ID: 1135875518

View in Genome Browser
Species Human (GRCh38)
Location 16:26196480-26196502
Sequence AAGCAGAAGCCTCATGAGGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1135875518_1135875525 28 Left 1135875518 16:26196480-26196502 CCAACCTCATGAGGCTTCTGCTT No data
Right 1135875525 16:26196531-26196553 TCTTTCTCCAGCTAGTCGGGAGG No data
1135875518_1135875526 29 Left 1135875518 16:26196480-26196502 CCAACCTCATGAGGCTTCTGCTT No data
Right 1135875526 16:26196532-26196554 CTTTCTCCAGCTAGTCGGGAGGG No data
1135875518_1135875524 25 Left 1135875518 16:26196480-26196502 CCAACCTCATGAGGCTTCTGCTT No data
Right 1135875524 16:26196528-26196550 CTTTCTTTCTCCAGCTAGTCGGG No data
1135875518_1135875523 24 Left 1135875518 16:26196480-26196502 CCAACCTCATGAGGCTTCTGCTT No data
Right 1135875523 16:26196527-26196549 TCTTTCTTTCTCCAGCTAGTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1135875518 Original CRISPR AAGCAGAAGCCTCATGAGGT TGG (reversed) Intergenic
No off target data available for this crispr