ID: 1135875758

View in Genome Browser
Species Human (GRCh38)
Location 16:26198574-26198596
Sequence GTATCTGCCCTCTCTTAGTC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1135875758_1135875760 -1 Left 1135875758 16:26198574-26198596 CCCGACTAAGAGAGGGCAGATAC No data
Right 1135875760 16:26198596-26198618 CTGCATTCCCAGAATGAAGTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1135875758 Original CRISPR GTATCTGCCCTCTCTTAGTC GGG (reversed) Intergenic
No off target data available for this crispr