ID: 1135877100

View in Genome Browser
Species Human (GRCh38)
Location 16:26212844-26212866
Sequence ATTTATGTGATCGGGGAGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1135877093_1135877100 7 Left 1135877093 16:26212814-26212836 CCAGCTTGGGAGCCAGATTGCCG No data
Right 1135877100 16:26212844-26212866 ATTTATGTGATCGGGGAGGCTGG No data
1135877091_1135877100 9 Left 1135877091 16:26212812-26212834 CCCCAGCTTGGGAGCCAGATTGC No data
Right 1135877100 16:26212844-26212866 ATTTATGTGATCGGGGAGGCTGG No data
1135877092_1135877100 8 Left 1135877092 16:26212813-26212835 CCCAGCTTGGGAGCCAGATTGCC No data
Right 1135877100 16:26212844-26212866 ATTTATGTGATCGGGGAGGCTGG No data
1135877094_1135877100 -5 Left 1135877094 16:26212826-26212848 CCAGATTGCCGCATAGTGATTTA No data
Right 1135877100 16:26212844-26212866 ATTTATGTGATCGGGGAGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1135877100 Original CRISPR ATTTATGTGATCGGGGAGGC TGG Intergenic