ID: 1135882553

View in Genome Browser
Species Human (GRCh38)
Location 16:26272653-26272675
Sequence GGTTTAACACAGAAAGAAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1135882553_1135882554 -8 Left 1135882553 16:26272653-26272675 CCTTCTTCTTTCTGTGTTAAACC No data
Right 1135882554 16:26272668-26272690 GTTAAACCCAGTGATTACCTAGG No data
1135882553_1135882560 4 Left 1135882553 16:26272653-26272675 CCTTCTTCTTTCTGTGTTAAACC No data
Right 1135882560 16:26272680-26272702 GATTACCTAGGGAATAGGGCAGG No data
1135882553_1135882558 -1 Left 1135882553 16:26272653-26272675 CCTTCTTCTTTCTGTGTTAAACC No data
Right 1135882558 16:26272675-26272697 CCAGTGATTACCTAGGGAATAGG No data
1135882553_1135882559 0 Left 1135882553 16:26272653-26272675 CCTTCTTCTTTCTGTGTTAAACC No data
Right 1135882559 16:26272676-26272698 CAGTGATTACCTAGGGAATAGGG No data
1135882553_1135882555 -7 Left 1135882553 16:26272653-26272675 CCTTCTTCTTTCTGTGTTAAACC No data
Right 1135882555 16:26272669-26272691 TTAAACCCAGTGATTACCTAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1135882553 Original CRISPR GGTTTAACACAGAAAGAAGA AGG (reversed) Intergenic
No off target data available for this crispr