ID: 1135882358

View in Genome Browser
Species Human (GRCh38)
Location 16:26270394-26270416
Sequence CTTGACAAACCCAATGAGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1135882354_1135882358 28 Left 1135882354 16:26270343-26270365 CCAGGCGCTGGTCCACATTATAC No data
Right 1135882358 16:26270394-26270416 CTTGACAAACCCAATGAGGCAGG No data
1135882356_1135882358 -2 Left 1135882356 16:26270373-26270395 CCTTTACATACAATTCTACTTCT No data
Right 1135882358 16:26270394-26270416 CTTGACAAACCCAATGAGGCAGG No data
1135882355_1135882358 16 Left 1135882355 16:26270355-26270377 CCACATTATACTCACATACCTTT No data
Right 1135882358 16:26270394-26270416 CTTGACAAACCCAATGAGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1135882358 Original CRISPR CTTGACAAACCCAATGAGGC AGG Intergenic
No off target data available for this crispr