ID: 1135868317

View in Genome Browser
Species Human (GRCh38)
Location 16:26125569-26125591
Sequence TAGAATCCTCAAGAAAAGCA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 282
Summary {0: 1, 1: 0, 2: 2, 3: 20, 4: 259}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1135868307_1135868317 21 Left 1135868307 16:26125525-26125547 CCAGTACTGGTCTGCAGCCCAGC 0: 2
1: 2
2: 19
3: 75
4: 279
Right 1135868317 16:26125569-26125591 TAGAATCCTCAAGAAAAGCATGG 0: 1
1: 0
2: 2
3: 20
4: 259
1135868312_1135868317 4 Left 1135868312 16:26125542-26125564 CCCAGCGGTTGGGGACCCCTGCT 0: 1
1: 78
2: 329
3: 803
4: 1242
Right 1135868317 16:26125569-26125591 TAGAATCCTCAAGAAAAGCATGG 0: 1
1: 0
2: 2
3: 20
4: 259
1135868313_1135868317 3 Left 1135868313 16:26125543-26125565 CCAGCGGTTGGGGACCCCTGCTT 0: 1
1: 39
2: 191
3: 492
4: 880
Right 1135868317 16:26125569-26125591 TAGAATCCTCAAGAAAAGCATGG 0: 1
1: 0
2: 2
3: 20
4: 259

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1135868317 Original CRISPR TAGAATCCTCAAGAAAAGCA TGG Intronic
900743414 1:4344033-4344055 TAGGATCATCACGGAAAGCAGGG - Intergenic
901243228 1:7707183-7707205 TAGAAGACTAAAGAAAAGCCTGG - Intronic
901787825 1:11636364-11636386 CAGAACCCACAAGAAGAGCAGGG - Intergenic
901806411 1:11741292-11741314 AAGCATCCTGAAGGAAAGCAAGG - Intronic
904432522 1:30473754-30473776 TAGAATCTTCAAGCAAAGGGAGG - Intergenic
907657209 1:56356443-56356465 TGGAAACATCAAGGAAAGCATGG + Intergenic
909349211 1:74629850-74629872 TAGAACTCTAAAGAAAAGCAGGG + Intronic
909954852 1:81767015-81767037 TAAAATTATAAAGAAAAGCAAGG - Intronic
911023744 1:93414787-93414809 TAGGATCCTGAAGAGAATCAAGG + Intergenic
911067350 1:93802374-93802396 TAGTATCTGAAAGAAAAGCAAGG - Intronic
911131710 1:94395113-94395135 TGGAATGCAGAAGAAAAGCAAGG - Intergenic
911506826 1:98763372-98763394 AAGAATCCTGAAACAAAGCATGG - Intergenic
911866084 1:103023918-103023940 TACAATTCTCAAGAAGAGTAAGG + Intronic
913030205 1:114894209-114894231 TAGAATCCAAAAGAAAAACCTGG - Intronic
915075180 1:153302361-153302383 TACAATCCTGAAGAAAAAGAGGG + Intronic
916298884 1:163251477-163251499 AAGAATCCACAAGAAAAGGAGGG - Intronic
917801767 1:178577835-178577857 TAAAACTCTAAAGAAAAGCAAGG + Intergenic
918004461 1:180528555-180528577 TCTAATCCTCAAGAAATGCGTGG - Intergenic
919737992 1:200965512-200965534 TAGAATCCTTCAGAGAAGCAAGG + Intergenic
920949131 1:210556262-210556284 TTGAATCTTTAAGAAAATCAGGG - Intronic
921474626 1:215591659-215591681 AAGAATCCTCAAGGAAAGAAAGG - Intronic
922448524 1:225717988-225718010 TAGAAGCCTGAAGAAAATTATGG + Intergenic
923233459 1:232010217-232010239 TGGAATCCTCCAGCAAAGCCTGG + Intronic
924275480 1:242381904-242381926 TAGAATCCAGAAGAACAGCTAGG + Intronic
1062978526 10:1702635-1702657 TACAGTGCTCAAGCAAAGCAGGG - Intronic
1063504805 10:6587274-6587296 TATAAGCCTCAAGAAGAGAATGG + Intergenic
1064705049 10:18063045-18063067 TAGAATCCTAATGTAAAGTATGG - Intergenic
1070384065 10:75908061-75908083 TATAATCCTCCAAAAATGCAGGG - Intronic
1070449029 10:76539186-76539208 TAGAAACCCCAAGGAAGGCAAGG + Intronic
1071990881 10:91099937-91099959 TTGAATGCTCAACAAAAGCAGGG + Intergenic
1072306871 10:94116114-94116136 TAGAATTTTGAAGAAAAGGATGG - Intronic
1072592457 10:96839406-96839428 TAGAATTCTCAAGAAAAGCCAGG + Intronic
1072718429 10:97766603-97766625 TGGAATGCCTAAGAAAAGCAAGG - Intergenic
1072910546 10:99497134-99497156 TAGGATCTTCAAGGAAATCAGGG + Intergenic
1073863912 10:107779157-107779179 TAGAATTTTGAATAAAAGCAAGG - Intergenic
1075000618 10:118794490-118794512 TAAAATCCTGAAGAAAATCAAGG - Intergenic
1075991468 10:126842216-126842238 TAGAAGCCTTATGACAAGCAGGG + Intergenic
1076296345 10:129387818-129387840 TATATTCCTCGAAAAAAGCAAGG + Intergenic
1076481381 10:130787131-130787153 TTCTATCCTCAAGAAATGCATGG + Intergenic
1078508940 11:11971338-11971360 TAGAACCATAAACAAAAGCAGGG + Intronic
1079977683 11:27112283-27112305 TAAAATTGTAAAGAAAAGCAAGG + Intronic
1081169024 11:39843891-39843913 TAAAATACTCAATAAAATCAAGG - Intergenic
1088064395 11:105698343-105698365 TATAAACCTCATGAAAAACATGG + Intronic
1088375384 11:109135165-109135187 TTGAATCCTCAAGACAACCTTGG + Intergenic
1088533317 11:110834209-110834231 GAAAATTCTCAAGAAAAGCAAGG + Intergenic
1088578413 11:111294946-111294968 TAGAATCTTGAAGAAACGCCTGG - Intergenic
1088725079 11:112627501-112627523 TAGAATCCACAAGAGATGGAAGG + Intergenic
1089024791 11:115258417-115258439 CACAAACCACAAGAAAAGCATGG + Intronic
1089542379 11:119197404-119197426 AAGAAACCTAAAGAAAAGAAAGG - Intergenic
1089813873 11:121154924-121154946 TGGAACTCTCAGGAAAAGCATGG + Intronic
1090049499 11:123365210-123365232 TAGAATCTACAAGGAAAGCATGG - Intergenic
1090539294 11:127682794-127682816 GAGACTCATCAAGAAGAGCAGGG + Intergenic
1094003548 12:25723080-25723102 TAAAATCCTCATGAAAATCCAGG - Intergenic
1094438310 12:30446299-30446321 TAGAAACCACAATAAAAACAAGG + Intergenic
1096069065 12:48764681-48764703 TAGAATCCGGAAGTGAAGCAGGG + Intergenic
1097947636 12:65389505-65389527 TAAAATCCTCAATAAATGAAGGG - Intronic
1099737790 12:86593231-86593253 TAGAATCATAAATAAAAGAAGGG - Intronic
1100136621 12:91560544-91560566 GAAAATCCTCAATAAAAGAATGG + Intergenic
1102425192 12:112838476-112838498 ATGAATCCTGAAGAAAAGGAGGG - Intronic
1102590153 12:113950689-113950711 TTTAATGCTCCAGAAAAGCAGGG - Intronic
1102672125 12:114629095-114629117 TAAAATTATAAAGAAAAGCAAGG + Intergenic
1103840721 12:123861973-123861995 TGGAATCCTCCAGAACAGGAAGG - Intronic
1105835844 13:24211524-24211546 AAAAATCCTCAACAAAATCAAGG - Intronic
1106386200 13:29288529-29288551 TAGAAATGTCAAGAAAAGGAGGG + Intronic
1106674360 13:31942171-31942193 CAAAATCCACAAGGAAAGCATGG + Intergenic
1107997493 13:45875050-45875072 TAAAATCATAAAGAAATGCAGGG - Intergenic
1108042938 13:46356279-46356301 TGGACTCCTCATGAAAAGGAGGG + Intronic
1108210423 13:48134050-48134072 TAGAATCCTCATTAAAATGAGGG - Intergenic
1108697247 13:52913350-52913372 TAGAGTCCTCAGAAAGAGCACGG - Intergenic
1109302475 13:60603465-60603487 AAGAATCATCATGAACAGCAAGG + Intergenic
1109420961 13:62111558-62111580 TAGGTTACTCAAGAAATGCAAGG - Intergenic
1110967459 13:81717910-81717932 TAGAAACTTGAAGAAAAGAAGGG - Intergenic
1111359028 13:87149588-87149610 TTGCATTTTCAAGAAAAGCATGG + Intergenic
1112874044 13:104013670-104013692 TGGAATCCTCAAGAAAAGAGTGG - Intergenic
1114713516 14:24802228-24802250 TAGAATCCCAGAGAAAAGGAAGG + Intergenic
1116880788 14:50166687-50166709 TAGGAGTTTCAAGAAAAGCAGGG - Intronic
1117004339 14:51403278-51403300 TAAAATCTTAAAGAAAGGCAAGG - Intergenic
1117854524 14:60014305-60014327 TAGAAAAATCAAGAAAAGAAGGG + Intronic
1118677889 14:68208248-68208270 GAGAGTCCCCAAGAAAAACAAGG + Intronic
1119204904 14:72787100-72787122 TAGAACCCTCAGGAACAGCCAGG + Intronic
1119419009 14:74494941-74494963 AACAATCCTCAAGCACAGCAAGG + Exonic
1119711978 14:76828983-76829005 TAGATTTATCAAGAAAAGTAGGG - Intronic
1120400759 14:84028318-84028340 TGGAAGCCTCAGGGAAAGCATGG + Intergenic
1120913481 14:89689201-89689223 TAGAATTAGGAAGAAAAGCAGGG + Intergenic
1121276500 14:92671574-92671596 AAGATTCCTCAAGGAAAACATGG + Intronic
1121375538 14:93406913-93406935 TAGAAGTCTAAAGAAAATCAAGG + Intronic
1124471064 15:29986415-29986437 TAAAACCATAAAGAAAAGCAAGG + Intergenic
1125086883 15:35740409-35740431 TGGAATCTTCAAGGTAAGCAAGG - Intergenic
1125188713 15:36964391-36964413 TAGAGTGCACAAGGAAAGCAAGG + Intronic
1128611926 15:69080972-69080994 AAGAATCCTCCAGAAGAGGAGGG - Intergenic
1129965302 15:79729672-79729694 TAGAATCCTCAGGAACTGGATGG + Intergenic
1135868317 16:26125569-26125591 TAGAATCCTCAAGAAAAGCATGG + Intronic
1136372056 16:29842676-29842698 TAGGAACCCCAAGAAAAGGAGGG + Intronic
1137577463 16:49610284-49610306 TAGAAAACTCAAGAAGAGAAGGG - Intronic
1138297264 16:55897450-55897472 AGTATTCCTCAAGAAAAGCAAGG - Intronic
1140487088 16:75302056-75302078 GAGAAGCCTCAAGCAAAGGAGGG + Intronic
1141336987 16:83165302-83165324 TTGAATCTTCAAGACAGGCAGGG - Intronic
1143789357 17:9281393-9281415 TAGAAAACAGAAGAAAAGCAGGG + Intronic
1150315024 17:64161718-64161740 TAGAATCCTCAAGTAGAAGAGGG - Intronic
1150651304 17:67012072-67012094 AAGAATCCTCTATAGAAGCAGGG - Intronic
1151780625 17:76242569-76242591 TAGAATAGTAAAGAAAAACAAGG + Intergenic
1152108935 17:78346505-78346527 TAGAACCCTCAAGACCAGCAAGG + Intergenic
1152405175 17:80094030-80094052 AAGAATCCCGAAGATAAGCAGGG - Intronic
1152443787 17:80328143-80328165 TATAATTCTCAAGAACATCACGG + Intronic
1154164556 18:12004818-12004840 TAGAATCCACAATATAGGCAGGG - Intronic
1156193929 18:34751604-34751626 TAGAATCGTGAAGAAAAGCAGGG - Intronic
1156551206 18:38019322-38019344 TAGAATCCTTGTGAAAAGTAAGG - Intergenic
1158076535 18:53536603-53536625 TAGATTCCTCATGAATGGCATGG - Intergenic
1158795541 18:60841357-60841379 TAGAAAACAGAAGAAAAGCAGGG + Intergenic
1158902914 18:61983059-61983081 TAGGACGCTAAAGAAAAGCAGGG - Intergenic
1159638816 18:70839355-70839377 TGGAATCATCAAGGAAAACATGG + Intergenic
1161177583 19:2855728-2855750 TAGCATCTTCAGAAAAAGCATGG - Exonic
1165930339 19:39353990-39354012 AAGAATCCTGAAGAAATGAATGG - Exonic
1166350157 19:42194091-42194113 TAGAAAATTGAAGAAAAGCAAGG + Intronic
1167188529 19:47965914-47965936 AAGAATACTCAAGAAAGGCCAGG + Intergenic
925842075 2:8001833-8001855 TAGAATCTATAAGAAAAGAAAGG + Intergenic
926411593 2:12608926-12608948 AAGAATCCTGGAGAAATGCAAGG + Intergenic
926710888 2:15879504-15879526 TAAAATTCTAAATAAAAGCAAGG + Intergenic
926802461 2:16671106-16671128 TAAAAACCTAAAGAAATGCAAGG - Intergenic
926819301 2:16835075-16835097 TAGAATCCCCAGGATAAGCCAGG - Intergenic
926930034 2:18027976-18027998 AATAAACATCAAGAAAAGCATGG - Intronic
929440392 2:41961594-41961616 TAGAATCTTTAAGAAAACAAAGG + Intergenic
930734273 2:54759359-54759381 TAAAATACTCCAGAAAACCAAGG - Intronic
931773002 2:65515534-65515556 CAGAATCATCAAGTAAGGCATGG - Intergenic
932485524 2:72082082-72082104 TAGAACCCACAACAAAAACATGG + Intergenic
932954841 2:76338887-76338909 TAGAATACTCATGAAAAATAAGG + Intergenic
935965575 2:108471013-108471035 AAGAACCTTCAAGAAAAGAATGG + Exonic
936796429 2:116210783-116210805 TATAATCTTCAACTAAAGCAAGG - Intergenic
937036419 2:118786167-118786189 CAGGACCCTCAGGAAAAGCACGG + Intergenic
939162698 2:138608460-138608482 TAGAAACCTCTGGAAAAGAAAGG - Intergenic
939745623 2:145962732-145962754 TATAATCCTTAACAAAAACAGGG + Intergenic
941215809 2:162707693-162707715 TAATATCCTCAAAAAATGCAAGG + Intronic
941320892 2:164052866-164052888 TATGATCCTTAAGAAAAGAAAGG - Intergenic
942591180 2:177548471-177548493 TAGAATCAAGAAGCAAAGCAGGG + Intergenic
944419364 2:199512623-199512645 CAGAGTCTTCAAGACAAGCAGGG + Intergenic
945024744 2:205609377-205609399 TGGCATGCTCAAGAATAGCATGG + Intronic
946890677 2:224272835-224272857 TAGAATACTTAAGAAAACTATGG + Intergenic
947254130 2:228142974-228142996 TAGATTCCTCGTGGAAAGCATGG - Intronic
947826075 2:233106995-233107017 TTGAATCTTCAAGGAAAGCATGG + Intronic
948471034 2:238179375-238179397 TAGATTCTTCTAAAAAAGCAGGG - Intronic
948595024 2:239074225-239074247 TAAAATCCACACCAAAAGCATGG - Intronic
1170107825 20:12770999-12771021 CAGTATCATAAAGAAAAGCAAGG + Intergenic
1171749615 20:29036059-29036081 TTGAATCCTTACTAAAAGCAAGG + Intergenic
1171770802 20:29320820-29320842 CAGAAACCTCCAGAGAAGCATGG + Intergenic
1174352772 20:49980295-49980317 TAGAATTAGAAAGAAAAGCAAGG - Intergenic
1174733195 20:52938274-52938296 GAGAAGAATCAAGAAAAGCAGGG + Intergenic
1175735093 20:61380035-61380057 TTGAATATTCAACAAAAGCAAGG + Intronic
1176315621 21:5239941-5239963 TTGAATCCTTACTAAAAGCAAGG - Intergenic
1177280327 21:18973631-18973653 TAGAAAACAGAAGAAAAGCAGGG + Intergenic
1177340381 21:19791216-19791238 TAGAATACTCCATAAATGCATGG + Intergenic
1178612192 21:34093578-34093600 TAGAATCATCAGAAAAAGCATGG + Intronic
1180393417 22:12305894-12305916 TTGAATCCTTACTAAAAGCAAGG - Intergenic
1180406332 22:12558874-12558896 TTGAATCCTTACTAAAAGCAAGG + Intergenic
1181964134 22:26644924-26644946 AACAATCCTCAAGCACAGCAAGG - Intergenic
1182220595 22:28755542-28755564 TAAAACTATCAAGAAAAGCAAGG - Intronic
1184229152 22:43149044-43149066 TAAAACCCTAAAGGAAAGCAAGG + Intergenic
1184298502 22:43541284-43541306 TTGAATCCTCAGAAGAAGCAGGG + Intronic
949645916 3:6093816-6093838 CAGAAACCTCCAGAAATGCATGG - Intergenic
950912302 3:16606737-16606759 TAAAATCCTTAGGAAAAGGATGG + Intronic
952305241 3:32139896-32139918 TAAAATAGTCAAGAAAAGCAAGG + Intronic
955952498 3:64256660-64256682 TATAATCCTATAGAAAAGTATGG + Intronic
956050744 3:65245536-65245558 TCAAATTATCAAGAAAAGCAAGG + Intergenic
959613802 3:108324631-108324653 TATAACACTAAAGAAAAGCAAGG - Intronic
959998846 3:112709309-112709331 TAGAAAACACAAAAAAAGCAGGG - Intergenic
960271463 3:115679123-115679145 TAGAATCCTAAAGCAACCCATGG - Intronic
962838828 3:139215194-139215216 CAGAATCCTCCAGAGAACCATGG + Intronic
964247682 3:154672099-154672121 TACAACCCTCAAGAGAAGCAGGG - Intergenic
964933869 3:162058625-162058647 TACAATCATCATGGAAAGCAAGG + Intergenic
965288765 3:166849546-166849568 TAGATTCCTCAGATAAAGCAGGG + Intergenic
965881034 3:173388307-173388329 TAGAGTCATCAAGAAAAAAATGG - Intergenic
965882433 3:173401684-173401706 CAGAATCTACAAGAAAAGAAGGG + Intronic
965985943 3:174753379-174753401 TAAAATCCTTAAGAAAAAAAGGG - Intronic
966967646 3:185011080-185011102 TGGAATCCTAAAAAAAAGTAGGG + Intronic
968280530 3:197473670-197473692 TAGAATCCCAAATAAAGGCAAGG - Intergenic
968668803 4:1836773-1836795 CAGCAGCCTCCAGAAAAGCAGGG + Intronic
970264715 4:14268832-14268854 TTGTATACTGAAGAAAAGCATGG + Intergenic
970515489 4:16825406-16825428 TTGAATCCCCAAGGCAAGCAGGG + Intronic
970749431 4:19339687-19339709 GAAAATCCTCAAGAAAATCTTGG - Intergenic
971052893 4:22881123-22881145 AAGAATCCACAAAAACAGCAGGG - Intergenic
971985876 4:33823039-33823061 TAGAATCCTAAAGTAAAACATGG - Intergenic
973166057 4:47079013-47079035 AAGAATCCTCAAGAAAATACTGG - Intronic
974108323 4:57496725-57496747 AAGACTCCTGAAGATAAGCAGGG - Intergenic
976508831 4:85883383-85883405 TAGAATCATCAAGAAAGGAGAGG - Intronic
977070164 4:92375436-92375458 TAGTATCCTCTACAAAAACAAGG + Intronic
980400039 4:132271381-132271403 TAGATTTTTCAAGAAATGCAAGG - Intergenic
980415477 4:132483101-132483123 TAGAGTTATCAAGAAAACCAGGG - Intergenic
982256852 4:153459248-153459270 TAGATTCCTCATGAATAGCTTGG - Intergenic
982894307 4:160897608-160897630 TACAATACTCATGAACAGCATGG + Intergenic
982929409 4:161383620-161383642 TTGAATACACAAGAAAAGAAGGG + Intergenic
983368776 4:166832185-166832207 AAGAATCCTAAAAGAAAGCATGG - Intronic
984739711 4:183149257-183149279 TGTATTCCTAAAGAAAAGCAAGG - Intronic
986255259 5:6097629-6097651 TTGCAACCTCAGGAAAAGCAAGG + Intergenic
986477250 5:8147709-8147731 TAGAATCCACCAGAAAATCCCGG - Intergenic
987646867 5:20684680-20684702 TAGAAGGCAAAAGAAAAGCAGGG - Intergenic
988722934 5:33896657-33896679 TAGAGAGCCCAAGAAAAGCAAGG + Intergenic
990702854 5:58494172-58494194 TAGAAAACTCAAGAAAAAGAAGG - Intronic
990884951 5:60580653-60580675 TAGAAACATCAGGAAAGGCATGG - Intergenic
992584952 5:78229091-78229113 TAAAATCCTAAAAAAAAGCCGGG - Intronic
993672305 5:90776175-90776197 TATCATGCTCATGAAAAGCAAGG - Intronic
993845072 5:92931199-92931221 TAGAAGCCAGAAGAAAAACAAGG + Intergenic
994979281 5:106852495-106852517 AAAAATCATCAATAAAAGCAGGG + Intergenic
995021207 5:107369168-107369190 CTGAATCTTCAAGAAAATCAAGG + Intergenic
995639657 5:114240062-114240084 CAGTATCCTCAAGAAAAGTAAGG + Intergenic
996348061 5:122509030-122509052 TTAAATCCTCAATAAGAGCAAGG + Intergenic
997618095 5:135266446-135266468 TAGATTGCTCAGGAACAGCAAGG - Intronic
997672840 5:135690580-135690602 GAGAATCCCAAGGAAAAGCAGGG - Intergenic
1002991170 6:2240223-2240245 TAGATTCCCCATGCAAAGCAAGG + Intronic
1004220841 6:13744854-13744876 CAGAAACCACAAGAAAAACACGG + Intergenic
1008482905 6:52005439-52005461 TAGAACCCACAGGAATAGCAAGG - Intronic
1009276985 6:61695402-61695424 TAGAATCCTCTAGAGAAGGATGG - Intronic
1010439307 6:75875004-75875026 GAGAATTCAAAAGAAAAGCAGGG - Intronic
1010694771 6:78957799-78957821 TAAAATCCTTAAGATAAGGAAGG + Intronic
1011250620 6:85368152-85368174 AAAAATCCTCAAGAAAATAATGG + Intergenic
1012161677 6:95892198-95892220 TAGAAACTTAAAGAAAGGCACGG - Intergenic
1012565614 6:100646260-100646282 TCTCATCCTCAAGAAAACCATGG - Intronic
1014583815 6:123172246-123172268 TAGTAACCTCAAGAAAATCCAGG + Intergenic
1017604057 6:156114308-156114330 TATAATCATCAAGAAAGGTATGG + Intergenic
1017903295 6:158736817-158736839 TAAAACCATCAAGAAAATCAAGG + Intronic
1018288534 6:162266113-162266135 TAGAAACCTCAAGATAGGCTAGG - Intronic
1024656490 7:51455157-51455179 TGGAAAACTCAAGAAAATCAGGG + Intergenic
1026439889 7:70434958-70434980 TGGGATCCTCATGATAAGCAAGG - Intronic
1026777345 7:73238995-73239017 TAGAATCAAAAAGAAAAGCCTGG - Intergenic
1027018195 7:74792367-74792389 TAGAATCAAAAAGAAAAGCCTGG - Intergenic
1027069832 7:75153551-75153573 TAGAATCAAAAAGAAAAGCCTGG + Intergenic
1028659001 7:93245724-93245746 TAAAAGCCTGAAGAAAAACAGGG + Intronic
1029013187 7:97284174-97284196 TAAAATCCTCAGCAGAAGCAGGG + Intergenic
1030120602 7:106106904-106106926 TAGAATCCTCAGAATTAGCATGG - Intronic
1032558992 7:132868738-132868760 TAGAATCCAAATGAAAAGCTTGG + Intronic
1033223390 7:139543333-139543355 AAGAAGCTTCCAGAAAAGCAGGG - Intronic
1033860378 7:145617017-145617039 AAGCATCCTCAAGAAATGTAAGG - Intergenic
1035935217 8:3829475-3829497 AAAAATACTCAAGAACAGCAGGG - Intronic
1036744591 8:11396345-11396367 TTGATTACTTAAGAAAAGCAAGG - Intronic
1037030844 8:14102792-14102814 CAGAATGCTCATGAAAAGTAGGG + Intronic
1037435185 8:18855107-18855129 CAGGATCCCCAGGAAAAGCATGG - Intronic
1038367816 8:26954468-26954490 TAGAAGCCAGAAGAAGAGCAGGG - Intergenic
1038381986 8:27104716-27104738 GACAATCCTCAAGAGAAGGAAGG + Intergenic
1038522024 8:28242106-28242128 CACAATCCTCAAGATAAGGAAGG - Intergenic
1038649843 8:29392588-29392610 TAGAATCACCAACAATAGCAGGG - Intergenic
1038727980 8:30098490-30098512 TAGAATCCTGGAGAAAACAAAGG - Intronic
1040531452 8:48269712-48269734 TTCAATCCACAAGAAAAACAGGG - Intergenic
1040939474 8:52817898-52817920 TAGAAGCCACAAGAAAATAAAGG - Intergenic
1041250448 8:55929217-55929239 TAGTTTCCTCATGAGAAGCAGGG + Intronic
1041779656 8:61563811-61563833 TATTATCCACAACAAAAGCATGG + Intronic
1042554854 8:70025441-70025463 CAGAATCCCCAAGAGAGGCAGGG - Intergenic
1042652760 8:71061235-71061257 GAGAGCCCTCAAGAAAGGCAGGG - Intergenic
1043310615 8:78854556-78854578 TAAATTCCTAAGGAAAAGCAGGG + Intergenic
1044856784 8:96484604-96484626 AAAAATATTCAAGAAAAGCATGG + Intergenic
1046159675 8:110344169-110344191 TAGAAAGATCAAGTAAAGCAAGG - Intergenic
1047155289 8:122310597-122310619 TAGAATACTGCAGAATAGCAAGG - Intergenic
1047514866 8:125545096-125545118 CAGAATCCTCTAGAAACCCAAGG - Intergenic
1047833609 8:128662863-128662885 TAGAATCCAGAAGAGAAACATGG - Intergenic
1047894210 8:129347224-129347246 GAGAGTCCTCAAGAAAAACCAGG + Intergenic
1047947487 8:129896372-129896394 TATAAACATCAAGAAAATCAAGG + Intronic
1048569685 8:135641424-135641446 TAAAATTCTCAAGAACATCAAGG + Intronic
1050337270 9:4601713-4601735 GAGAGTCCTCAAGAAAAGCCGGG + Intronic
1050344098 9:4669254-4669276 GAGCAACCTCCAGAAAAGCAAGG - Intergenic
1051091813 9:13418637-13418659 TGGAATCCTGAAGAAAAGAAAGG - Intergenic
1051377503 9:16418478-16418500 AAGAATCTTCAATTAAAGCATGG - Exonic
1055303014 9:74901972-74901994 TATAATCATAAAGAAATGCAAGG - Intergenic
1055463072 9:76537488-76537510 TGGAATTATCTAGAAAAGCAGGG + Intergenic
1056735233 9:89203835-89203857 TAGAGACCTAAAGAACAGCATGG + Intergenic
1058396345 9:104558135-104558157 TAAAATCCTCAGCAAAATCAAGG + Intergenic
1059512915 9:114865805-114865827 CAGATTCCTCATGAACAGCATGG - Intergenic
1060867030 9:127008565-127008587 TAGAATCCTCCAGAAAGGAAGGG + Intronic
1187243584 X:17534767-17534789 TAGCATCTGCTAGAAAAGCAAGG - Intronic
1187517814 X:19988703-19988725 AATAATCCTTAAGAAAAGTAAGG + Intergenic
1187653634 X:21442608-21442630 TGGAATCATCATGAAAAACAGGG - Intronic
1189078573 X:37944007-37944029 TAAAAAGCTCCAGAAAAGCAGGG - Intronic
1190839996 X:54134991-54135013 TGGGATCCTCAGAAAAAGCATGG + Exonic
1191047939 X:56159288-56159310 TAAAATCCTCAATAAAACAATGG - Intergenic
1194529343 X:95025869-95025891 AAGAAAACTAAAGAAAAGCAGGG - Intergenic
1196423161 X:115543454-115543476 AAGTATCCTGAAGAAAAGAAAGG - Intergenic
1196898756 X:120362706-120362728 TAGAATCCCCAATAGGAGCAGGG + Intronic
1197283921 X:124572398-124572420 TAGAATCTCCTAGAAAAACATGG + Intronic
1197838219 X:130717900-130717922 TAGAATTATAAAGATAAGCAAGG - Intronic
1199427504 X:147719906-147719928 TAGAAGCCTTAAGAAGTGCATGG - Intergenic
1199460508 X:148078559-148078581 TATAATTTTCAAGAAAAACATGG - Intergenic
1200758738 Y:7016434-7016456 TGCAATCCTAAATAAAAGCATGG - Intronic
1202282135 Y:23200298-23200320 TAAAATCCTTAGGAAAAGGATGG + Intergenic
1202283756 Y:23218221-23218243 TAAAATCCTTAGGAAAAGGATGG - Intergenic
1202433807 Y:24814683-24814705 TAAAATCCTTAGGAAAAGGATGG + Intergenic
1202435432 Y:24832607-24832629 TAAAATCCTTAGGAAAAGGATGG - Intergenic