ID: 1135876047

View in Genome Browser
Species Human (GRCh38)
Location 16:26200927-26200949
Sequence CAGGGTGAAGGCTCTTTTTC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1135876045_1135876047 -8 Left 1135876045 16:26200912-26200934 CCGGCTTTGTTATGTCAGGGTGA No data
Right 1135876047 16:26200927-26200949 CAGGGTGAAGGCTCTTTTTCTGG No data
1135876039_1135876047 15 Left 1135876039 16:26200889-26200911 CCTGGAAGTCCATGATTAGGGGG No data
Right 1135876047 16:26200927-26200949 CAGGGTGAAGGCTCTTTTTCTGG No data
1135876042_1135876047 6 Left 1135876042 16:26200898-26200920 CCATGATTAGGGGGCCGGCTTTG No data
Right 1135876047 16:26200927-26200949 CAGGGTGAAGGCTCTTTTTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1135876047 Original CRISPR CAGGGTGAAGGCTCTTTTTC TGG Intergenic
No off target data available for this crispr