401524 AGGCCCCTAGAGTCTCCAAGTGG - Intronic
1019434231 7:1013523-1013545 GGGCCTAGAGGGGCTCCAGGGGG - Intronic
1019494615 7:1332012-1332034 GGGCCCACAGGGTCTGCAGGAGG + Intergenic
1019723885 7:2590026-2590048 GGACCACGAGCGTCTCCGAGGGG + Exonic
1020137394 7:5594606-5594628 GGGTCCCGAGGTTCCCCAGGAGG + Intronic
1030270054 7:107661108-107661130 GCGCTCCGCGGGTCCCCAAGAGG - Intronic
1034478710 7:151303645-151303667 GGGCCCGGGGGCGCTCCAAGGGG - Intergenic
1035240147 7:157523999-157524021 GAGCCCAGAGGGACTGCAAGGGG - Intergenic
1036297653 8:7549771-7549793 GGGCCCCGAGCCTCTCCTCGTGG - Intergenic
1036298957 8:7557419-7557441 GGGCCCCGAGCCTCTCCTCGTGG - Intergenic
1036300262 8:7565069-7565091 GGGCCCCGAGCCTCTCCTCGTGG - Intergenic
1036324919 8:7771247-7771269 GGGCCCCGAGCCTCTCCTCGTGG + Intergenic
1036812832 8:11879494-11879516 GGCCCCCGAGGGTCTGCAGCTGG - Intergenic
1036846404 8:12173480-12173502 GGGCCCCGAGCCTCTCCTCGTGG - Intergenic
1036867767 8:12415799-12415821 GGGCCCCGAGCCTCTCCTCGTGG - Intergenic
1038639968 8:29315820-29315842 GGGCCTCGGGGGCCTCCAAGAGG + Intergenic
1049288982 8:141791649-141791671 GGGCCCCGAAGGCCCCCAGGGGG - Intergenic
1049799375 8:144510673-144510695 TGGCCCCCAGGGTGTCCAGGTGG - Exonic
1051867224 9:21696109-21696131 GGTCCCCCAGGCCCTCCAAGGGG + Intergenic
1052963320 9:34319222-34319244 AGGCCTCGAGGGGCTCCACGTGG - Intronic
1053052880 9:34976450-34976472 GGGCCCCGAGGGTGCCCTGGAGG + Intronic
1056295305 9:85187203-85187225 GTTCCCTGAGGGGCTCCAAGTGG - Intergenic
1056309370 9:85323372-85323394 GGGCCACCAGGGCCCCCAAGAGG + Intergenic
1056583833 9:87915127-87915149 GGCCCCCGAGGGCCTCCCACCGG + Intergenic
1056584325 9:87918596-87918618 GGCCCCCGAGGGCCTCCCACCGG + Intergenic
1056612544 9:88134326-88134348 GGCCCCCGAGGGCCTCCCACCGG - Intergenic
1056613036 9:88137794-88137816 GGCCCCCGAGGGCCTCCCACCGG - Intergenic
1057520037 9:95752671-95752693 TAGCTCCGAGGGTCTCCAGGTGG - Intergenic
1061972974 9:134054682-134054704 CTGCCCCGAGCGTCTACAAGTGG - Intronic
1061993327 9:134172006-134172028 AGGCCCCGAGGGTTTACAATGGG + Intergenic
1062074215 9:134575682-134575704 CTGCCCCGAGGGGCCCCAAGGGG + Intergenic
1062249865 9:135588640-135588662 GGGCCTCCACGGTCTCCAGGAGG - Intergenic
1062561206 9:137142865-137142887 GGGCCAGGAGGGTCTGCAGGAGG - Intronic
1203785706 EBV:126287-126309 GGCCCCCGGGGGTGTCCAAACGG - Intergenic
1199980198 X:152916591-152916613 GGGCCCCGAGGGACAGGAAGGGG + Intronic
1200066697 X:153507395-153507417 TGGACCCGAGGGTCTCCAGGTGG + Intronic
1200119730 X:153784608-153784630 GGGTCCCCAGGTCCTCCAAGAGG - Intronic