ID: 1135866810

View in Genome Browser
Species Human (GRCh38)
Location 16:26110810-26110832
Sequence TGAGAGAGGGAGACAGTGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 2143
Summary {0: 1, 1: 0, 2: 10, 3: 214, 4: 1918}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1135866810_1135866814 -4 Left 1135866810 16:26110810-26110832 CCTTCCACTGTCTCCCTCTCTCA 0: 1
1: 0
2: 10
3: 214
4: 1918
Right 1135866814 16:26110829-26110851 CTCACGCTCTCCAGCTACACCGG 0: 1
1: 0
2: 1
3: 14
4: 154

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1135866810 Original CRISPR TGAGAGAGGGAGACAGTGGA AGG (reversed) Intronic
Too many off-targets to display for this crispr