ID: 1135885801

View in Genome Browser
Species Human (GRCh38)
Location 16:26306322-26306344
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1135885796_1135885801 17 Left 1135885796 16:26306282-26306304 CCAAATTGGCTCACATACTAGAA No data
Right 1135885801 16:26306322-26306344 TTCAGGTACAGCTTGATCCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1135885801 Original CRISPR TTCAGGTACAGCTTGATCCA GGG Intergenic
No off target data available for this crispr