ID: 1135875476

View in Genome Browser
Species Human (GRCh38)
Location 16:26196129-26196151
Sequence CTTTTAATGCTGGAGGTGGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1135875476_1135875484 -5 Left 1135875476 16:26196129-26196151 CCCCCCACCTCCAGCATTAAAAG No data
Right 1135875484 16:26196147-26196169 AAAAGGTCATTATAAGAATTTGG No data
1135875476_1135875486 22 Left 1135875476 16:26196129-26196151 CCCCCCACCTCCAGCATTAAAAG No data
Right 1135875486 16:26196174-26196196 TATAATGCCTATCTGGATAATGG No data
1135875476_1135875485 15 Left 1135875476 16:26196129-26196151 CCCCCCACCTCCAGCATTAAAAG No data
Right 1135875485 16:26196167-26196189 TGGACTGTATAATGCCTATCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1135875476 Original CRISPR CTTTTAATGCTGGAGGTGGG GGG (reversed) Intergenic
No off target data available for this crispr