ID: 1135875760

View in Genome Browser
Species Human (GRCh38)
Location 16:26198596-26198618
Sequence CTGCATTCCCAGAATGAAGT CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1135875758_1135875760 -1 Left 1135875758 16:26198574-26198596 CCCGACTAAGAGAGGGCAGATAC No data
Right 1135875760 16:26198596-26198618 CTGCATTCCCAGAATGAAGTCGG No data
1135875759_1135875760 -2 Left 1135875759 16:26198575-26198597 CCGACTAAGAGAGGGCAGATACT No data
Right 1135875760 16:26198596-26198618 CTGCATTCCCAGAATGAAGTCGG No data
1135875757_1135875760 0 Left 1135875757 16:26198573-26198595 CCCCGACTAAGAGAGGGCAGATA No data
Right 1135875760 16:26198596-26198618 CTGCATTCCCAGAATGAAGTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1135875760 Original CRISPR CTGCATTCCCAGAATGAAGT CGG Intergenic
No off target data available for this crispr