ID: 1135866235

View in Genome Browser
Species Human (GRCh38)
Location 16:26105016-26105038
Sequence TTGAAGAAGGATAAGGAGGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 570
Summary {0: 1, 1: 0, 2: 1, 3: 44, 4: 524}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1135866235 Original CRISPR TTGAAGAAGGATAAGGAGGT GGG (reversed) Intronic
901206019 1:7496352-7496374 TTGAACAAGGGTAAGCATGTGGG + Intronic
901412619 1:9095014-9095036 TTAAAGTATGTTAAGGAGGTGGG - Intergenic
903027858 1:20442415-20442437 GTGAAGCAGGATGAGGGGGTGGG - Intergenic
903468856 1:23570900-23570922 TTGCAGAAGTAGATGGAGGTGGG + Intergenic
904203655 1:28838353-28838375 TTGAAGAAGCAGAAGGAACTTGG + Intronic
905085165 1:35367679-35367701 TTAGAGAAAGATAAAGAGGTGGG + Intronic
905649715 1:39648010-39648032 TTGATGAAGGATATGGAGACTGG + Intergenic
905809084 1:40898939-40898961 ATGGAGAAGGATCAGGAGCTAGG - Intergenic
906381967 1:45338412-45338434 TTGAAAAATGATAAGGTGTTAGG - Intronic
906442903 1:45865652-45865674 TTTAAGAAGGAAAAGATGGTAGG - Intronic
906562021 1:46765301-46765323 ATGAAGAGGGATAATTAGGTAGG - Intronic
906706603 1:47899640-47899662 TTGAAGAAGAAAAAGGATTTTGG + Intronic
906720893 1:48003642-48003664 ATGAAGGAGGAAAAGGAGCTGGG + Intergenic
906960747 1:50418406-50418428 TGGAAGAGGGATCCGGAGGTAGG + Exonic
907976610 1:59436897-59436919 TTGGAGAAAGGTCAGGAGGTGGG + Intronic
909656411 1:78038409-78038431 TGGAAAGAGGAAAAGGAGGTGGG - Intronic
910354539 1:86340544-86340566 TTGAATGAGGAAAAAGAGGTAGG - Intergenic
910501768 1:87900590-87900612 ATGAAGAAGGAGAAAGAGATGGG - Intergenic
911283879 1:95965625-95965647 TTGGAGAAGGATATGCAGATTGG + Intergenic
912573688 1:110644187-110644209 TTGAGAAAGGAAAAAGAGGTGGG - Intergenic
912687253 1:111777293-111777315 AAGAAGTAGGAAAAGGAGGTAGG + Intronic
913077387 1:115352506-115352528 GAGAAGCAGGATAAGGAGGCTGG - Intergenic
913586012 1:120276609-120276631 TGGAAGAATGAAAAGCAGGTAGG + Intergenic
913622173 1:120621760-120621782 TGGAAGAATGAAAAGCAGGTAGG - Intergenic
914351900 1:146847230-146847252 TTGAAGAAGGAAAAGGTGGGAGG - Intergenic
914360858 1:146934795-146934817 CGGAAGCAGGATAAAGAGGTGGG - Intergenic
914491727 1:148155842-148155864 CGGAAGCAGGATAAAGAGGTGGG + Intergenic
914568018 1:148888467-148888489 TGGAAGAATGAAAAGCAGGTAGG + Intronic
914604806 1:149241781-149241803 TGGAAGAATGAAAAGCAGGTAGG - Intergenic
915075972 1:153308288-153308310 ATGAAGAAAGAGAAGGAGGCTGG - Intronic
915790669 1:158666852-158666874 TAGGAGAAGCATAATGAGGTTGG + Intronic
916987324 1:170205861-170205883 AAGAAGGAGGAGAAGGAGGTAGG - Intergenic
917313592 1:173702588-173702610 AGGAAGAAGGAGAAGGAGGAAGG + Intergenic
917863396 1:179170291-179170313 TTGAAAAAGTAGTAGGAGGTGGG - Intronic
918789565 1:188808909-188808931 TGGAAGAGAGGTAAGGAGGTAGG + Intergenic
919145528 1:193629737-193629759 TTTAAGAAGGCTTTGGAGGTTGG - Intergenic
919548448 1:198953234-198953256 TTAAAGAAGGAGAATGAGGAAGG - Intergenic
919595845 1:199561519-199561541 AAGAAGAAGGAGAAGGAGGAGGG - Intergenic
920193795 1:204212876-204212898 TTGAAGAACAACAAGGAGGTGGG - Intronic
922715853 1:227871338-227871360 TTGAAGAAGCAGAACAAGGTGGG + Intergenic
923131529 1:231078844-231078866 TTAAAGAAGGAGGAGGAGGTCGG - Intergenic
923425603 1:233865799-233865821 GTGAGCAAGGAAAAGGAGGTAGG - Intergenic
923858466 1:237869297-237869319 TTGAAGAGGGAAGAGCAGGTTGG - Intergenic
924546776 1:245035268-245035290 TTGAAAAAGGATAACAAAGTTGG + Intronic
1062846029 10:706285-706307 TTGGAGAAGGAGAAGAAGGGAGG - Intergenic
1064039603 10:11948426-11948448 ATGAAGAAGAAGAAGAAGGTGGG - Exonic
1064213616 10:13381529-13381551 TTCAAGAAGGAAAAGGAGGCTGG + Intergenic
1065747418 10:28855015-28855037 AGGTAGAAGGATAAGGAGGAAGG - Intronic
1065966987 10:30778727-30778749 AAGAAGAAGGATAAGGAGGGGGG + Intergenic
1066124421 10:32326141-32326163 AAGAGGAAGGATAAGGAAGTAGG - Intronic
1066400428 10:35070829-35070851 TGAAAGCAGGATAAGGACGTGGG - Intronic
1067014612 10:42748059-42748081 TGGAAGATGGAGATGGAGGTGGG + Intergenic
1067040253 10:42948461-42948483 TTGAAAAAGGATAAAGTGGGAGG + Intergenic
1067229236 10:44395344-44395366 TTGAAGAAGGGAAGGGAGTTGGG + Intergenic
1068726574 10:60309617-60309639 CTGGAGATGAATAAGGAGGTTGG + Intronic
1069338823 10:67386981-67387003 TTAAAGAAGGATAGGAAGGTAGG - Intronic
1069509590 10:69031886-69031908 TTGTAGACGGAAAAGGAGGAAGG - Intergenic
1069704509 10:70449702-70449724 TTGAAGAAGGACAATGAGATGGG - Intergenic
1069771023 10:70900367-70900389 TTGAAGAAGAAAAATGAGATTGG - Intergenic
1071952273 10:90717372-90717394 ATGAAGAAGGAAAAGGAGCATGG + Intergenic
1072143338 10:92610233-92610255 TTGAATAAGGATTAGAAGTTAGG + Intronic
1072778472 10:98225285-98225307 GTGAAGAGGGATGGGGAGGTAGG - Intronic
1072841355 10:98777750-98777772 AAGAAGAAGGACAAGGAGGCAGG - Intronic
1073715521 10:106102199-106102221 TTGCAGAAGGATTGGCAGGTTGG - Intergenic
1074454291 10:113583852-113583874 TTGAGGAAGGAGAGAGAGGTGGG - Intronic
1074542387 10:114375728-114375750 TTTTTGAAGGATAAGGAGGGAGG + Intronic
1075075876 10:119349787-119349809 TTGAGGAAGGAAGAGGAGGAAGG + Intronic
1075337208 10:121617153-121617175 TTGGAAAAGGAGAAGGAGGAAGG + Intergenic
1075568931 10:123524888-123524910 TTAAAAAAGGATAAGGAAGTAGG - Intergenic
1075602406 10:123779828-123779850 TTGAAGAAGAAAAAGGATCTAGG - Intronic
1075848353 10:125565445-125565467 TTGGAGAAGGATAACGTGGCAGG + Intergenic
1077010213 11:376270-376292 ATGAAGATGGACAAGGAGGAGGG + Exonic
1077174236 11:1181426-1181448 GTGGAGAAGGAGAAGGTGGTTGG - Intronic
1078030779 11:7748912-7748934 TGAGAGAAGGAGAAGGAGGTAGG - Intergenic
1078385830 11:10891713-10891735 TTGAAGAAGGAGAAGAAGATGGG + Intergenic
1078938863 11:15977812-15977834 TTGAGGAAAGTTAAGAAGGTAGG - Intronic
1079927139 11:26508245-26508267 TTGATGTTGGAGAAGGAGGTAGG + Exonic
1081004765 11:37721916-37721938 TTGAAAAAGGAAAATGAGATTGG - Intergenic
1081548811 11:44093549-44093571 TTAAAGAAGGAAAAGCAGCTGGG - Intergenic
1081959777 11:47127046-47127068 TAGACGAAGGAAAAGCAGGTTGG + Intronic
1082664310 11:55955528-55955550 TTGAAGAAGAGTAAAGAGGGAGG - Intergenic
1082976502 11:59077421-59077443 TTGAAGAAGAAAAGGGAAGTGGG - Intergenic
1083414135 11:62514315-62514337 TTGAGGAAGGAACAGGAGATGGG + Intronic
1083573437 11:63772154-63772176 GGGAAGAAGGAGAAGGAGGAGGG + Intergenic
1085983131 11:81748880-81748902 ATGAAGAAGGAGAAGGAGAAGGG - Intergenic
1086079574 11:82889397-82889419 AAGAAGAAGGAGAAGGAGGAGGG + Intronic
1086884325 11:92187066-92187088 TTGAAGAAGGACAACAAAGTTGG + Intergenic
1086924891 11:92629705-92629727 CTGAAGAAGGGGAAGGAGGTTGG - Intronic
1087213332 11:95466169-95466191 TGGAAGAAGAACAAGGAGCTAGG - Intergenic
1087333940 11:96818855-96818877 TTGAAGGATAATAAAGAGGTAGG - Intergenic
1087534458 11:99425496-99425518 TTGTAGAGGGACAAGGTGGTGGG + Intronic
1088757046 11:112893785-112893807 TTGAAGAAAGAAAAGCAGTTAGG - Intergenic
1089067881 11:115675789-115675811 TTGAAGAAGGGTAGGGAGCTTGG - Intergenic
1089122362 11:116146295-116146317 CTGAAGCTGGATAGGGAGGTCGG - Intergenic
1090920112 11:131199370-131199392 TTGAAGCAGGATAATGAGGCTGG - Intergenic
1091177444 11:133574492-133574514 TCTCAGAGGGATAAGGAGGTGGG + Intergenic
1091770234 12:3146665-3146687 GTGGAGAAAGATAAGGAGGCAGG - Intronic
1092158580 12:6302046-6302068 ATGAAGAGGGATTAGGCGGTAGG + Intergenic
1092459930 12:8677426-8677448 TTGAACAATATTAAGGAGGTAGG - Intergenic
1092569771 12:9709310-9709332 CTGAAGCTGGATAGGGAGGTTGG - Intergenic
1093590753 12:20899388-20899410 TGGCAGAAGGAAAAGGAAGTGGG + Intronic
1093604608 12:21074525-21074547 TGGCAGAAGGAAAAGGAAGTGGG + Intronic
1094372679 12:29754866-29754888 GTCAAGAAGTATAAAGAGGTAGG + Intronic
1095809275 12:46354817-46354839 TTTTGGAAGGGTAAGGAGGTGGG + Intergenic
1095820105 12:46468708-46468730 TTCAAGAAGGATTGGGAGGATGG - Intergenic
1096113512 12:49042160-49042182 TGGGAGAAGGATGAGGAGTTGGG - Exonic
1096409759 12:51368701-51368723 TTGAAGAAGGAAAAAGTGGGCGG - Intronic
1096444857 12:51680434-51680456 TTGAAGAAAAACTAGGAGGTAGG - Intronic
1097052342 12:56230916-56230938 TTGAGGGGGGATAAAGAGGTGGG + Intronic
1097152195 12:56987287-56987309 TTGAACAAGGACAATGAGGATGG + Intergenic
1097161124 12:57047459-57047481 GTGAAGCAAGTTAAGGAGGTGGG - Intronic
1097222142 12:57457242-57457264 TTGAAGCAGGGTAAGCAGGCTGG + Exonic
1097294983 12:57952827-57952849 TTGAAGAAGGAACAAGAAGTGGG + Intronic
1097345993 12:58493023-58493045 TTGAAGAAGAAAAATGAAGTTGG - Intergenic
1097527733 12:60759382-60759404 TTGAAGATGGAGAAGGGGGCAGG - Intergenic
1098178806 12:67823074-67823096 TTGAACTAGGTTAATGAGGTTGG + Intergenic
1098217502 12:68235858-68235880 GAGAAGAAGGAGAAGGAGGAAGG + Intergenic
1098227368 12:68338629-68338651 CTGCAGTAGGAGAAGGAGGTTGG - Intergenic
1098701310 12:73631187-73631209 AAGAAGAAGGAGAAGGAGGAGGG + Intergenic
1098758003 12:74389549-74389571 CTGAAGCTGGATAAGGAGGTCGG + Intergenic
1099015692 12:77341477-77341499 TTGAACCAGGAGACGGAGGTTGG - Intergenic
1099827569 12:87797757-87797779 TTGAATTAGGATTCGGAGGTAGG + Intergenic
1100140040 12:91606627-91606649 TTGAAGATGGATAGGAAGGCAGG + Intergenic
1100350279 12:93774543-93774565 GTGAAGATGGGTTAGGAGGTGGG + Intronic
1101997367 12:109534666-109534688 TTGAAGCAGGTGGAGGAGGTGGG - Exonic
1102570347 12:113823535-113823557 ATGAAGAAAGATAAGGAGTAGGG + Intronic
1103885824 12:124199330-124199352 ATGAAAAAGAATAAGGAGGCTGG - Intronic
1104272591 12:127295271-127295293 TTGAAGAAGGGAAAGAAAGTCGG - Intergenic
1105347753 13:19589502-19589524 TTGAAGCAGGAGTAGGAGTTAGG - Intergenic
1105398634 13:20066659-20066681 TGGAAGAGGTAGAAGGAGGTTGG + Intronic
1105690383 13:22831608-22831630 CTGAATGAGGATAAGGAGTTTGG - Intergenic
1106506685 13:30376575-30376597 TTGAGGAAGGAAAAGGAAGAGGG + Intergenic
1106803476 13:33281248-33281270 CTGAAGTAGGATAAGGAGACAGG - Intronic
1107480122 13:40779309-40779331 TTGAAGCAGGAGGAGGAGTTAGG - Intergenic
1107872431 13:44759689-44759711 TGGAAGAGGGATAGGGAGGAAGG + Intergenic
1108483501 13:50900676-50900698 TTGAAGGAAGAAAAGGAGGTAGG - Intergenic
1108623078 13:52202892-52202914 TTGAAGTAGGAGTAGGAGTTAGG - Intergenic
1108663647 13:52608150-52608172 TTGAAGTAGGAGTAGGAGTTAGG + Intergenic
1108812141 13:54240315-54240337 TTAAAGCAGAATAAGGAGGATGG - Intergenic
1108988633 13:56627559-56627581 TTGAAGAAATATCAGGACGTTGG + Intergenic
1109714532 13:66204352-66204374 TTGGAGATGAATAAGGAAGTTGG - Intergenic
1109996620 13:70135340-70135362 ATGAAATAGGATAAGGAGTTTGG - Intergenic
1111117912 13:83804918-83804940 TTGAGGAAGAATAAAGGGGTGGG + Intergenic
1111942773 13:94630630-94630652 TTGATGAAGGACAATGAGGCTGG - Exonic
1112065302 13:95786339-95786361 TTTAAGAAGGGTAAAGGGGTAGG + Intronic
1112289442 13:98132225-98132247 CTGAGGAAGAATAAGGAGGTGGG - Intergenic
1113021709 13:105894846-105894868 TGGAAGAATGAAAAGGAGGAAGG - Intergenic
1114860192 14:26508372-26508394 TTGAAGAAAGAAAAGGAACTGGG + Intronic
1115064205 14:29236625-29236647 TTGAAGAAGAAAAGGAAGGTTGG + Intergenic
1115075237 14:29381140-29381162 TTGAAAAAAGAAAAGGGGGTGGG - Intergenic
1115078894 14:29426353-29426375 TTTAAGAAGGAAAAGAAGGAAGG + Intergenic
1115937474 14:38569824-38569846 AGCATGAAGGATAAGGAGGTAGG + Intergenic
1117232851 14:53739438-53739460 TTGAGGAAGGAGAAGGAGCAAGG + Intergenic
1117232963 14:53741042-53741064 TTGAAGAAGAAGAAGGAGCAAGG - Intergenic
1117872347 14:60214167-60214189 CTGAAGAAGGCTAACGTGGTAGG - Intergenic
1118019678 14:61697172-61697194 TTGAAGAAGGACCAGGAGAAGGG - Intronic
1118587718 14:67371112-67371134 TTTCAGAAAGTTAAGGAGGTAGG + Intronic
1119651283 14:76385451-76385473 TTTAAGAAGGATTAGGAGAAAGG + Intronic
1119698450 14:76733623-76733645 TTGAAGAAGAAAAAGAAAGTTGG - Intergenic
1119730599 14:76948601-76948623 GGGCAGAAGGATAAAGAGGTCGG + Intergenic
1119838934 14:77776302-77776324 TTGAATAAGGAGAACAAGGTGGG - Intergenic
1119873872 14:78040088-78040110 TTGAAAAAGGAGAACGAAGTTGG - Intergenic
1120745088 14:88145295-88145317 CTGAAGCTGGATAGGGAGGTCGG - Intergenic
1121704719 14:95982917-95982939 CCGAAGAAGGAGAAGGAGCTAGG - Intergenic
1125108538 15:36003334-36003356 TTGCAGAAGGTTAATGAGGCTGG - Intergenic
1125415297 15:39446177-39446199 TGTAAGAAGGTTAAAGAGGTGGG + Intergenic
1126347811 15:47715631-47715653 TTGCAGAAGGATATGCTGGTAGG - Intronic
1127773031 15:62245644-62245666 TTCAAGAAGGGCAGGGAGGTGGG - Intergenic
1129592053 15:76924780-76924802 TTGAAGAAGAAAAAGAATGTGGG - Intergenic
1129708306 15:77807119-77807141 TTGAAGAAGGGGTAGGAGATGGG - Intronic
1129785903 15:78309895-78309917 ATGACGAAGGAAAAGGAGGTGGG + Intergenic
1130919582 15:88333013-88333035 TTGAACAAAGACAGGGAGGTGGG - Intergenic
1131251672 15:90834941-90834963 ATGAAGAGGGATAGGAAGGTTGG - Intergenic
1131662872 15:94537607-94537629 ATGAAAAATGAAAAGGAGGTAGG + Intergenic
1131674753 15:94660460-94660482 ATTAAGAAAGATAAGGAGTTGGG + Intergenic
1131938190 15:97531195-97531217 ATAAAGAAGGAAAATGAGGTAGG + Intergenic
1132364456 15:101247083-101247105 TTTATGCAGGAAAAGGAGGTGGG - Intronic
1132628884 16:906744-906766 TTGAAGAAGAATAAAGATGCAGG - Intronic
1133139179 16:3731771-3731793 ATGGAGAAGCACAAGGAGGTAGG - Exonic
1133392224 16:5419824-5419846 TTGAAGATGGAGAAGGAGTGTGG + Intergenic
1134856040 16:17520112-17520134 ATGAAGATGGAGAAGGAGGCAGG + Intergenic
1135231196 16:20709666-20709688 CTGTATAAGGATAAGGAAGTGGG - Intronic
1135849532 16:25950648-25950670 CTGAAGAAGGATAAAGATCTAGG + Intronic
1135866235 16:26105016-26105038 TTGAAGAAGGATAAGGAGGTGGG - Intronic
1135976179 16:27110079-27110101 CTGAAAAAGGATAACGAGGTGGG + Intergenic
1137532445 16:49287949-49287971 CTGAAGATGGAGAAGGAGGAAGG - Intergenic
1137942990 16:52707263-52707285 CTGAAGGAGGAGCAGGAGGTAGG - Intergenic
1138412420 16:56850930-56850952 GTGCAGATGGCTAAGGAGGTAGG + Intergenic
1139237380 16:65354514-65354536 CAGAGGAAGGATAAGGAGCTGGG - Intergenic
1139339989 16:66262286-66262308 GTGAAGAAAGCTAATGAGGTGGG + Intergenic
1139982133 16:70868306-70868328 TTGAAGAAGGAAAAGGTGGGAGG + Intronic
1140185189 16:72763338-72763360 TTGAAGAAAGAAGAGGAGGAGGG + Intergenic
1140739669 16:77930093-77930115 TTCAAGAAGGATACGAAGTTTGG - Intronic
1141157447 16:81607082-81607104 TTGAAGAATGTTGAGGAGGAGGG + Intronic
1141673728 16:85506567-85506589 TTGAGGATGGAAGAGGAGGTTGG + Intergenic
1142152007 16:88516795-88516817 TTGTAGAAGGAGAAGGGGGAGGG + Intronic
1143167745 17:4906201-4906223 CTGAAGAAGGATCATGGGGTTGG + Intergenic
1143282741 17:5766930-5766952 AGGAAAAAGGATAGGGAGGTGGG - Intergenic
1143449787 17:7029168-7029190 TTCAAGTAGGATTAAGAGGTTGG + Exonic
1143947426 17:10605466-10605488 TTGGAGAAAGAGAAGGAGGAGGG + Intergenic
1144261584 17:13527075-13527097 TTGAGGAAGGCAAAGCAGGTAGG - Intronic
1144335389 17:14264570-14264592 TTGGAGAAGTATAAAAAGGTAGG - Intergenic
1144721153 17:17470726-17470748 TTAAAGAAGGGAAAGGAGGAGGG + Intergenic
1145177358 17:20712605-20712627 TTACAAAAGGAAAAGGAGGTCGG - Intergenic
1145372701 17:22320412-22320434 TTTAAGAAGGACAAGGAGCCGGG + Intergenic
1145774134 17:27515053-27515075 TTAAGGAAGGAAAAGGAGGATGG + Intronic
1147115550 17:38296803-38296825 TTAAAAAAGGAAAAGGAGGCCGG - Intergenic
1147570836 17:41569854-41569876 AAGAAGAATCATAAGGAGGTAGG - Exonic
1148414128 17:47492817-47492839 TTAAAAAAGGAAAAGGAGGCCGG + Intergenic
1149449016 17:56735032-56735054 TTGAAGCAAGAGATGGAGGTGGG + Intergenic
1149455633 17:56785881-56785903 TTGACAAAGGAGATGGAGGTGGG - Intergenic
1150456527 17:65310881-65310903 CTGAAGGAGGAGAAGGAGCTAGG + Intergenic
1150827098 17:68486615-68486637 TAGGAGAAGGAGAAGGAGGAAGG - Intergenic
1151122745 17:71810597-71810619 ATCAAAAAGGATAAGGAGGCTGG + Intergenic
1151624373 17:75267533-75267555 TTGAGCAAGGAGGAGGAGGTGGG - Exonic
1151814063 17:76462463-76462485 TTGATGCAGGACAAAGAGGTGGG + Exonic
1152012219 17:77725612-77725634 CTGAAGTAGGAGAAGGAGGTTGG + Intergenic
1152277646 17:79367416-79367438 TTGAAGAAGGATCAAGCAGTGGG - Intronic
1153320418 18:3768500-3768522 TTGAAAAAGGAGAAGGAAGGGGG + Intronic
1154484812 18:14865219-14865241 TGGGAGAAGGATAAAGAGGGTGG - Intergenic
1155320569 18:24614827-24614849 TTGAAGAAGGAACATGAAGTAGG + Intergenic
1155438403 18:25836333-25836355 TTGGAGAAGAGTAAGGAGATGGG + Intergenic
1155555762 18:27017602-27017624 TAGAAGAAGGGTAGGGAGGTAGG + Intronic
1155923438 18:31628924-31628946 TTGAAGATGGAAAAGGAGGCAGG - Intronic
1156449291 18:37257867-37257889 AAGGAGAAGGATGAGGAGGTCGG + Intronic
1156996744 18:43478380-43478402 TTGACAATGGATAAGGAGGAAGG - Intergenic
1157174430 18:45438270-45438292 TTGAGGCAGGATGAGGGGGTAGG + Intronic
1157193715 18:45602406-45602428 TTGAAGCAGGGCAAGGAGGCAGG + Intronic
1157313805 18:46572136-46572158 TTGGACAAGGATAAGGATGATGG - Intronic
1158327802 18:56329234-56329256 TTGAAGGGTGATCAGGAGGTTGG - Intergenic
1158555642 18:58472549-58472571 TGGAAGAAGGATAAAGAGCCTGG + Intergenic
1159024546 18:63170634-63170656 TTGCAGAAGGATAATGAAATGGG - Intronic
1159333818 18:67037113-67037135 TTGAAGAAGAATAAGTTGGGAGG - Intergenic
1159374161 18:67570400-67570422 ATGAAGAAGATTAATGAGGTTGG + Intergenic
1160049579 18:75420275-75420297 TTCAAGAAGGAAAAGGAGAAAGG + Intronic
1160232292 18:77057558-77057580 GTGAAGAAGGACAAGGAGAGAGG + Intronic
1161517376 19:4703954-4703976 TTGATGAAGGAGAAGAAGGCAGG + Exonic
1162174753 19:8822800-8822822 TTGAAGAAGGATGGGAAGGATGG - Intronic
1162845771 19:13391366-13391388 ATGTAGAAGGTTAAGGAGCTTGG - Intronic
1162911859 19:13851841-13851863 TTTAAGAAGGATAGAAAGGTGGG - Intergenic
1163060477 19:14757427-14757449 TTGAAGAAGAACAAGAAGGTTGG + Intronic
1163227591 19:15975485-15975507 TAGAAGCAGGATAAAGAGGTGGG + Intergenic
1163262986 19:16202365-16202387 TTAAAGAATAAAAAGGAGGTCGG - Intronic
1163443418 19:17333242-17333264 GTGAAGAAGGCGGAGGAGGTGGG + Intronic
1164441898 19:28285131-28285153 GGGAAGAAGGAGAAGGAGGGTGG + Intergenic
1164592167 19:29513051-29513073 TAGAGGAAGGATGAGGAGGAAGG + Intergenic
1164597912 19:29542182-29542204 TAGAAGAATGATAAGTAGATGGG + Intronic
1164624270 19:29715765-29715787 TTGCAAAAGGAGAAGCAGGTTGG + Intronic
1165394958 19:35558915-35558937 CTGAAGAGGGATAGGGAGGTAGG - Intronic
1165532422 19:36415115-36415137 TTGAAAAAGGAAAAAGAGGTTGG - Intronic
1165806906 19:38585985-38586007 GTGAAGGAGGATATGGAGGTAGG + Exonic
1165821184 19:38677102-38677124 CTGAAGAATGAGGAGGAGGTAGG - Intronic
1165956430 19:39504445-39504467 TTGAAGTAGGATTAGGTGATGGG + Intronic
1166182103 19:41116384-41116406 TGGTGGAAGGATAAGGAGGAGGG + Intronic
1166247422 19:41538934-41538956 CTGAAGCTGGATACGGAGGTTGG - Intergenic
1166390325 19:42405671-42405693 TTCAAAAGGGATAAGGAGGCTGG + Intronic
1166901995 19:46071722-46071744 TTCAAAAATGGTAAGGAGGTTGG + Intronic
1167191288 19:47991750-47991772 GTGAAGAAGGAAGAGGAGGAGGG - Intronic
1168418444 19:56184439-56184461 TTGAAGAAGGAGATGGGGTTGGG - Intronic
925482647 2:4293224-4293246 GTGGAGAAGGATAAGGATGAGGG - Intergenic
926233018 2:11019106-11019128 AGGAAGAAGAAAAAGGAGGTGGG - Intergenic
926543967 2:14215777-14215799 TTGAAGATGTTTAAGGAGGGAGG - Intergenic
926859030 2:17289375-17289397 TTGAAGATAGATAATGGGGTAGG - Intergenic
927103960 2:19808457-19808479 TTGAAGATGGATCAGCAGGCAGG + Intergenic
927292841 2:21421608-21421630 TTGGGGAAGGATGAGGAGATGGG - Intergenic
928644869 2:33341289-33341311 TTGGAGAAGGATGAGCAGGTGGG + Intronic
928650174 2:33395768-33395790 TTGGACAAGGATATGGAGTTTGG - Intronic
929458647 2:42085019-42085041 GGGAAGAAGAATAAGGAGGAGGG + Intergenic
929554590 2:42917762-42917784 TCGAAGATGAATAATGAGGTAGG + Intergenic
929799924 2:45091033-45091055 TTGAAAAAGGAAAAAGAGGGTGG - Intergenic
930989717 2:57638315-57638337 AAGATGAAGGAAAAGGAGGTAGG + Intergenic
931087514 2:58849622-58849644 TGGAAGAAAGCTAATGAGGTAGG - Intergenic
931242571 2:60466433-60466455 TTGCAGAAGGTTTAGGAGGTTGG - Intronic
932911207 2:75807897-75807919 TTGAAGAAGAGAAAGGAGGGTGG + Intergenic
933438656 2:82281929-82281951 TTGCAGAAAGAGCAGGAGGTAGG + Intergenic
933656712 2:84894531-84894553 TTGAAGCAGAAGAAGGAAGTGGG - Intronic
933805602 2:85996500-85996522 CTGAAGAAGAGGAAGGAGGTGGG + Intergenic
934037450 2:88100022-88100044 TAGGAGAAGGAGCAGGAGGTGGG - Intronic
935104949 2:100032960-100032982 TTGAAAAAGAATAAGGTTGTTGG - Intronic
935369688 2:102332270-102332292 TTGGAGCAGGTTAAGGAGATGGG + Intronic
935849711 2:107205145-107205167 TTGAAGAAGAATACGGAAGAAGG + Intergenic
938545189 2:132322496-132322518 TTTAAGAAGGATAAAAAGATAGG + Intergenic
938809820 2:134842880-134842902 CTGGGGAAGGATAGGGAGGTAGG - Intronic
939025891 2:137013683-137013705 TTAAAGAAGGATCAGGGGGTTGG - Intronic
939230503 2:139419267-139419289 TTGAGGGAGGATAAGAAAGTTGG - Intergenic
939496946 2:142936085-142936107 TTGAATGAGGAAAAAGAGGTAGG + Intronic
939648260 2:144729099-144729121 CTGAAGAAGGATAATGAACTAGG - Intergenic
939949271 2:148449273-148449295 TTGAAAATACATAAGGAGGTGGG - Intronic
940364117 2:152827211-152827233 TTGAAGAAAGAAAATGAAGTAGG + Intergenic
940577978 2:155538370-155538392 TTGAAAAAGGATAAAGATGAAGG - Intergenic
941010843 2:160297817-160297839 TTGGAGGAGGATAAGCAGGAAGG + Intronic
941322363 2:164071764-164071786 TTGAAGAGGGCTAAGGAGATAGG - Intergenic
941645520 2:168036268-168036290 GTGAAGAAGGCTAAGGCAGTGGG + Intronic
942210424 2:173664232-173664254 TTGAAGAAGGCGGAGGAGGAGGG - Intergenic
942604655 2:177677600-177677622 TTGAAGAAGGAGAGGGTGGAAGG + Intronic
943401817 2:187421882-187421904 TTGAAGAGGGAAAAGAAAGTTGG - Intronic
944112276 2:196145372-196145394 TGAAAGAAGGATAAGGAGAAAGG + Intronic
945431462 2:209770975-209770997 AGGAAGAAGGAGAAGGAGGAGGG + Intergenic
945549781 2:211206619-211206641 TAGAAGATAGATAAGTAGGTAGG + Intergenic
945914268 2:215686265-215686287 TTGAAGAAGCACAAAGGGGTGGG - Intergenic
945922793 2:215772947-215772969 TGGAAGATGGAGATGGAGGTGGG - Intergenic
946458067 2:219845259-219845281 TTGAGGCAGGATGAGGAGGAGGG + Intergenic
946740106 2:222792868-222792890 GTGAAGAAGGAGGAGGAGGAGGG - Intergenic
947128648 2:226898130-226898152 TTGTAGGAGTATAGGGAGGTAGG - Intronic
947325436 2:228970114-228970136 TTGAAGAAAGCAGAGGAGGTTGG - Intronic
947379991 2:229536193-229536215 CTGAGGAAGGCTGAGGAGGTTGG + Intronic
948744274 2:240074920-240074942 TTGAAAAAGAACAATGAGGTGGG - Intergenic
1168864181 20:1070735-1070757 TTAAAGCAGGATATGAAGGTAGG - Intergenic
1169275279 20:4229627-4229649 TTGTAGAACGATGACGAGGTTGG + Intronic
1169329079 20:4702559-4702581 TTGAGGAAGGCTGAGGAGGAAGG + Intergenic
1169472050 20:5894938-5894960 ATGAATAAGGAAAAAGAGGTGGG - Intergenic
1169691857 20:8341072-8341094 TGGAACAAGGGAAAGGAGGTTGG - Intronic
1169770836 20:9198363-9198385 TAGAAGAAAGAGAAGAAGGTAGG + Intronic
1169833009 20:9845874-9845896 TTCAAGAAGAATAAGGTGGGAGG + Intergenic
1170346276 20:15390231-15390253 TGGCAGAAGGATCAGGAGGAGGG - Intronic
1170372008 20:15659446-15659468 TTGAAGAACTAAAAGAAGGTGGG - Intronic
1170902150 20:20474617-20474639 TTGAGGATGGTTAATGAGGTGGG + Intronic
1171874042 20:30555279-30555301 TTTAAGAAGGATAAAAAGATAGG + Intergenic
1172081899 20:32348422-32348444 TTGAAGAAGATTAACGAGCTGGG - Intergenic
1172183806 20:33019344-33019366 TTGAAGAAGGATAAGGGAAAGGG - Intronic
1172274585 20:33672764-33672786 TTGAGGAAGGTTGAGGAGATGGG + Intronic
1173525424 20:43729039-43729061 TAGAAGAAGGAAGAGGATGTGGG + Intergenic
1173620163 20:44430338-44430360 CTGAAGAAGGAGGATGAGGTTGG - Exonic
1173707420 20:45122651-45122673 ATGAAGAAGAAGAAGGAGGGAGG - Intergenic
1173966267 20:47115165-47115187 TGGGAGAAGGGTAAGGTGGTGGG - Intronic
1174406435 20:50306166-50306188 ATGAAGCAGGAAAAGGAGATGGG + Intergenic
1174412759 20:50346552-50346574 TTGAGCAAGGGTAAGGAGGTGGG - Intergenic
1174696699 20:52567030-52567052 TTGAAGAAAGGTGTGGAGGTAGG - Intergenic
1175779448 20:61672955-61672977 TAGAAGAAGAAGAAGGAGGCAGG + Intronic
1176796515 21:13374256-13374278 TGGGAGAAGGATAAAGAGGGTGG + Intergenic
1178150426 21:29788219-29788241 ATGAAGCAGGATGAGGAGCTTGG + Intronic
1179000339 21:37451989-37452011 TTGAAGAATGGTGAGAAGGTCGG + Intronic
1179917789 21:44488941-44488963 CTGAAGCTGGATAGGGAGGTCGG - Intergenic
1180189142 21:46154374-46154396 TGAAAGAAGGAAAAGGAGCTTGG + Intronic
1181279325 22:21707640-21707662 TTGAAGACTGATGAGGATGTGGG - Intronic
1181359621 22:22324366-22324388 GAGAAGATGGACAAGGAGGTAGG + Intergenic
1181369693 22:22406104-22406126 GAGAAGATGGACAAGGAGGTAGG + Intergenic
1182469148 22:30536691-30536713 TTGAACAAGGAGGAGGAGGAGGG + Intronic
1182872730 22:33662926-33662948 GTGAAGAAGGAAAAGAAGATAGG - Intronic
1183176084 22:36225689-36225711 TGGAAGAAGGATCATGAGGAAGG + Intergenic
1183182249 22:36268024-36268046 TGGAAGAAGGATCATGAGGAAGG - Intergenic
1185363749 22:50424933-50424955 TTGAAGAAGGAAAAGGGGCTGGG - Intronic
949165454 3:935184-935206 TGGAAGAAGGGAAAGCAGGTGGG + Intergenic
949493158 3:4608492-4608514 CTCAAGAAGGATAGGGAGGAAGG + Intronic
949818492 3:8089189-8089211 TTGAGGAAGGACAAGATGGTTGG + Intergenic
950484482 3:13264993-13265015 GGGCAGAAGGATAAGAAGGTGGG + Intergenic
951219154 3:20051288-20051310 AGGTAGAATGATAAGGAGGTGGG + Intronic
951287496 3:20832682-20832704 TTGAAGAAAGAGAAAGAAGTGGG - Intergenic
951685563 3:25340145-25340167 TTCAAGAAGAATGAGGAGTTTGG + Intronic
952566452 3:34665109-34665131 TTGAAGAAGGATAAGGCAGGGGG - Intergenic
952649400 3:35707214-35707236 GGGAAGGAGGAGAAGGAGGTTGG - Intronic
952708155 3:36401018-36401040 TTAAAGAAGGCAAAGGATGTCGG + Intronic
952998573 3:38908992-38909014 TTAAAGGAGGAAAAGGAGGTAGG - Exonic
953349817 3:42207018-42207040 CTTCAGAAGGATGAGGAGGTTGG + Intronic
953405728 3:42658920-42658942 TTTAAGGAGGAGAAGGAGGGTGG + Exonic
953621673 3:44538121-44538143 ATGAAGAAGCATGAGGAGGGAGG + Intergenic
953764385 3:45725127-45725149 TTGCAAAAGGAGAAGGAAGTTGG - Intronic
955006845 3:54976597-54976619 AAGAAGAAGAATAAGGAGGATGG - Intronic
955275047 3:57539331-57539353 GTGAAGATGGAGAGGGAGGTGGG - Intronic
955570241 3:60297082-60297104 TTGAAAAAGAATAAGGTGGTAGG - Intronic
956377708 3:68633738-68633760 TTGGACAAGGATATGGAGTTTGG - Intergenic
958415554 3:93869034-93869056 AAAAAGAAGGATAGGGAGGTAGG - Intergenic
959769443 3:110074849-110074871 TTGAAGAAGGATAAGGAAATGGG - Intergenic
959820486 3:110729653-110729675 TTGAAGTAGGAGAGAGAGGTAGG + Intergenic
959836791 3:110927382-110927404 TTGAAGAAAGAAAAGGAAGGAGG + Intergenic
960427832 3:117530840-117530862 TTGAAGGATGATAGTGAGGTGGG - Intergenic
961703085 3:128762259-128762281 ATGAAAAAGGCTAAGGAGGAGGG + Intronic
962051558 3:131821095-131821117 CTGAAGGAGGAGGAGGAGGTTGG + Intronic
962300027 3:134231648-134231670 CTTCCGAAGGATAAGGAGGTTGG - Intronic
962795304 3:138844808-138844830 TTGAAAAAGGAGAGGGAGGCTGG + Intergenic
962883896 3:139605209-139605231 ATGAATAAGGATGAGGAGGAAGG - Intronic
963761418 3:149289971-149289993 CTGAAGCTGGATAGGGAGGTTGG - Intergenic
963990063 3:151642714-151642736 TTGAATAAGTACATGGAGGTTGG - Intergenic
964406932 3:156358797-156358819 TTGATGAAGGTTAAGTAAGTTGG + Intronic
964628761 3:158785623-158785645 TTGAAGAAGGAGAACCAAGTGGG + Intronic
964896390 3:161601851-161601873 TTGAAGAAATAGAAGGATGTTGG - Intergenic
965496587 3:169405874-169405896 TTGAACAAGGGTAAGGAGAAGGG + Intronic
965871993 3:173275561-173275583 TCCAAGGAGGATAAAGAGGTAGG - Intergenic
966241636 3:177760796-177760818 TTGGAGAAGGAAAAAGTGGTTGG + Intergenic
966636341 3:182138165-182138187 TAGAGGAAGGAAAAGGAGGGAGG + Intergenic
966834120 3:184036341-184036363 TGGGAGAAGGACAGGGAGGTAGG - Intronic
966915414 3:184581815-184581837 TTGAAGATGGATTAGGAGAGGGG + Exonic
967079667 3:186037825-186037847 CTGATGAAAGAGAAGGAGGTGGG - Intergenic
967370877 3:188744700-188744722 CTGAAGAGGGGAAAGGAGGTTGG - Intronic
968780297 4:2575351-2575373 TTGAAGGAGGATCAGGAGCATGG + Intronic
970321223 4:14877440-14877462 TTGAAGAATGGTTAGGAGTTAGG - Intergenic
971305114 4:25473289-25473311 ATGAAGAAGGAGAAGGAGAAGGG + Intergenic
971546691 4:27895303-27895325 TTGCAGCAGTATTAGGAGGTGGG - Intergenic
972918186 4:43905477-43905499 CTGAAGCTGGATAGGGAGGTCGG - Intergenic
973280042 4:48350354-48350376 TAGCAGAAGGGTAAGGAGGCAGG - Intronic
973284028 4:48395144-48395166 TTGAAGAAATATATGAAGGTCGG + Intronic
973930080 4:55783223-55783245 TTGAAGAAGTAAAAGGGGATTGG + Intergenic
974437419 4:61874436-61874458 TAGAATAAGGCTAAGGTGGTGGG - Intronic
977437478 4:97017777-97017799 TTGAACAAAAATAATGAGGTTGG - Intergenic
979610896 4:122687816-122687838 TTGAAGAACAAAGAGGAGGTTGG + Intergenic
979757093 4:124354483-124354505 TTGAAGAAGAAGAAGAAAGTTGG - Intergenic
979792997 4:124809651-124809673 TTTAAGGAGGATAAAGACGTGGG + Intergenic
980716819 4:136638563-136638585 CTGAAGCAGGATAGGGAGGTGGG - Intergenic
980822578 4:138036652-138036674 CTGGAGAAGGACAAAGAGGTTGG - Intergenic
981041637 4:140228244-140228266 ATGAAGAAGGAGGAGGAGGAGGG - Intergenic
981312829 4:143313569-143313591 TTGAAGCCAGATAAGGAGATTGG - Intergenic
981318315 4:143363526-143363548 TTGAAGAAGGAAAGTGTGGTTGG + Intronic
981909363 4:149960432-149960454 TTGAAAAAGGATAATAAAGTAGG - Intergenic
982055559 4:151545671-151545693 ACTAAGAAGGATAAGGAGGCTGG - Intronic
982855352 4:160375376-160375398 TCTAAGAAGGATAATGAGGCTGG - Intergenic
982905047 4:161057395-161057417 TTGAAGTAGGATGAGAAGGATGG - Intergenic
983019134 4:162653529-162653551 AAGAAAAAGGACAAGGAGGTTGG - Intergenic
983363096 4:166752121-166752143 CTGAGGCAGGAGAAGGAGGTTGG - Intronic
985006579 4:185540488-185540510 AGGAAGAAAGAAAAGGAGGTAGG - Intergenic
985967418 5:3348184-3348206 TAGCAGAAGTATAAGGAGGGAGG - Intergenic
986566759 5:9123416-9123438 AAGAAGAAGGAAAAGGAGGAGGG + Intronic
986734347 5:10657038-10657060 TTTAAGAAGTTTGAGGAGGTAGG + Intergenic
987472491 5:18350551-18350573 CTGACGAAGGATTAGGAGGCAGG - Intergenic
988660462 5:33261582-33261604 TTGGAGGAGGAGGAGGAGGTGGG + Intergenic
991100665 5:62789055-62789077 ATGAAGAAGTCAAAGGAGGTAGG + Intergenic
991272138 5:64796764-64796786 AGGAAGAAGGAAAAGGAGGGAGG - Intronic
991272151 5:64796808-64796830 AGGAAGAAGGAAAAGGAGGGAGG - Intronic
991636422 5:68710590-68710612 TTGGAGAAGGACAAGGAGAGGGG - Intergenic
992095932 5:73362475-73362497 TTGGGGAAGGATCAGGAGTTTGG - Intergenic
993134045 5:83934525-83934547 TTTAAGAAGGAAAAGGATTTTGG + Intergenic
993137962 5:83993959-83993981 ATGAAGCAGGATAAGAAGGTGGG - Intronic
995844468 5:116479185-116479207 TTTCTGAAGGATGAGGAGGTAGG + Intronic
996587580 5:125107739-125107761 TAGAAGGAGGAGAAGGAGGAGGG - Intergenic
996875924 5:128240358-128240380 TGGAAGAAGGAAAAGCTGGTTGG + Intergenic
997206771 5:132054778-132054800 AGGAAGAAGGATGAGGAGGAGGG + Intergenic
997289641 5:132719178-132719200 TAGATGAAGGATATGTAGGTTGG - Intronic
999267272 5:150275076-150275098 GTGCAGAAGGATGAGGAGGAAGG + Intronic
999972137 5:156875335-156875357 TTGAAGGAGGCTAAGGAGACAGG + Intergenic
1000558683 5:162758602-162758624 TCAAATAAGGACAAGGAGGTAGG + Intergenic
1001735887 5:174000765-174000787 TTTAAGAAGGAGAATGAGGTGGG + Intronic
1003022889 6:2527377-2527399 TTGAAGAAAAATAAGGAGAGAGG - Intergenic
1003509929 6:6771287-6771309 AAGAAGAAGGAGAAGGAGGAAGG + Intergenic
1003509940 6:6771330-6771352 AAGAAGAAGGAGAAGGAGGAAGG + Intergenic
1003509951 6:6771373-6771395 AAGAAGAAGGAGAAGGAGGAAGG + Intergenic
1004174167 6:13324440-13324462 TTTAAGAAAGAAAAGGAGGATGG + Intronic
1004536211 6:16504954-16504976 TTGCAGGAGGAGGAGGAGGTGGG - Intronic
1004784741 6:18955121-18955143 ATGAAGAAGGAGAAGGGGCTGGG - Intergenic
1005200790 6:23341904-23341926 TTGAAAAAGGCTAAAGAAGTGGG + Intergenic
1005210206 6:23452077-23452099 TTCATGAAGGATAAGGATCTGGG - Intergenic
1005429358 6:25738133-25738155 TTGAAAAAGAATAAAGTGGTAGG + Intergenic
1005686943 6:28262294-28262316 TAGAAGAAGAATAAGGTAGTTGG + Intergenic
1006105853 6:31715823-31715845 TTTTAGGAGAATAAGGAGGTGGG - Intronic
1006215270 6:32436724-32436746 GTGCAGAAGGAAAAGGGGGTAGG + Intergenic
1006710448 6:36064486-36064508 TTGAAGAGGGAAATGGAAGTGGG + Intronic
1006756640 6:36421832-36421854 TAAAAGAAGAGTAAGGAGGTTGG - Intronic
1006809666 6:36811727-36811749 TTGAAGGAGGAAAGGGAGGCAGG + Intronic
1007904536 6:45445809-45445831 TTCAAGAAGGATGAGGGGGGCGG + Intronic
1008014235 6:46500539-46500561 TTGAAGAAGTAGGAGGAGGCTGG - Intergenic
1008073771 6:47124655-47124677 TTGAAGAAGCAGAACCAGGTTGG - Intergenic
1008707822 6:54184492-54184514 TAGATGATGGATAAGGAGCTTGG + Intronic
1009461489 6:63919416-63919438 TTGAAGAAGGATGTGTGGGTTGG - Intronic
1010289216 6:74115964-74115986 CTGAAGAAGGAAAAAGAGATTGG - Intergenic
1011051495 6:83155579-83155601 TTGAGGAAGGAGAGGTAGGTAGG + Intronic
1011159662 6:84374757-84374779 TTGAAGAAGCTGAAGGAGATGGG - Intergenic
1012296235 6:97528112-97528134 TTGAAGAAAGAAAAAAAGGTGGG - Intergenic
1012326646 6:97927971-97927993 TTGAAGAATGAGCAGGAGTTAGG - Intergenic
1014999773 6:128200827-128200849 AAGAAGAAGGATGAGGAGGAGGG + Intronic
1015261370 6:131241280-131241302 ATGGAGAAGGAGAAGGAGGAGGG + Intronic
1015275285 6:131377741-131377763 TTGAAGAAGGAGAAAGGGGAGGG - Intergenic
1015864224 6:137711488-137711510 TGGAAGAGAGATAAGGAGTTTGG + Intergenic
1016659667 6:146563346-146563368 TGGAAGGAGGAGAAGGAAGTAGG + Intergenic
1016852261 6:148632707-148632729 GGGAAGAAAGAAAAGGAGGTAGG + Intergenic
1017088133 6:150733808-150733830 TTTAACCAGGATAAGGAGGTAGG + Exonic
1017281164 6:152627575-152627597 TTGAACAGGGAGATGGAGGTTGG + Intronic
1017314745 6:153017507-153017529 TTGAAGGAGGACATGAAGGTGGG + Intronic
1017506404 6:155072583-155072605 TTGAAAAAGAATAACGAGTTTGG + Intronic
1017541208 6:155404904-155404926 TTGAAGGAGGTTAATGAGGAGGG - Intronic
1017638018 6:156462491-156462513 TCCAAGATGGGTAAGGAGGTGGG - Intergenic
1018842614 6:167528807-167528829 TTGGAGAAGGTGAAGGAGTTAGG - Intergenic
1019971119 7:4541684-4541706 TTGAAGAAGGAAAACAAGGAAGG - Intergenic
1020538544 7:9431159-9431181 TTGAAGAAGGATGATGATGAAGG - Intergenic
1021484287 7:21149771-21149793 GTGGAGAAGGCTATGGAGGTGGG - Intergenic
1021756021 7:23853537-23853559 TTGAAAAAGGATAACTAAGTAGG + Intergenic
1022591585 7:31668988-31669010 TTGAGGAAGGAGAAGGAAGTAGG + Intergenic
1022604207 7:31792373-31792395 TTGAATAAGCATGAGGAGGATGG + Intronic
1022845786 7:34208450-34208472 GAGAAGAAGGAAAAGAAGGTAGG - Intergenic
1024367275 7:48535532-48535554 TGGAAGAAGGATCAGGTGGTGGG + Intronic
1026015863 7:66670053-66670075 TTTAAGAAGGAGAATGAGATGGG - Intronic
1026620359 7:71944857-71944879 TTGAAGAAGAGTTAGGAGGCAGG + Intronic
1026621970 7:71957683-71957705 TTGAAGAAGGAGAAGAAACTAGG + Intronic
1026960456 7:74404379-74404401 TTGAAGAAGGTTCAGAAGGTGGG - Exonic
1027880733 7:83832175-83832197 TTGTAGAAGGATCACGTGGTTGG + Intergenic
1028424940 7:90676231-90676253 TTAAAGCAGGAAAAGGAGATAGG + Intronic
1028746859 7:94337129-94337151 ACGAAGTAGGGTAAGGAGGTAGG - Intergenic
1028898843 7:96073247-96073269 GTGAAGGGTGATAAGGAGGTTGG + Intronic
1028981718 7:96974492-96974514 GGGAAGAAATATAAGGAGGTAGG + Intergenic
1030394789 7:108972310-108972332 TTCAAGAAGGTTGAGAAGGTTGG - Intergenic
1030421077 7:109306995-109307017 TGGAAGAAGAAAAAGGAAGTTGG - Intergenic
1030493640 7:110269843-110269865 GTGAACAAGGACAAGGACGTTGG - Intergenic
1030503863 7:110395164-110395186 TGGAAGAAAGAGAAGGAGGGAGG + Intergenic
1030589492 7:111463654-111463676 TGGCAGAAGGAAAAAGAGGTGGG - Intronic
1030778782 7:113571326-113571348 TTAAACAAGAAAAAGGAGGTGGG + Intergenic
1032691750 7:134294394-134294416 CTGAAGAAGGAAAAGGTGATGGG + Exonic
1033711026 7:143944714-143944736 TTGAAGAAGAATAATAAAGTTGG - Intergenic
1033711065 7:143945445-143945467 TTGAAGAAGAATAATAAAGTTGG - Intergenic
1033890469 7:146006537-146006559 TAGAAGAAGAAGAAGGAGGAGGG - Intergenic
1036425165 8:8638706-8638728 TTGAAGGAGGATTAGGAGTTGGG + Intergenic
1037073179 8:14677852-14677874 TTGAAGGAGGAGAACGAAGTTGG + Intronic
1037637705 8:20715126-20715148 GTGAAGTAGGATAAGGAGAACGG - Intergenic
1038483660 8:27918869-27918891 GGGAAGAAGGAGAAGGAGGAGGG + Intronic
1040793634 8:51264726-51264748 TTGAAGAAGGACAAAGTGGGAGG - Intergenic
1040918122 8:52584849-52584871 TTGAATAAATATAAGGAAGTAGG - Intergenic
1040986243 8:53297078-53297100 TGGAGGCAGGATAAGCAGGTGGG - Intergenic
1041243854 8:55872622-55872644 TGGAAGCAGGAGTAGGAGGTTGG - Intergenic
1041785660 8:61630313-61630335 TTGAAAAATGGCAAGGAGGTAGG + Intronic
1042069774 8:64918836-64918858 TTGAAGGAGGAGAAAGAGATAGG + Intergenic
1042350898 8:67776505-67776527 TTGAAGAATGTTGGGGAGGTGGG + Intergenic
1042440402 8:68819794-68819816 TAGAGGAAGGATGAGGAGCTAGG + Intergenic
1043135443 8:76518201-76518223 ATGAAGCAGGAAAAGTAGGTTGG + Intergenic
1043407285 8:79950957-79950979 AGGAAGAAGGAAATGGAGGTGGG - Intronic
1044342130 8:91058113-91058135 TTTAAGGATGATAAGAAGGTTGG + Intergenic
1044460987 8:92443684-92443706 ATGAAGAAGGAGGAGCAGGTTGG + Intergenic
1044775394 8:95681704-95681726 TTGAAGAATGAGCAGGAGTTAGG + Intergenic
1044906541 8:97010012-97010034 TTGAAGAGGGGTTAGAAGGTGGG + Intronic
1045773285 8:105770912-105770934 TAGAGGAAAGATAAGGAGATTGG - Intronic
1046015600 8:108601126-108601148 AAGAAGAAGGAGAAGGAGGAGGG + Intergenic
1046186617 8:110729762-110729784 TAGAAGGAGGAGAAGGAGGGAGG + Intergenic
1046363167 8:113187858-113187880 TTGGAGAAGTATAAAGGGGTAGG - Intronic
1046860181 8:119082589-119082611 TTGAAGACGGAGATGGAGGCAGG + Intronic
1047748859 8:127865230-127865252 TTTCAGAAGGACAAGGTGGTAGG + Intergenic
1048156192 8:131955777-131955799 TTGCAGAAGGAGAAGAAGGAGGG - Exonic
1048477225 8:134754666-134754688 TTGAAGAAGGGTGAGGTGGGTGG - Intergenic
1048941146 8:139401954-139401976 GAGAAGAAGGATAAGGGGGATGG - Intergenic
1050234873 9:3566928-3566950 TTGAAGAAGGAAGAGGAGTGGGG + Intergenic
1051187901 9:14479974-14479996 AGGAAGAAGGAGAAGGAGGCAGG + Intergenic
1051250248 9:15151879-15151901 TTGAAAAAGGAAAAGAGGGTTGG + Intergenic
1051261952 9:15273358-15273380 TGCAAGAAGGAAAAGGAAGTAGG + Intronic
1051893455 9:21965851-21965873 TTGAGGAAGGGTAAGGAGGAAGG + Intronic
1052426728 9:28314453-28314475 TTGAAGAAGGAACAGGAGACAGG - Intronic
1053099529 9:35359535-35359557 CAGAAGAAGGATCAGGAGTTTGG - Intronic
1053388276 9:37713171-37713193 TTTAAAAAGGATAATGAGGATGG + Intronic
1054800739 9:69345902-69345924 TTTAATAAGAATAAGAAGGTAGG - Intronic
1055007867 9:71529101-71529123 TTGAATCAGGCTCAGGAGGTTGG - Intergenic
1055066356 9:72123082-72123104 TTGAAGAAAGATAAGTAATTAGG - Intronic
1055420584 9:76136977-76136999 CTGAAGAAATGTAAGGAGGTTGG - Intronic
1055715816 9:79116864-79116886 TGTAAGGAGGAGAAGGAGGTAGG + Intergenic
1055958231 9:81794299-81794321 GTGAAGAAGGCTGGGGAGGTGGG - Intergenic
1056614090 9:88147897-88147919 TTGAAGAAGAACAAAGAAGTCGG + Intergenic
1058606077 9:106724849-106724871 TTGAAAAAGTATAAGCAGGCTGG + Intergenic
1059067157 9:111097408-111097430 GTGAAGAAGGGAAAGGAGGCTGG - Intergenic
1059649821 9:116305626-116305648 TTGAAGAATGACAAGGGGATTGG - Intronic
1059970248 9:119659939-119659961 TTGAAGAATGATGAGAATGTTGG + Intergenic
1060214076 9:121727856-121727878 TGGGAGAAGGAGATGGAGGTGGG - Intronic
1060385920 9:123228190-123228212 TTAAAGAAAGAAAAGGAGTTGGG + Intronic
1060394135 9:123303776-123303798 TTGGGGAAGAATAAGAAGGTTGG - Intergenic
1060446205 9:123690665-123690687 TTAAAGAAAGAAAAGGAGGGGGG - Intronic
1060593079 9:124831669-124831691 TTGAAGCAGGAGATGGAAGTGGG - Intergenic
1060847127 9:126846457-126846479 ATGAAGAAAGGTACGGAGGTGGG + Intergenic
1061224995 9:129276312-129276334 CTCAAGAAGGATGAGGAGGGAGG - Intergenic
1185814493 X:3142397-3142419 AAGAAGAAGGAGGAGGAGGTGGG + Intergenic
1187016923 X:15338426-15338448 TTGAAGCAGAATCAGGAGTTAGG - Intergenic
1187824738 X:23323660-23323682 TGGAAGAAGAAGAAGGAGGAGGG - Intergenic
1188253138 X:27924637-27924659 TTGAAGGAGCATAAGGACATGGG - Intergenic
1188269297 X:28118878-28118900 GGGAAGAAGGAAAAGGAGGAGGG - Intergenic
1189193544 X:39132738-39132760 TTGAAGATGGAGGAAGAGGTAGG - Intergenic
1189280717 X:39818703-39818725 TTTAAGAAGGATAAAGGGGGGGG + Intergenic
1189314010 X:40040907-40040929 TAAAAGAAGGAGAAGGAGGAGGG - Intergenic
1189601741 X:42634138-42634160 TTGAAGAAAGAGAAGGAAGATGG + Intergenic
1190762496 X:53448213-53448235 TTGAAGAAATAAAAGGAGGCCGG - Intergenic
1193675300 X:84444443-84444465 TGGAACCAGGGTAAGGAGGTAGG + Intronic
1194539008 X:95146943-95146965 TTGAAGAATGACAAAGATGTTGG + Intergenic
1195318451 X:103701148-103701170 AGGAAGAAGGAAAAGGAGGAGGG - Intergenic
1195658786 X:107358661-107358683 GTGAAGAAGGAGAGGGAGGGAGG + Intergenic
1196313282 X:114194248-114194270 TTGAAGAAGAATAACAAAGTTGG + Intergenic
1198381769 X:136090805-136090827 TTGAAGAAGAACAATAAGGTGGG + Intergenic
1199045569 X:143167319-143167341 CTGAAGAAGCAGAAGGAGGGTGG + Intergenic
1199193840 X:145003745-145003767 CTGAAGATGGAGAAGGAGGAGGG + Intergenic
1201315656 Y:12643143-12643165 TTTATTAAAGATAAGGAGGTTGG - Intergenic
1201786041 Y:17780333-17780355 TGTAAGAAGGATAAGGATTTGGG - Intergenic
1201815512 Y:18125655-18125677 TGTAAGAAGGATAAGGATTTGGG + Intergenic