ID: 1135864706

View in Genome Browser
Species Human (GRCh38)
Location 16:26090626-26090648
Sequence GGGCCCCGAGGGTCTCCAAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 148
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 139}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1135864706_1135864714 8 Left 1135864706 16:26090626-26090648 CCCCTTGGAGACCCTCGGGGCCC 0: 1
1: 0
2: 0
3: 8
4: 139
Right 1135864714 16:26090657-26090679 GATTTGTGCCACCATCCAAAGGG 0: 1
1: 0
2: 0
3: 11
4: 130
1135864706_1135864713 7 Left 1135864706 16:26090626-26090648 CCCCTTGGAGACCCTCGGGGCCC 0: 1
1: 0
2: 0
3: 8
4: 139
Right 1135864713 16:26090656-26090678 AGATTTGTGCCACCATCCAAAGG 0: 1
1: 0
2: 3
3: 8
4: 138

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1135864706 Original CRISPR GGGCCCCGAGGGTCTCCAAG GGG (reversed) Intronic