ID: 1135874174

View in Genome Browser
Species Human (GRCh38)
Location 16:26182154-26182176
Sequence CCAGTTCAGCAGATATTTAT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1135874168_1135874174 24 Left 1135874168 16:26182107-26182129 CCAACTTCCCGGTAGGTGTCCAG No data
Right 1135874174 16:26182154-26182176 CCAGTTCAGCAGATATTTATTGG No data
1135874172_1135874174 5 Left 1135874172 16:26182126-26182148 CCAGATAAGTGGTAACATAATTA No data
Right 1135874174 16:26182154-26182176 CCAGTTCAGCAGATATTTATTGG No data
1135874169_1135874174 17 Left 1135874169 16:26182114-26182136 CCCGGTAGGTGTCCAGATAAGTG No data
Right 1135874174 16:26182154-26182176 CCAGTTCAGCAGATATTTATTGG No data
1135874170_1135874174 16 Left 1135874170 16:26182115-26182137 CCGGTAGGTGTCCAGATAAGTGG No data
Right 1135874174 16:26182154-26182176 CCAGTTCAGCAGATATTTATTGG No data
1135874167_1135874174 25 Left 1135874167 16:26182106-26182128 CCCAACTTCCCGGTAGGTGTCCA No data
Right 1135874174 16:26182154-26182176 CCAGTTCAGCAGATATTTATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1135874174 Original CRISPR CCAGTTCAGCAGATATTTAT TGG Intergenic
No off target data available for this crispr